Summmary for taxonomy:
[clostridium] clostridioforme wal-7855
Total dbBact sequences with taxonomy : 3

# exps # anno. Taxonomy Sequence
88149d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG
1433d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCGACGCCGCGTGAGTGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAAATGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA
11d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaCCGCGGTAATACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGG

Annotations for 3 sequences

common ontology terms
term enrichment score
TermScore
gastric carcinoma0.334227
stomach neoplasm0.334227
homo sapiens0.195067
feces0.187754
zhejiang province0.148324
infant0.136359
formula fed0.133242
adult0.132927
united states of america0.091715
colonized germ free0.083262
seattle0.083262
germany0.082451
LOWER IN control0.080503
china0.078169
crohn's disease0.077884
italy0.077470
stomach0.074118
age 1 year0.070419
mouse0.062964
research facility0.062530
LOWER IN breast fed0.061487
clostridium difficile intestinal infectious disease0.061439
child0.059181
biopsy0.058759
mus musculus0.058655
terminal ileum0.056649
hospital0.054865
age 3 months0.051911
sigmoid colon0.050587
clostridium difficile infection0.049339
state of georgia0.048437
suckling0.044404
preweaned0.044404
age 2-4 weeks0.044404
cftr s489x0.044404
juvenile0.044404
after hcst0.044404
hematopoietic stem cell transplant0.044404
valladolid0.044404
age 7 months0.044404
breast fed0.044404
juvenile organism0.044350
chelonia mydas0.042973
green turtle0.042973
remission0.042973
farm0.041634
jiangxi province0.041631
pig0.041207
sus scrofa0.041207
kingdom of spain0.040576
cystic fibrosis0.040371
control0.038129
canada0.035292
wild0.030325
ulcerative colitis0.030075
guangzhou city prefecture0.028777
age 1 month0.028731
rat0.028610
monkey0.026806
age 3-5 weeks0.026291
captive0.024507
LOWER IN weaned0.022967
LOWER IN corn and soybean diet0.022967
LOWER IN age 4-7 weeks0.022967
taipei city0.022967
low anterior resection0.022967
peromyscus maniculatus0.022967
deer mice0.022967
algonquin provincial park0.022967
before hsct0.022967
rattus rattus0.022967
europe0.022967
LOWER IN cameroon0.022967
LOWER IN age 7 months0.022967
adriatic sea coastal waters of italy0.022967
loggerhead sea turtle0.022967
caretta caretta0.022967
age 6-14 years0.022967
hangzhou city prefecture0.022967
c57bl/60.022857
province of ontario0.022578
LOWER IN age 1 month0.022578
LOWER IN age 2 years0.022578
taiwan0.022202
age 2 years0.022202
gorilla gorilla0.021486
mediterranean sea0.021486
LOWER IN captive0.021146
LOWER IN research facility0.021146
rectum0.019900
obsolete_juvenile stage0.019900
australia0.019663
LOWER IN child0.019592
LOWER IN wild0.019308
city0.019157
age 8 weeks0.019048
taconic farms0.019048
zoological garden0.018765
age < 3 years0.017227
finland0.016380
Fraction of dbbact annotations with this term covered by the query
TermScore
terminal ileum0.333333
sigmoid colon0.333333
age 3-5 weeks0.333333
gastric carcinoma0.333333
stomach neoplasm0.333333
suckling0.333333
preweaned0.333333
age 2-4 weeks0.333333
LOWER IN weaned0.333333
LOWER IN corn and soybean diet0.333333
LOWER IN age 4-7 weeks0.333333
taipei city0.333333
low anterior resection0.333333
peromyscus maniculatus0.333333
deer mice0.333333
algonquin provincial park0.333333
cftr s489x0.333333
colonized germ free0.333333
seattle0.333333
juvenile0.333333
before hsct0.333333
after hcst0.333333
hematopoietic stem cell transplant0.333333
rattus rattus0.333333
valladolid0.333333
europe0.333333
LOWER IN cameroon0.333333
age 7 months0.333333
LOWER IN age 7 months0.333333
breast fed0.333333
adriatic sea coastal waters of italy0.333333
loggerhead sea turtle0.333333
caretta caretta0.333333
age 6-14 years0.333333
hangzhou city prefecture0.333333
biopsy0.285714
crohn's disease0.277778
clostridium difficile intestinal infectious disease0.277778
biopsy site0.250000
clostridium difficile infection0.250000
age < 3 years0.222222
state of oklahoma0.222222
LOWER IN age 2 months0.222222
ulcerative colitis0.222222
province of ontario0.222222
chelonia mydas0.222222
green turtle0.222222
remission0.222222
LOWER IN breast fed0.222222
formula fed0.222222
LOWER IN age 1 month0.222222
LOWER IN age 2 years0.222222
age 1 month0.200000
new york county0.166667
chronic fatigue syndrome0.166667
children0.166667
mammalian milk beverage0.166667
shantytown0.166667
lima0.166667
LOWER IN el salado0.166667
LOWER IN small village0.166667
LOWER IN egypt0.166667
glasgow0.166667
LOWER IN plant diet0.166667
bangladesh0.166667
age 130.166667
juvenile organism0.166667
LOWER IN bacterial vaginosis0.166667
LOWER IN wound0.166667
LOWER IN ulcer0.166667
age > 1 year0.166667
LOWER IN russia0.166667
LOWER IN estonia0.166667
native american0.166667
arapaho0.166667
cheyenne0.166667
epilithic0.166667
little physical activity0.166667
LOWER IN physical activity0.166667
age one year0.166667
LOWER IN age one month0.166667
LOWER IN peru0.166667
LOWER IN tunapuco0.166667
LOWER IN rural community0.166667
age 1 year0.166667
age 50-60 years0.166667
nanning city prefecture0.166667
nephrolithiasis0.166667
irritable bowel syndrome0.166667
age<17 years0.166667
spondyloarthritis0.166667
spondylitis0.166667
oslo0.166667
LOWER IN age 30-400.166667
denver0.166667
LOWER IN amerindian0.166667
LOWER IN hunter gatherer0.166667
LOWER IN venezuela0.166667
gangcha region0.166667
LOWER IN gannan tibetan autonomous prefecture0.166667
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.798143
feces0.605246
adult0.476540
china0.428152
LOWER IN control0.374552
zhejiang province0.335125
stomach0.335125
gastric carcinoma0.335125
stomach neoplasm0.335125
united states of america0.186054
germany0.142717
infant0.133920
research facility0.122678
formula fed0.095145
mus musculus0.074454
mouse0.074454
italy0.059466
control0.055393
colonized germ free0.047572
seattle0.047572
crohn's disease0.045292
age 1 year0.044640
child0.041707
LOWER IN breast fed0.035679
age 3 months0.035679
clostridium difficile intestinal infectious disease0.034539
hospital0.034539
biopsy0.032747
farm0.032747
terminal ileum0.030955
kingdom of spain0.029163
state of georgia0.029163
sigmoid colon0.027370
pig0.027370
sus scrofa0.027370
clostridium difficile infection0.027370
juvenile organism0.025578
canada0.024438
jiangxi province0.023786
suckling0.023786
preweaned0.023786
age 2-4 weeks0.023786
cystic fibrosis0.023786
cftr s489x0.023786
juvenile0.023786
chelonia mydas0.023786
green turtle0.023786
after hcst0.023786
hematopoietic stem cell transplant0.023786
remission0.023786
valladolid0.023786
age 7 months0.023786
breast fed0.023786
wild0.020854
rat0.017269
ulcerative colitis0.016129
c57bl/60.016129
guangzhou city prefecture0.016129
age 1 month0.015477
monkey0.015477
captive0.015477
age 3-5 weeks0.013685
australia0.012545
LOWER IN weaned0.011893
LOWER IN corn and soybean diet0.011893
LOWER IN age 4-7 weeks0.011893
taiwan0.011893
taipei city0.011893
low anterior resection0.011893
peromyscus maniculatus0.011893
deer mice0.011893
province of ontario0.011893
algonquin provincial park0.011893
LOWER IN captive0.011893
LOWER IN research facility0.011893
before hsct0.011893
rattus rattus0.011893
gorilla gorilla0.011893
zoological garden0.011893
europe0.011893
LOWER IN wild0.011893
LOWER IN cameroon0.011893
LOWER IN age 1 month0.011893
LOWER IN age 7 months0.011893
LOWER IN child0.011893
LOWER IN age 2 years0.011893
age 2 years0.011893
adriatic sea coastal waters of italy0.011893
mediterranean sea0.011893
loggerhead sea turtle0.011893
caretta caretta0.011893
age 6-14 years0.011893
hangzhou city prefecture0.011893
rectum0.010753
city0.010753
obsolete_juvenile stage0.010753
age 8 weeks0.010753
taconic farms0.010753
diarrhea0.008961
finland0.008961
Exp. ID User ID Description Date Region Flag Sequences
655amnoncommon in patients after hematopoietic stem cell transplant (common after hcst, hematopoietic stem cell transplant, italy, feces, homo sapiens)2020-09-13v3No2 / 10
797amnon high in age 1 year compared to age 7 months in breast fed germany infant homo sapiens feces 2021-06-13v3No2 / 15
728amnoncommon clostridium difficile infection, adult, hospital, valladolid, kingdom of spain, clostridium difficile intestinal infectious disease, feces, homo sapiens2021-01-05v3No2 / 16
713amnondominant remission, crohn's disease, feces, homo sapiens2028-05-21v3No2 / 18
619amnondominant cystic fibrosis, cftr s489x, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No2 / 20
797amnondominant age 7 months, formula fed, infant, germany, homo sapiens, feces2021-06-13v3No2 / 20
797amnondominant formula fed, age 3 months, infant, germany, homo sapiens, feces2021-06-13v3No2 / 20
728amnondominant clostridium difficile infection, adult, hospital, valladolid, kingdom of spain, clostridium difficile intestinal infectious disease, feces, homo sapiens2021-01-05v3No2 / 21
619amnondominant control, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No2 / 22
655amnondominant in patients after hematopoietic stem cell transplant (dominant after hcst, hematopoietic stem cell transplant, italy, feces, homo sapiens)2020-09-13v3No2 / 22
713amnoncommon remission, crohn's disease, feces, homo sapiens2028-05-21v3No2 / 22
797amnoncommon formula fed, age 1 year, infant, germany, homo sapiens, feces2021-06-13v3No2 / 23
641amnoncommon united states of america, state of georgia, research facility, juvenile organism, juvenile, feces, chelonia mydas, green turtle2020-08-23v3No2 / 24
641amnondominant united states of america, state of georgia, research facility, juvenile organism, juvenile, feces, chelonia mydas, green turtle2020-08-23v3No2 / 24
714amnondominant germany, biopsy, sigmoid colon, terminal ileum, homo sapiens2028-05-21v3No2 / 25
655amnoncommon in patients before hematopoietic stem cell transplant (common before hsct, italy, feces, homo sapiens)2020-09-13v3No2 / 31
797amnon high in formula fed compared to breast fed in age 7 months germany infant feces homo sapiens 2021-06-13v3No2 / 31
797amnon high in age 3 months compared to age 1 month in formula fed germany infant homo sapiens feces 2021-06-13v3No2 / 39
714amnoncommon germany, biopsy, sigmoid colon, terminal ileum, homo sapiens2028-05-21v3No2 / 40
825amnoncommon control, age 6-14 years, hangzhou city prefecture, china, child, homo sapiens, feces2021-08-12v3No2 / 40
797amnoncommon breast fed, age 2 years, child, germany, homo sapiens, feces2021-06-13v3No2 / 50
797amnon high in infant age 1 year compared to child age 2 years in formula fed germany homo sapiens feces 2021-06-13v3No2 / 52
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in israel research facility mouse mus musculus feces antibiotic )2018-10-23v4No1 / 3
619amnoncommon control, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No2 / 61
619amnoncommon cystic fibrosis, cftr s489x, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No2 / 64
394amnon high in ulcerative colitis compared to control in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 8
294amnon high in irritable bowel syndrome compared to control in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 9
797amnon high in formula fed compared to breast fed in germany age 1 month infant feces homo sapiens 2021-06-13v3No2 / 69
629amnon high in acquired immunodeficiency syndrome hiv infection compared to control in adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 10
810amnoncommon in sea turtle feces from sea turtle rescue center (common adriatic sea coastal waters of italy, feces, mediterranean sea, research facility, italy, loggerhead sea turtle, caretta caretta)2021-06-22v3No2 / 72
689amnoncommon non c. diff diarrhea, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 12
797amnon high in formula fed compared to breast fed in age 3 months germany infant feces homo sapiens 2021-06-13v3No2 / 75
502amnon high in schizophrenia compared to control in homo sapiens feces adult united states of america 2019-03-12v4No1 / 13
51amnonlower in stool compared to biopsies ( high in biopsy site biopsy compared to feces in homo sapiens united states of america )2017-01-19v4No1 / 14
185amnoncommon in patients with c. diff infection before treatment (common homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
779amnon high in crohn's disease compared to control in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 15
94amnoncommon homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child ulcerative colitis inflammatory bowel disease crohn's disease compared to control in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
659amnon high in before antibiotics compared to doxycycline metronidazole amoxicillin vancomycin antibiotic in ulcerative colitis acute severe colitis homo sapiens child feces 2020-09-19v4No1 / 16
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 17
12amnon high in chronic fatigue syndrome compared to control in homo sapiens feces new york county 2016-11-02v4No1 / 18
330amnon high in infant age 1 year compared to adult age 30-40 in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 19
689amnoncommon clostridium difficile infection, clostridium difficile colitis, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 19
292amnondominant homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 20
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in homo sapiens feces infant )2016-12-01v4No1 / 21
779amnondominant crohn's disease, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 21
94amnondominant homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (dominant homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
689amnondominant clostridium difficile infection, clostridium difficile colitis, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 22
779amnoncommon crohn's disease, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 22
241amnoncommon in babies age < 3 years in finland (common homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 23
779amnondominant ulcerative colitis, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 23
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 24
541amnonlower in koalas eating Eucalyptus obliqua leaves comapred to Eucalyptus viminalis ( high in eucalyptus viminalis eucalyptus viminalis diet compared to eucalyptus obliqua eucalyptus obliqua diet in phascolarctos cinereus koala feces australia wild cape otway )2019-08-01v4No1 / 24
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, ulcerative colitis, inflammatory bowel disease, crohn's disease2018-11-14v4No1 / 25
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 25
779amnoncommon ulcerative colitis, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 25
399amnondominant feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 27
399amnon high in crohn's disease compared to control in feces united states of america homo sapiens 2018-11-16v4No1 / 27
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 30
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v4No1 / 30
390amnoncommon homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 31
404amnonnegatively correlated with fiber intake ( high in low fiber compared to plant fiber cell high fiber in homo sapiens feces adult colombia city )2018-11-20v4No1 / 32
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 34
284amnon high in age 1 year compared to age 2 months in homo sapiens female feces state of california infant 2018-01-27v4No1 / 35
669amnoncommon age 1 year, sweden, infant, feces, homo sapiens2020-09-26v4No1 / 35
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 36
233amnon high in age age > 1 year compared to age < 1 year in feces homo sapiens infant united states of america 2017-11-05v4No1 / 37
390amnoncommon homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 38
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 39
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 40
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
241amnonhigher in babies from finland compared to estonia ( high in finland compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 45
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 46
428amnon high in pancreatitis acute pancreatitis compared to control in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 46
591amnoncommon homo sapiens, feces, adult, age 50-80 years, united states of america, parkinson's disease2020-02-17v4No1 / 47
779amnoncommon control, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 47
651amnoncommon parkinson's disease, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 49
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 50
650amnoncommon african american, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 52
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in homo sapiens feces adult age 50-60 years nanning city prefecture china )2018-01-27v4No1 / 54
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 55
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
591amnoncommon homo sapiens, feces, adult, age 50-80 years, united states of america, control2020-02-17v4No1 / 56
650amnon high in female compared to male in feces adult homo sapiens united states of america state of new york 2020-09-10v4No1 / 57
651amnoncommon control, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 58
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 59
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No2 / 169
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 61
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No2 / 172
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
671amnon high in age 1 month compared to age 3 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 64
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
448amnoncommon equus caballus, horse, feces, farm, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 65
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-15v4No1 / 68
644amnon high in female compared to male in adult united states of america hispanic or latin american feces homo sapiens 2020-08-31v4No1 / 69
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in indomethacin non-steroidal anti-inflammatory drug compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 72
448amnon high in equine grass sickness disease compared to control in equus caballus horse feces farm united kingdom 2019-01-08v4No1 / 72
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus viminalis diet2019-08-01v4No1 / 72
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in homo sapiens feces china )2018-12-30v4No1 / 76
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus obliqua diet2019-08-01v4No1 / 77
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 77
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet + inulin2020-02-10v4No1 / 78
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic neomycin ampicillin compared to control in rat rattus norvegicus sprague dawley feces caecum research facility switzerland )2018-12-20v4No1 / 80
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No2 / 214
590amnoncommon china, red-eared slider turtle, trachemys scripta elegans, age 3-5 weeks, intestine, turtle farm, farm, hainan autonomous prefecture2020-02-10v4No1 / 83
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, perianal skin, rectum2020-01-22v4No1 / 88
601amnoncommon homo sapiens, feces, china, adult, control2020-03-30v4No1 / 93
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada ileum terminal ileum 2019-07-29v4No1 / 104
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada colon right colon 2019-07-29v4No1 / 108
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v4No1 / 120
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, colon, right colon, taconic farms2019-07-30v4No1 / 130
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, ileum, terminal ileum2019-07-30v4No1 / 132
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
644amnonlower in individuals born in mexico compared to cuba ( high in cuba compared to mexico in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada feces 2019-07-29v4No1 / 135
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 148
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No2 / 347
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 149
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, mouse chow, low fat diet, united states of america, state of georgia2020-02-10v4No1 / 151
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to captive research facility in feces canada peromyscus maniculatus deer mice age 3-5 weeks province of ontario algonquin provincial park )2019-07-28v3No2 / 358
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
123amnon high in high fat diet diet compared to normal diet mouse chow in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 170
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 171
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v4No1 / 172
666amnoncommon rattus rattus, rat, italy, feces2020-09-25v3No2 / 406
179amnoncommon mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 183
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 184
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v4No1 / 185
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
389amnon high in age 1-3 weeks compared to age 4 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 189
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
669amnon high in age 1 year compared to age 2 months in sweden infant feces homo sapiens 2020-09-26v4No1 / 212
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
671amnon high in state of california compared to state of oregon in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 217
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
25amnon high in antibiotic compared to control in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 231
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to metronidazole neomycin vancomycin antibiotic in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 301
729amnon high in captive zoological garden europe compared to wild cameroon in gorilla gorilla monkey feces 2021-01-05v3No2 / 656
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-04v4No1 / 384
582amnon high in perianal skin rectum compared to ear canal external acoustic meatus in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 400
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
650amnon high in european caucasian compared to asian in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 475
657amnoncommon research facility, china, qinghai province, rumen liquid, rumen, age < 1 year, lamb, sheep, ovis aries2020-09-13v4No1 / 517
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
372amnon high in mouse chow compared to high fat diet in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 579
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081

Problems / suggestions? Please email info AT dbbact DOT org