Search result for sequence:
TTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAATTAAAAAGCTTGTAGTTGAATCTTGGGAGCAGGTGGGCTGGTGAGCCACGGCCCATCCCTGCTTCTTGCCTCTCGGTGCCCCCTGGATGCTCTTAGCTGAGTGTCCTCTGGCCC
common ontology terms
term enrichment score
TermScore
sinusoidal space0.363636
paranasal sinus0.307692
trachea0.285714
endotracheal aspirate0.285714
LOWER IN oropharyngeal swab0.285714
acute respiratory failure0.285714
respiratory failure0.285714
sinusitis0.285714
uganda0.285714
tracheal aspirate0.250000
pneumonia0.250000
LOWER IN oropharynx0.222222
bronchial epithelium0.200000
bronchoalveolar lavage0.166667
commonwealth of pennsylvania0.142857
hospital0.133333
lung0.133333
hiv infection0.133333
mucosa0.088889
homo sapiens0.029091
united states of america0.023928
adult0.011236
feces0.006270
Fraction of dbbact annotations with this term covered by the query
TermScore
trachea0.500000
endotracheal aspirate0.500000
LOWER IN oropharyngeal swab0.500000
acute respiratory failure0.500000
respiratory failure0.500000
sinusitis0.500000
uganda0.500000
tracheal aspirate0.333333
sinusoidal space0.333333
pneumonia0.333333
LOWER IN oropharynx0.250000
paranasal sinus0.250000
bronchial epithelium0.200000
bronchoalveolar lavage0.142857
commonwealth of pennsylvania0.111111
hospital0.100000
lung0.100000
hiv infection0.100000
mucosa0.050000
homo sapiens0.014760
united states of america0.012146
adult0.005780
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
united states of america0.800000
mucosa0.400000
paranasal sinus0.400000
sinusoidal space0.400000
feces0.200000
tracheal aspirate0.200000
trachea0.200000
endotracheal aspirate0.200000
LOWER IN oropharynx0.200000
LOWER IN oropharyngeal swab0.200000
hospital0.200000
adult0.200000
commonwealth of pennsylvania0.200000
acute respiratory failure0.200000
respiratory failure0.200000
sinusitis0.200000
lung0.200000
bronchoalveolar lavage0.200000
hiv infection0.200000
bronchial epithelium0.200000
uganda0.200000
pneumonia0.200000

Problems / suggestions? Please email info AT dbbact DOT org