Search result for sequence:
TTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGAGCCACCGCCCGTCCCCGCCCCTTGCCTCTCGGCGCCCCCTCGATGCTCTTAGCTGAGTG
common ontology terms
term enrichment score
TermScore
mild disease course0.230769
state of new hampshire0.230769
cystic fibrosis0.206897
skin0.180451
seoul0.142857
age 20-30 years0.142857
dog0.127273
foodon product type0.126316
mucus0.117647
canis lupus familiaris0.112903
lung0.105263
south korea0.095238
protected brush sampling0.090909
skin of cheek0.090909
skin of forehead0.090909
sinusoidal space0.086957
paranasal sinus0.086957
megaptera novaeangliae0.086957
humpback whale0.086957
antarctic peninsula0.086957
shanghai district0.086957
duodenum0.085714
mucosa0.083333
sinusitis0.083333
state of colorado0.083333
sputum0.083333
antarctica0.080000
oral cavity0.078431
bronchoalveolar lavage0.076923
cat0.074074
south africa0.074074
homo sapiens0.070588
felis catus0.068966
vagina0.068966
united states of america0.066025
mouth0.063492
female0.055300
adult0.050856
blood0.047619
bangkok0.047619
semi domestic dog0.047619
ground beef food product0.047619
ulcer0.047619
wound0.047619
peponocephala electra0.047619
stenella attenuata0.047619
globicephala macrorhynchus0.047619
short finned pilot whale0.047619
balaenoptera borealis0.047619
sei whale0.047619
balaenoptera physalus0.047619
fin whale0.047619
LOWER IN bacterial vaginosis0.047619
LOWER IN age 8-12 years0.047619
conjunctiva0.046512
foot0.046512
diabetes mellitus0.046512
cebus capucinus0.046512
white-faced capuchin0.046512
colon0.046512
LOWER IN supragingival dental plaque0.046512
external acoustic meatus0.045455
ear canal0.045455
thailand0.044444
rectal swab0.044444
LOWER IN supragingival plaque0.044444
msm0.043478
homosexual0.043478
costa rica0.042553
woodland area0.042553
mouth mucosa0.041667
LOWER IN dentition0.041667
male0.040816
hiv infection0.040816
monkey0.040000
rectum0.040000
LOWER IN child0.040000
ileum0.038462
china0.037500
saliva0.035714
australia0.032787
LOWER IN control0.029851
feces0.012500
control0.009950
Fraction of dbbact annotations with this term covered by the query
TermScore
protected brush sampling0.500000
mild disease course0.500000
state of new hampshire0.500000
blood0.500000
bangkok0.500000
semi domestic dog0.500000
ground beef food product0.500000
ulcer0.500000
wound0.500000
skin of cheek0.500000
skin of forehead0.500000
peponocephala electra0.500000
stenella attenuata0.500000
globicephala macrorhynchus0.500000
short finned pilot whale0.500000
balaenoptera borealis0.500000
sei whale0.500000
balaenoptera physalus0.500000
fin whale0.500000
LOWER IN bacterial vaginosis0.500000
LOWER IN age 8-12 years0.500000
foodon product type0.400000
conjunctiva0.333333
cystic fibrosis0.333333
sinusoidal space0.333333
paranasal sinus0.333333
foot0.333333
diabetes mellitus0.333333
megaptera novaeangliae0.333333
humpback whale0.333333
antarctic peninsula0.333333
cebus capucinus0.333333
white-faced capuchin0.333333
colon0.333333
shanghai district0.333333
LOWER IN supragingival dental plaque0.333333
mucosa0.250000
sinusitis0.250000
state of colorado0.250000
sputum0.250000
seoul0.250000
age 20-30 years0.250000
external acoustic meatus0.250000
ear canal0.250000
thailand0.200000
antarctica0.200000
rectal swab0.200000
LOWER IN supragingival plaque0.200000
oral cavity0.181818
bronchoalveolar lavage0.166667
msm0.166667
homosexual0.166667
cat0.142857
mucus0.142857
costa rica0.142857
woodland area0.142857
south africa0.142857
skin0.129032
mouth mucosa0.125000
LOWER IN dentition0.125000
felis catus0.111111
lung0.111111
male0.111111
hiv infection0.111111
vagina0.111111
dog0.100000
duodenum0.100000
monkey0.100000
rectum0.100000
LOWER IN child0.100000
south korea0.090909
mouth0.086957
canis lupus familiaris0.083333
ileum0.083333
australia0.047619
homo sapiens0.037975
united states of america0.034934
female0.033898
saliva0.027778
adult0.027586
china0.022059
LOWER IN control0.018634
feces0.007143
control0.006211
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.600000
homo sapiens0.500000
adult0.325000
skin0.300000
canis lupus familiaris0.175000
dog0.175000
mild disease course0.150000
cystic fibrosis0.150000
state of new hampshire0.150000
female0.150000
china0.125000
lung0.100000
mucus0.100000
seoul0.100000
age 20-30 years0.100000
south korea0.100000
duodenum0.075000
foodon product type0.075000
LOWER IN control0.075000
cat0.050000
felis catus0.050000
protected brush sampling0.050000
bronchoalveolar lavage0.050000
mucosa0.050000
sinusoidal space0.050000
paranasal sinus0.050000
sinusitis0.050000
state of colorado0.050000
sputum0.050000
skin of cheek0.050000
skin of forehead0.050000
megaptera novaeangliae0.050000
humpback whale0.050000
antarctica0.050000
antarctic peninsula0.050000
feces0.050000
oral cavity0.050000
mouth0.050000
south africa0.050000
vagina0.050000
saliva0.050000
shanghai district0.050000
conjunctiva0.025000
blood0.025000
thailand0.025000
bangkok0.025000
semi domestic dog0.025000
ground beef food product0.025000
australia0.025000
foot0.025000
ulcer0.025000
wound0.025000
diabetes mellitus0.025000
external acoustic meatus0.025000
ear canal0.025000
monkey0.025000
cebus capucinus0.025000
costa rica0.025000
white-faced capuchin0.025000
woodland area0.025000
peponocephala electra0.025000
stenella attenuata0.025000
globicephala macrorhynchus0.025000
short finned pilot whale0.025000
ileum0.025000
balaenoptera borealis0.025000
sei whale0.025000
mouth mucosa0.025000
rectal swab0.025000
male0.025000
msm0.025000
homosexual0.025000
hiv infection0.025000
balaenoptera physalus0.025000
fin whale0.025000
colon0.025000
control0.025000
LOWER IN bacterial vaginosis0.025000
rectum0.025000
LOWER IN age 8-12 years0.025000
LOWER IN child0.025000
LOWER IN dentition0.025000
LOWER IN supragingival plaque0.025000
LOWER IN supragingival dental plaque0.025000
Exp. ID User ID Description Date Region Flag Sequences
301amnonhost 18S dna (dog or cat or human) (other canis lupus familiaris, dog, united states of america, duodenum)2018-03-05v4No1 / -7
158amnoncommon cat, felis catus, united states of america, conjunctiva2017-07-06v4No1 / -4
269amnonhigh freq. in fresh yao meat food (dominant china, foodon product type)2018-01-09v4No1 / -4
646amnondominant protected brush sampling, lung, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / -2
646amnoncommon lung, bronchoalveolar lavage, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / -1
646amnondominant lung, bronchoalveolar lavage, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 0
228amnonhigher in chronic sinositis compared to healthy controls in sinus brushing ( high in sinusitis compared to control in homo sapiens mucosa sinusoidal space paranasal sinus united states of america )2017-10-31v4No1 / 0
301amnondominant canis lupus familiaris, dog, united states of america, duodenum2018-03-05v4No1 / 1
646amnoncommon protected brush sampling, lung, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 2
664amnoncommon blood, dog, canis lupus familiaris, thailand, bangkok, semi domestic dog2020-09-22v4No1 / 3
525amnoncommon in ground beef (common united states of america, state of colorado, foodon product type, ground beef food product)2019-07-10v4No1 / 3
232amnonhigher in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in ulcer wound compared to control in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 5
646amnondominant adult, sputum, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 6
749amnondominant seoul, age 20-30 years, female, south korea, adult, skin of cheek, skin, homo sapiens2021-03-10v4No1 / 8
749amnondominant skin of forehead, seoul, age 20-30 years, female, south korea, adult, skin, homo sapiens2021-03-10v4No1 / 10
275amnondominant megaptera novaeangliae, humpback whale, antarctica, antarctic peninsula, skin2018-01-16v4No1 / 11
158amnoncommon cat, felis catus, united states of america, external acoustic meatus, ear canal2017-07-06v4No1 / 14
275amnoncommon megaptera novaeangliae, humpback whale, antarctica, antarctic peninsula, skin2018-01-16v4No1 / 18
228amnoncommon in sinus brush of sinusitis patients (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 19
646amnoncommon adult, sputum, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 25
350amnoncommon in feces of white faced capuchin from costa rica rain forest (common monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v4No1 / 27
79amnoncommon peponocephala electra, skin, united states of america2017-03-03v4No1 / 32
79amnoncommon skin, united states of america, stenella attenuata2017-03-03v4No1 / 32
79amnoncommon skin, united states of america, globicephala macrorhynchus, short finned pilot whale2017-03-03v4No1 / 34
749amnoncommon skin of forehead, seoul, age 20-30 years, female, south korea, adult, skin, homo sapiens2021-03-10v4No1 / 36
749amnoncommon seoul, age 20-30 years, female, south korea, adult, skin of cheek, skin, homo sapiens2021-03-10v4No1 / 36
301amnoncommon canis lupus familiaris, dog, united states of america, duodenum2018-03-05v4No1 / 39
301amnoncommon canis lupus familiaris, dog, united states of america, ileum2018-03-05v4No1 / 61
79amnoncommon skin, united states of america, balaenoptera borealis, sei whale2017-03-03v4No1 / 82
202amnoncommon homo sapiens, mouth mucosa, oral cavity, china, mouth2017-10-01v4No1 / 92
563amnon high in hiv infection compared to control in homo sapiens feces rectal swab united states of america male msm homosexual 2019-11-18v4No1 / 92
213amnoncommon homo sapiens, south africa, vagina2017-10-22v4No1 / 95
79amnoncommon skin, united states of america, balaenoptera physalus, fin whale2017-03-03v4No1 / 97
301amnoncommon canis lupus familiaris, dog, united states of america, colon2018-03-05v4No1 / 97
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 99
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 105
301amnoncommon canis lupus familiaris, dog, united states of america, rectum2018-03-05v4No1 / 108
640amnoncommon saliva, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 109
711amnon high in adult compared to age 8-12 years child in state of colorado united states of america mouth oral cavity homo sapiens 2028-05-21v4No1 / 126
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens shanghai district china adult female 2020-08-22v4No1 / 224

Problems / suggestions? Please email info AT dbbact DOT org