Search result for sequence:
TTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACTTTGGGCCCGGTTGGCCGGTCCGATTTTTTCGTGTACTGGATTTCCAACGGGGCCTTTCCTTCTGGCTAACCTTGAGTCCTTGTGGCTCTTGG
common ontology terms
term enrichment score
TermScore
stuttgart0.500000
wine food product0.500000
saccharomyces cerevisiae0.333333
yeast0.333333
fermented beverage0.333333
gut content0.333333
temp 12c0.333333
LOWER IN warm temperature habitat0.333333
LOWER IN temp 18c0.333333
cold environment0.333333
rainbow trout0.250000
oncorhynchus mykiss0.250000
sweden0.125000
fish0.111111
germany0.095238
digestive system0.062500
research facility0.014925
Fraction of dbbact annotations with this term covered by the query
TermScore
saccharomyces cerevisiae0.500000
yeast0.500000
stuttgart0.500000
wine food product0.500000
gut content0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
cold environment0.500000
fermented beverage0.250000
rainbow trout0.250000
oncorhynchus mykiss0.250000
sweden0.083333
fish0.071429
germany0.052632
digestive system0.035714
research facility0.007692
Fraction of annotations for the query sequences containing the term
TermScore
fermented beverage0.500000
stuttgart0.500000
germany0.500000
wine food product0.500000
saccharomyces cerevisiae0.250000
yeast0.250000
sweden0.250000
fish0.250000
rainbow trout0.250000
oncorhynchus mykiss0.250000
research facility0.250000
digestive system0.250000
gut content0.250000
temp 12c0.250000
LOWER IN warm temperature habitat0.250000
LOWER IN temp 18c0.250000
cold environment0.250000

Problems / suggestions? Please email info AT dbbact DOT org