Summmary for taxonomy:
[clostridium] clostridioforme 90a3
Total dbBact sequences with taxonomy : 3

# exps # anno. Taxonomy Sequence
96164d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG
1638d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCGACGCCGCGTGAGTGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAAATGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA
11d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaCCGCGGTAATACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGG

Annotations for 3 sequences

common ontology terms
term enrichment score
TermScore
gastric carcinoma0.334089
stomach neoplasm0.334089
homo sapiens0.176333
feces0.169128
adult0.126469
infant0.122758
formula fed0.114448
zhejiang province0.111195
crohn's disease0.096918
united states of america0.093319
juvenile0.085432
LOWER IN control0.082199
italy0.080436
biopsy0.078709
germany0.072551
stomach0.070209
colonized germ free0.067911
seattle0.067911
research facility0.064902
china0.063737
ulcerative colitis0.062683
mouse0.057254
child0.056269
12-month-old human stage0.054953
monkey0.054391
mus musculus0.054007
hyplus rabbit0.052264
LOWER IN breast fed0.051977
rabbit0.051977
oryctolagus cuniculus0.051797
clostridium difficile intestinal infectious disease0.050863
age 5 weeks0.048465
terminal ileum0.046449
french republic0.046391
hospital0.046273
state of california0.044803
3-month-old human stage0.043699
cecal content0.043699
sigmoid colon0.040329
clostridium difficile infection0.039532
state of georgia0.039490
caecum0.038218
control0.037262
wild0.036856
kingdom of spain0.036726
cystic fibrosis0.036380
rectal swab0.035976
suckling0.035778
preweaned0.035778
age 2-4 weeks0.035778
cftr s489x0.035778
after hcst0.035778
hematopoietic stem cell transplant0.035778
valladolid0.035778
exclusive breastmilk diet0.035778
punta licosa0.035778
lizard0.035778
podarcis siculus0.035778
large intestine0.035778
juvenile organism0.035730
captive0.034998
chelonia mydas0.034843
green turtle0.034843
age 7 months0.034843
pig0.034727
sus scrofa0.034727
farm0.034033
jiangxi province0.033955
remission0.033955
breast fed0.033955
canada0.033271
ireland0.031545
LOWER IN 1-month-old human stage0.026651
c57bl/60.024096
guangzhou city prefecture0.023857
rat0.023755
age 3-5 weeks0.021235
1-month-old human stage0.020164
hispanic or latin american0.019943
LOWER IN weaned0.018382
LOWER IN corn and soybean diet0.018382
LOWER IN age 4-7 weeks0.018382
taipei city0.018382
low anterior resection0.018382
peromyscus maniculatus0.018382
deer mice0.018382
algonquin provincial park0.018382
before hsct0.018382
rattus rattus0.018382
europe0.018382
LOWER IN cameroon0.018382
LOWER IN age 7 months0.018382
loggerhead sea turtle0.018382
caretta caretta0.018382
age 6-14 years0.018382
solid food diet0.018382
soild food supplemented diet0.018382
LOWER IN licosa island0.018382
ngamba island0.018382
plecturocebus cupreus0.018382
Fraction of dbbact annotations with this term covered by the query
TermScore
juvenile0.444444
terminal ileum0.333333
age 3-5 weeks0.333333
gastric carcinoma0.333333
stomach neoplasm0.333333
suckling0.333333
preweaned0.333333
age 2-4 weeks0.333333
LOWER IN weaned0.333333
LOWER IN corn and soybean diet0.333333
LOWER IN age 4-7 weeks0.333333
taipei city0.333333
low anterior resection0.333333
peromyscus maniculatus0.333333
deer mice0.333333
algonquin provincial park0.333333
cftr s489x0.333333
colonized germ free0.333333
seattle0.333333
before hsct0.333333
after hcst0.333333
hematopoietic stem cell transplant0.333333
rattus rattus0.333333
valladolid0.333333
europe0.333333
LOWER IN cameroon0.333333
LOWER IN age 7 months0.333333
loggerhead sea turtle0.333333
caretta caretta0.333333
age 6-14 years0.333333
exclusive breastmilk diet0.333333
hyplus rabbit0.333333
solid food diet0.333333
soild food supplemented diet0.333333
punta licosa0.333333
lizard0.333333
podarcis siculus0.333333
LOWER IN licosa island0.333333
large intestine0.333333
ngamba island0.333333
plecturocebus cupreus0.333333
titi monkey0.333333
biopsy0.296296
clostridium difficile intestinal infectious disease0.277778
LOWER IN 1-month-old human stage0.277778
crohn's disease0.270833
sigmoid colon0.250000
biopsy site0.250000
bangladesh0.222222
age < 3 years0.222222
chelonia mydas0.222222
green turtle0.222222
age 7 months0.222222
adriatic sea coastal waters of italy0.222222
hangzhou city prefecture0.222222
uganda0.222222
pan troglodytes schweinfurthii0.222222
clostridium difficile infection0.200000
LOWER IN breast fed0.200000
formula fed0.200000
rabbit0.200000
new york county0.166667
chronic fatigue syndrome0.166667
children0.166667
mammalian milk beverage0.166667
shantytown0.166667
lima0.166667
LOWER IN el salado0.166667
LOWER IN small village0.166667
LOWER IN egypt0.166667
LOWER IN plant diet0.166667
13-year-old human stage0.166667
LOWER IN bacterial vaginosis0.166667
LOWER IN wound0.166667
LOWER IN ulcer0.166667
LOWER IN russia0.166667
LOWER IN estonia0.166667
state of oklahoma0.166667
native american0.166667
arapaho0.166667
cheyenne0.166667
epilithic0.166667
little physical activity0.166667
LOWER IN physical activity0.166667
LOWER IN peru0.166667
LOWER IN tunapuco0.166667
12-month-old human stage0.166667
LOWER IN age 2 months0.166667
sixth decade human stage0.166667
nephrolithiasis0.166667
ulcerative colitis0.166667
immature stage0.166667
age<17 years0.166667
spondyloarthritis0.166667
spondylitis0.166667
oslo0.166667
denver0.166667
LOWER IN amerindian0.166667
LOWER IN venezuela0.166667
gangcha region0.166667
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.739394
feces0.545238
adult0.480592
china0.411688
LOWER IN control0.391631
zhejiang province0.334848
stomach0.334848
gastric carcinoma0.334848
stomach neoplasm0.334848
united states of america0.182828
research facility0.133911
infant0.118398
germany0.113420
formula fed0.080159
italy0.066162
mus musculus0.063564
mouse0.063564
crohn's disease0.059019
control0.049567
juvenile0.047258
biopsy0.045382
child0.040115
ulcerative colitis0.038600
colonized germ free0.037807
seattle0.037807
caecum0.035931
monkey0.034416
12-month-old human stage0.032900
oryctolagus cuniculus0.031385
french republic0.031385
LOWER IN breast fed0.029870
rabbit0.029870
state of california0.029149
3-month-old human stage0.028355
age 5 weeks0.028355
hyplus rabbit0.028355
cecal content0.028355
clostridium difficile intestinal infectious disease0.027994
hospital0.027994
farm0.026479
wild0.026479
terminal ileum0.024964
kingdom of spain0.024964
state of georgia0.023449
captive0.023449
canada0.023088
sigmoid colon0.021934
pig0.021934
sus scrofa0.021934
clostridium difficile infection0.021934
rectal swab0.021934
juvenile organism0.020418
cystic fibrosis0.020418
jiangxi province0.018903
suckling0.018903
preweaned0.018903
age 2-4 weeks0.018903
cftr s489x0.018903
chelonia mydas0.018903
green turtle0.018903
after hcst0.018903
hematopoietic stem cell transplant0.018903
remission0.018903
valladolid0.018903
age 7 months0.018903
breast fed0.018903
exclusive breastmilk diet0.018903
punta licosa0.018903
lizard0.018903
podarcis siculus0.018903
large intestine0.018903
ireland0.018903
c57bl/60.016667
LOWER IN 1-month-old human stage0.013997
rat0.013997
guangzhou city prefecture0.013636
age 3-5 weeks0.010967
1-month-old human stage0.010967
australia0.010606
hispanic or latin american0.010606
LOWER IN weaned0.009452
LOWER IN corn and soybean diet0.009452
LOWER IN age 4-7 weeks0.009452
taiwan0.009452
taipei city0.009452
low anterior resection0.009452
peromyscus maniculatus0.009452
deer mice0.009452
province of ontario0.009452
algonquin provincial park0.009452
LOWER IN captive0.009452
LOWER IN research facility0.009452
before hsct0.009452
rattus rattus0.009452
gorilla gorilla0.009452
zoological garden0.009452
europe0.009452
LOWER IN wild0.009452
LOWER IN cameroon0.009452
LOWER IN age 7 months0.009452
Number of experiments associating the term to the sequence
TermScore
feces101.000000
homo sapiens89.000000
united states of america50.000000
adult41.000000
LOWER IN control25.000000
research facility19.000000
china17.000000
control16.000000
infant12.000000
crohn's disease11.000000
child11.000000
mus musculus9.000000
mouse9.000000
state of california8.000000
ulcerative colitis8.000000
biopsy6.000000
caecum5.000000
farm5.000000
monkey5.000000
clostridium difficile intestinal infectious disease4.000000
kingdom of spain4.000000
LOWER IN 1-month-old human stage4.000000
canada4.000000
wild4.000000
captive4.000000
italy4.000000
terminal ileum3.000000
oryctolagus cuniculus3.000000
biopsy site3.000000
australia3.000000
12-month-old human stage3.000000
french republic3.000000
pig3.000000
sus scrofa3.000000
hospital3.000000
rat3.000000
c57bl/63.000000
sigmoid colon2.000000
LOWER IN small village2.000000
bangladesh2.000000
13-year-old human stage2.000000
juvenile organism2.000000
age < 3 years2.000000
state of oklahoma2.000000
state of georgia2.000000
age 3-5 weeks2.000000
hispanic or latin american2.000000
clostridium difficile infection2.000000
guangzhou city prefecture2.000000
LOWER IN breast fed2.000000
formula fed2.000000
1-month-old human stage2.000000
cystic fibrosis2.000000
rabbit2.000000
rectal swab2.000000
juvenile2.000000
germany2.000000
new york county1.000000
chronic fatigue syndrome1.000000
children1.000000
mammalian milk beverage1.000000
shantytown1.000000
lima1.000000
LOWER IN el salado1.000000
LOWER IN egypt1.000000
LOWER IN plant diet1.000000
LOWER IN bacterial vaginosis1.000000
LOWER IN wound1.000000
LOWER IN ulcer1.000000
LOWER IN russia1.000000
LOWER IN estonia1.000000
native american1.000000
arapaho1.000000
cheyenne1.000000
epilithic1.000000
little physical activity1.000000
LOWER IN physical activity1.000000
LOWER IN peru1.000000
LOWER IN tunapuco1.000000
LOWER IN age 2 months1.000000
sixth decade human stage1.000000
nephrolithiasis1.000000
immature stage1.000000
age<17 years1.000000
spondyloarthritis1.000000
spondylitis1.000000
oslo1.000000
denver1.000000
LOWER IN amerindian1.000000
LOWER IN venezuela1.000000
gangcha region1.000000
zhejiang province1.000000
stomach1.000000
gastric carcinoma1.000000
stomach neoplasm1.000000
jiangxi province1.000000
suckling1.000000
preweaned1.000000
age 2-4 weeks1.000000
LOWER IN weaned1.000000
LOWER IN corn and soybean diet1.000000
LOWER IN age 4-7 weeks1.000000
taiwan1.000000
taipei city1.000000
low anterior resection1.000000
peromyscus maniculatus1.000000
deer mice1.000000
province of ontario1.000000
algonquin provincial park1.000000
LOWER IN captive1.000000
LOWER IN research facility1.000000
cftr s489x1.000000
colonized germ free1.000000
seattle1.000000
chelonia mydas1.000000
green turtle1.000000
before hsct1.000000
after hcst1.000000
hematopoietic stem cell transplant1.000000
rattus rattus1.000000
remission1.000000
valladolid1.000000
gorilla gorilla1.000000
zoological garden1.000000
europe1.000000
LOWER IN wild1.000000
LOWER IN cameroon1.000000
3-month-old human stage1.000000
age 7 months1.000000
LOWER IN age 7 months1.000000
breast fed1.000000
adriatic sea coastal waters of italy1.000000
loggerhead sea turtle1.000000
caretta caretta1.000000
age 6-14 years1.000000
hangzhou city prefecture1.000000
age 5 weeks1.000000
exclusive breastmilk diet1.000000
hyplus rabbit1.000000
cecal content1.000000
solid food diet1.000000
soild food supplemented diet1.000000
punta licosa1.000000
lizard1.000000
podarcis siculus1.000000
LOWER IN licosa island1.000000
large intestine1.000000
ireland1.000000
ngamba island1.000000
uganda1.000000
pan troglodytes schweinfurthii1.000000
plecturocebus cupreus1.000000
titi monkey1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
655amnoncommon in patients after hematopoietic stem cell transplant (common after hcst, hematopoietic stem cell transplant, italy, feces, homo sapiens)2020-09-13v32 / 10approvedNo
797amnon high in 12-month-old human stage compared to age 7 months in breast fed germany infant homo sapiens feces 2021-06-13v32 / 15approvedNo
728amnoncommon clostridium difficile infection, adult, hospital, valladolid, kingdom of spain, clostridium difficile intestinal infectious disease, feces, homo sapiens2021-01-05v32 / 16approvedNo
981amnondominant monkey, rectal swab, plecturocebus cupreus, titi monkey, captive, united states of america, state of california2022-12-25v32 / 17approvedNo
713amnondominant remission, crohn's disease, feces, homo sapiens2028-05-21v32 / 18approvedNo
619amnondominant cystic fibrosis, cftr s489x, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v32 / 20approvedNo
797amnondominant age 7 months, formula fed, infant, germany, homo sapiens, feces2021-06-13v32 / 20approvedNo
797amnondominant 3-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v32 / 20approvedNo
728amnondominant clostridium difficile infection, adult, hospital, valladolid, kingdom of spain, clostridium difficile intestinal infectious disease, feces, homo sapiens2021-01-05v32 / 21approvedNo
853amnondominant solid food diet, soild food supplemented diet, hyplus rabbit, age 5 weeks, juvenile, caecum, rabbit, cecal content, french republic, oryctolagus cuniculus, research facility2021-12-20v32 / 21approvedNo
619amnondominant control, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v32 / 22approvedNo
655amnondominant in patients after hematopoietic stem cell transplant (dominant after hcst, hematopoietic stem cell transplant, italy, feces, homo sapiens)2020-09-13v32 / 22approvedNo
713amnoncommon remission, crohn's disease, feces, homo sapiens2028-05-21v32 / 22approvedNo
797amnoncommon 12-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v32 / 23approvedNo
641amnoncommon united states of america, state of georgia, research facility, juvenile organism, juvenile, feces, chelonia mydas, green turtle2020-08-23v32 / 24approvedNo
641amnondominant united states of america, state of georgia, research facility, juvenile organism, juvenile, feces, chelonia mydas, green turtle2020-08-23v32 / 24approvedNo
853amnondominant exclusive breastmilk diet, hyplus rabbit, age 5 weeks, juvenile, rabbit, cecal content, french republic, oryctolagus cuniculus, caecum, research facility2021-12-20v32 / 24approvedNo
714amnondominant germany, biopsy, sigmoid colon, terminal ileum, homo sapiens2028-05-21v32 / 25approvedNo
655amnoncommon in patients before hematopoietic stem cell transplant (common before hsct, italy, feces, homo sapiens)2020-09-13v32 / 31approvedNo
797amnon high in formula fed compared to breast fed in age 7 months germany infant feces homo sapiens 2021-06-13v32 / 31approvedNo
797amnon high in 3-month-old human stage compared to 1-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v32 / 39approvedNo
714amnoncommon germany, biopsy, sigmoid colon, terminal ileum, homo sapiens2028-05-21v32 / 40approvedNo
825amnoncommon control, age 6-14 years, hangzhou city prefecture, china, child, homo sapiens, feces2021-08-12v32 / 40approvedNo
797amnoncommon 2-year-old human stage, breast fed, child, germany, homo sapiens, feces2021-06-13v32 / 50approvedNo
797amnon high in 12-month-old human stage infant compared to 2-year-old human stage child in formula fed germany homo sapiens feces 2021-06-13v32 / 52approvedNo
944amnon high in crohn's disease crohn's disease compared to control in large intestine biopsy adult ireland 2022-11-26v32 / 54approvedNo
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in israel research facility mouse mus musculus feces antibiotic )2018-10-23v41 / 3approvedNo
944amnon high in ulcerative colitis ulcerative colitis compared to control in large intestine biopsy adult ireland 2022-11-26v32 / 60approvedNo
619amnoncommon control, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v32 / 61approvedNo
619amnoncommon cystic fibrosis, cftr s489x, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v32 / 64approvedNo
394amnon high in ulcerative colitis compared to control in homo sapiens feces adult united states of america state of california 2018-11-06v41 / 8approvedNo
294amnon high in irritable bowel syndrome compared to control in homo sapiens feces adult kingdom of spain 2018-02-09v41 / 9approvedNo
797amnon high in formula fed compared to breast fed in 1-month-old human stage germany infant feces homo sapiens 2021-06-13v32 / 69approvedNo
629amnon high in acquired immunodeficiency syndrome hiv infection compared to control in adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v41 / 10approvedNo
810amnoncommon in sea turtle feces from sea turtle rescue center (common adriatic sea coastal waters of italy, feces, mediterranean sea, research facility, italy, loggerhead sea turtle, caretta caretta)2021-06-22v32 / 72approvedNo
689amnoncommon non c. diff diarrhea, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v41 / 12approvedNo
797amnon high in formula fed compared to breast fed in 3-month-old human stage germany infant feces homo sapiens 2021-06-13v32 / 75approvedNo
502amnon high in schizophrenia compared to control in homo sapiens feces adult united states of america 2019-03-12v41 / 13approvedNo
51amnonlower in stool compared to biopsies ( high in biopsy site biopsy compared to feces in homo sapiens united states of america )2017-01-19v41 / 14approvedNo
185amnoncommon in patients with c. diff infection before treatment (common homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v41 / 14approvedNo
779amnon high in crohn's disease compared to control in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v41 / 15approvedNo
94amnoncommon homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v41 / 16approvedNo
395amnonhigher in kids with ibd compared to healthy donors ( high in child ulcerative colitis inflammatory bowel disease crohn's disease compared to control in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v41 / 16approvedNo
659amnon high in before antibiotics compared to doxycycline metronidazole amoxicillin vancomycin antibiotic in ulcerative colitis acute severe colitis homo sapiens child feces 2020-09-19v41 / 16approvedNo
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v41 / 17approvedNo
12amnon high in chronic fatigue syndrome compared to control in homo sapiens feces new york county 2016-11-02v41 / 18approvedNo
330amnon high in infant age 1 year compared to fourth decade human stage adult in homo sapiens feces kingdom of norway oslo 2018-05-13v41 / 19approvedNo
689amnoncommon clostridium difficile infection, clostridium difficile colitis, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v41 / 19approvedNo
866amnon high in crohn's disease crohn's disease compared to control in human adult stage adult united states of america homo sapiens feces 2022-02-08v41 / 19approvedNo
292amnondominant homo sapiens, adult, feces, crohn's disease, china2018-02-05v41 / 20approvedNo
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in homo sapiens feces infant )2016-12-01v41 / 21approvedNo
779amnondominant crohn's disease, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v41 / 21approvedNo
859amnoncommon formula fed, 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v41 / 21approvedNo
94amnondominant homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v41 / 22approvedNo
185amnonhigh freq. in patients with c. diff infection before treatment (dominant homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v41 / 22approvedNo
689amnondominant clostridium difficile infection, clostridium difficile colitis, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v41 / 22approvedNo
779amnoncommon crohn's disease, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v41 / 22approvedNo
859amnondominant 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, formula fed, state of california, infant, homo sapiens, feces2022-01-12v41 / 22approvedNo
241amnoncommon in babies age < 3 years in finland (common homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v41 / 23approvedNo
779amnondominant ulcerative colitis, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v41 / 23approvedNo
853amnoncommon age 5 weeks, exclusive breastmilk diet, hyplus rabbit, juvenile, rabbit, cecal content, french republic, oryctolagus cuniculus, caecum, research facility2021-12-20v32 / 96approvedNo
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in homo sapiens feces australia hospital diarrhea )2018-11-04v41 / 24approvedNo
541amnonlower in koalas eating Eucalyptus obliqua leaves comapred to Eucalyptus viminalis ( high in eucalyptus viminalis eucalyptus viminalis diet compared to eucalyptus obliqua eucalyptus obliqua diet in phascolarctos cinereus koala feces australia wild cape otway )2019-08-01v41 / 24approvedNo
959amnondominant homo sapiens, feces, child, 6-12 year-old child stage, adolescent stage, united states of america, state of california, los angeles, ulcerative colitis, ulcerative colitis2022-12-19v41 / 24approvedNo
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, ulcerative colitis, inflammatory bowel disease, crohn's disease2018-11-14v41 / 25approvedNo
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v41 / 25approvedNo
779amnoncommon ulcerative colitis, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v41 / 25approvedNo
399amnondominant feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v41 / 27approvedNo
399amnon high in crohn's disease compared to control in feces united states of america homo sapiens 2018-11-16v41 / 27approvedNo
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v41 / 30approvedNo
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v41 / 30approvedNo
390amnoncommon homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v41 / 31approvedNo
404amnonnegatively correlated with fiber intake ( high in low fiber compared to plant fiber cell high fiber in homo sapiens feces adult colombia city )2018-11-20v41 / 32approvedNo
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v41 / 34approvedNo
284amnon high in 12-month-old human stage compared to age 2 months in homo sapiens female feces state of california infant 2018-01-27v41 / 35approvedNo
669amnoncommon 12-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v41 / 35approvedNo
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v41 / 36approvedNo
233amnon high in 1-year-old human stage age compared to under-1-year-old human stage in feces homo sapiens infant united states of america 2017-11-05v41 / 37approvedNo
390amnoncommon homo sapiens, feces, australia, hospital, diarrhea2018-11-04v41 / 38approvedNo
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v41 / 39approvedNo
959amnoncommon ulcerative colitis, ulcerative colitis, los angeles, state of california, united states of america, adolescent stage, 6-12 year-old child stage, child, feces, homo sapiens2022-12-19v41 / 39approvedNo
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v41 / 40approvedNo
859amnon high in formula fed compared to breast fed in los angeles district state of california hispanic hispanic or latin american 6-month-old human stage infant feces homo sapiens 2022-01-12v41 / 41approvedNo
876amnon high in age 1 week neonate compared to age 20 months juvenile organism in monkey state of washington macaca mulatta research facility united states of america feces 2022-03-06v41 / 43approvedNo
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v41 / 44approvedNo
1017amnoncommon calgary, canada, human adult stage, adult, rectal swab, homo sapiens, intensive care unit admission, critical illness, disease2023-04-02v41 / 44approvedNo
241amnonhigher in babies from finland compared to estonia ( high in finland compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v41 / 45approvedNo
273amnoncommon 1-year-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v41 / 46approvedNo
428amnon high in pancreatitis acute pancreatitis compared to control in homo sapiens adult feces nanchang city prefecture china 2018-12-09v41 / 46approvedNo
591amnoncommon human late adulthood stage, homo sapiens, feces, adult, united states of america, parkinson's disease2020-02-17v41 / 47approvedNo
779amnoncommon control, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v41 / 47approvedNo
651amnoncommon parkinson's disease, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v41 / 49approvedNo
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v41 / 50approvedNo
650amnoncommon african american, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v41 / 52approvedNo
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v41 / 53approvedNo
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v41 / 53approvedNo
981amnoncommon rectal swab, ngamba island, uganda, chimpanzee, pan troglodytes schweinfurthii, wild, monkey2022-12-25v32 / 157approvedNo
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in sixth decade human stage homo sapiens feces adult nanning city prefecture china )2018-01-27v41 / 54approvedNo
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v41 / 55approvedNo
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v41 / 56approvedNo
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v41 / 56approvedNo
591amnoncommon human late adulthood stage, homo sapiens, feces, adult, united states of america, control2020-02-17v41 / 56approvedNo
650amnon high in female compared to male in feces adult homo sapiens united states of america state of new york 2020-09-10v41 / 57approvedNo
651amnoncommon control, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v41 / 58approvedNo
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in homo sapiens feces united states of america )2017-12-04v41 / 59approvedNo
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v32 / 169approvedNo
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v41 / 61approvedNo
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v32 / 172approvedNo
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v41 / 63approvedNo
671amnon high in age 1 month compared to 3-month-old human stage in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v41 / 64approvedNo
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v41 / 65approvedNo
448amnoncommon equus caballus, horse, feces, farm, equine grass sickness, disease, united kingdom2019-01-08v41 / 65approvedNo
895amnoncommon 6-12 year-old child stage, cystic fibrosis, bordeaux, french republic, child, feces, homo sapiens2022-04-16v41 / 65approvedNo
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-15v41 / 68approvedNo
902amnoncommon antibiotics induced colitis, antibiotic, colitis, colitis, adult organism, horse, equus caballus, united states of america, feces2022-05-02v41 / 68approvedNo
644amnon high in female compared to male in adult united states of america hispanic or latin american feces homo sapiens 2020-08-31v41 / 69approvedNo
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in indomethacin non-steroidal anti-inflammatory drug compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v41 / 72approvedNo
448amnon high in equine grass sickness disease compared to control in equus caballus horse feces farm united kingdom 2019-01-08v41 / 72approvedNo
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus viminalis diet2019-08-01v41 / 72approvedNo
859amnon high in 6-month-old human stage compared to 1-month-old human stage in hispanic los angeles district hispanic or latin american state of california infant homo sapiens feces 2022-01-12v41 / 72approvedNo
438amnonhigher in kindergarten compared to primary and middle school kids ( high in 2-5 year-old child stage age 3-6 compared to 14-year-old human stage 13-year-old human stage 6-12 year-old child stage age 8-12 age 13-14 in homo sapiens feces china )2018-12-30v41 / 76approvedNo
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v41 / 77approvedNo
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus obliqua diet2019-08-01v41 / 77approvedNo
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v41 / 77approvedNo
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet + inulin2020-02-10v41 / 78approvedNo
974amnoncommon in feces of marmosets reintroduced to the wild (common anal swab, captive, brazil, feces, marmosets, callithrix <genus>, monkey)2022-12-24v41 / 78approvedNo
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic neomycin ampicillin compared to control in rat rattus norvegicus sprague dawley feces caecum research facility switzerland )2018-12-20v41 / 80approvedNo
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v41 / 81approvedNo
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v41 / 82approvedNo
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v32 / 214approvedNo
590amnoncommon china, red-eared slider turtle, trachemys scripta elegans, age 3-5 weeks, intestine, turtle farm, farm, hainan autonomous prefecture2020-02-10v41 / 83approvedNo
959amnoncommon control, los angeles, state of california, united states of america, adolescent stage, 6-12 year-old child stage, child, feces, homo sapiens2022-12-19v41 / 83approvedNo
249amnoncommon homo sapiens, feces, united states of america2017-11-22v41 / 86approvedNo
841amnoncommon feces, human adult stage, state of texas, adult, united states of america, homo sapiens2021-11-08v41 / 86approvedNo
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v41 / 88approvedNo
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, perianal skin, rectum2020-01-22v41 / 88approvedNo
884amnoncommon state of california, united states of america, human adult stage, adult, feces, homo sapiens2022-03-24v41 / 88approvedNo
958amnoncommon mexico, mexican american, state of texas, united states of america, adult, homo sapiens, feces2022-12-19v41 / 91approvedNo
601amnoncommon homo sapiens, feces, china, adult, control2020-03-30v41 / 93approvedNo
1017amnoncommon control, calgary, canada, human adult stage, adult, rectal swab, homo sapiens2023-04-02v41 / 101approvedNo
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada ileum terminal ileum 2019-07-29v41 / 104approvedNo
215amnoncommon homo sapiens, feces, united states of america2017-10-23v41 / 107approvedNo
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v41 / 107approvedNo
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada colon right colon 2019-07-29v41 / 108approvedNo
438amnoncommon 2-5 year-old child stage, homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v41 / 109approvedNo
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v41 / 110approvedNo
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v41 / 114approvedNo
239amnoncommon homo sapiens, feces, united states of america2017-11-08v41 / 117approvedNo
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v41 / 118approvedNo
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v41 / 118approvedNo
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v41 / 120approvedNo
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v41 / 120approvedNo
438amnoncommon tenth decade human stage, ninth decade human stage, feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v41 / 121approvedNo
927amnoncommon punta licosa, lizard, podarcis siculus, italy, feces2022-08-15v32 / 305approvedNo
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, colon, right colon, taconic farms2019-07-30v41 / 130approvedNo
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, ileum, terminal ileum2019-07-30v41 / 132approvedNo
438amnoncommon 14-year-old human stage, 13-year-old human stage, homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v41 / 134approvedNo
644amnonlower in individuals born in mexico compared to cuba ( high in cuba compared to mexico in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v41 / 134approvedNo
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v41 / 135approvedNo
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada feces 2019-07-29v41 / 135approvedNo
10amnoncommon homo sapiens, feces, toronto2016-10-27v41 / 138approvedNo
132amnoncommon homo sapiens, feces, united states of america2017-04-16v41 / 145approvedNo
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v41 / 148approvedNo
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v32 / 347approvedNo
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v41 / 149approvedNo
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, mouse chow, low fat diet, united states of america, state of georgia2020-02-10v41 / 151approvedNo
866amnoncommon restraint stress, stress, mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v41 / 152approvedNo
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to captive research facility in feces canada peromyscus maniculatus deer mice age 3-5 weeks province of ontario algonquin provincial park )2019-07-28v32 / 358approvedNo
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v41 / 162approvedNo
297amnoncommon adolescent stage, immature stage, homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v41 / 162approvedNo
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v41 / 168approvedNo
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v41 / 169approvedNo
123amnon high in high fat diet diet compared to normal diet mouse chow in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v41 / 170approvedNo
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v41 / 171approvedNo
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v41 / 172approvedNo
960amnon high in 18-month-old human stage infant compared to female adult in homo sapiens nigeria edo state feces 2022-12-20v41 / 178approvedNo
666amnoncommon rattus rattus, rat, italy, feces2020-09-25v32 / 406approvedNo
179amnoncommon mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v41 / 183approvedNo
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v41 / 184approvedNo
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v41 / 185approvedNo
197amnon high in india compared to finland in 13-year-old human stage feces homo sapiens obsolete_juvenile stage juvenile organism 2017-09-12v41 / 189approvedNo
389amnon high in age 1-3 weeks compared to age 4 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v41 / 189approvedNo
866amnoncommon control, mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v41 / 193approvedNo
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v41 / 197approvedNo
120amnoncommon homo sapiens, feces, brazil2017-04-12v41 / 208approvedNo
669amnon high in 12-month-old human stage compared to 2-month-old human stage in sweden infant feces homo sapiens 2020-09-26v41 / 212approvedNo
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v41 / 216approvedNo
671amnon high in state of california compared to state of oregon in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v41 / 217approvedNo
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v41 / 218approvedNo
566amnoncommon feces, china, homo sapiens, adult2019-11-24v41 / 221approvedNo
902amnon high in salmonella gastroenteritis salmonellosis compared to control in adult organism horse equus caballus united states of america feces 2022-05-02v41 / 226approvedNo
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v41 / 227approvedNo
927amnon high in punta licosa compared to licosa island in lizard podarcis siculus italy feces 2022-08-15v32 / 509approvedNo
25amnon high in antibiotic compared to control in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v41 / 231approvedNo
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v41 / 236approvedNo
286amnoncommon in feces of individuals with kidney stones (common sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, nephrolithiasis, china)2018-01-27v41 / 239approvedNo
960amnon high in 9-month-old human stage compared to 1-month-old human stage in homo sapiens nigeria edo state infant feces 2022-12-20v41 / 244approvedNo
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v41 / 263approvedNo
286amnoncommon in feces of individuals without kidney stones (common sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, control, china)2018-01-27v41 / 281approvedNo
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v41 / 295approvedNo
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to metronidazole neomycin vancomycin antibiotic in state of california united states of america adult feces homo sapiens )2028-03-04v41 / 301approvedNo
729amnon high in captive zoological garden europe compared to wild cameroon in gorilla gorilla monkey feces 2021-01-05v32 / 656approvedNo
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v41 / 319approvedNo
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v41 / 343approvedNo
891amnon high in 1-year-old human stage compared to under-1-year-old human stage in urban slum infant stage dhaka bangladesh infant homo sapiens feces 2022-04-03v41 / 363approvedNo
902amnon high in colitis colitis antibiotics induced colitis antibiotic compared to control in adult organism horse equus caballus united states of america feces 2022-05-02v41 / 364approvedNo
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v41 / 373approvedNo
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-04v41 / 384approvedNo
582amnon high in perianal skin rectum compared to ear canal external acoustic meatus in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v41 / 400approvedNo
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v41 / 417approvedNo
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v41 / 422approvedNo
438amnonhigher in centenarians compared to adults ( high in tenth decade human stage ninth decade human stage age >94 compared to fifth decade human stage fourth decade human stage 65-79 year-old human stage in homo sapiens feces china )2018-12-30v41 / 474approvedNo
650amnon high in european caucasian compared to asian in feces adult homo sapiens united states of america state of new york 2020-09-12v41 / 475approvedNo
657amnoncommon research facility, china, qinghai province, rumen liquid, rumen, age < 1 year, lamb, sheep, ovis aries2020-09-13v41 / 517approvedNo
273amnon high in 1-year-old human stage age compared to 1-month-old human stage in feces homo sapiens kingdom of denmark infant 2018-01-14v41 / 557approvedNo
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in 1-year-old human stage age compared to under-1-year-old human stage in homo sapiens feces infant finland )2017-11-12v41 / 567approvedNo
372amnon high in mouse chow compared to high fat diet in mouse mus musculus feces research facility united states of america 2018-09-07v41 / 579approvedNo
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v41 / 836approvedNo
252amnoncommon in river rock biofilm (common biofilm, kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v41 / 1081approvedNo
916amnon high in farm2 compared to farm1 in rabbit age 2 months kingdom of spain oryctolagus cuniculus caecum research facility 2022-07-04v41 / 1191approvedNo

Problems / suggestions? Please email info AT dbbact DOT org