Summmary for taxonomy:
clostridium sp. mt10-315-cc-82
Total dbBact sequences with taxonomy : 3

# exps # anno. Taxonomy Sequence
95163d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG
1536d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCGACGCCGCGTGAGTGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAAATGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA
11d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaCCGCGGTAATACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGG

Annotations for 3 sequences

common ontology terms
term enrichment score
TermScore
gastric carcinoma0.334148
stomach neoplasm0.334148
homo sapiens0.199286
feces0.192815
infant0.141343
adult0.135218
formula fed0.134554
zhejiang province0.111202
united states of america0.097379
juvenile0.097040
crohn's disease0.088250
LOWER IN control0.080448
seattle0.077071
colonized germ free0.077071
research facility0.074845
china0.070969
italy0.070522
stomach0.070211
germany0.068027
mouse0.064277
12-month-old human stage0.062777
mus musculus0.060762
LOWER IN breast fed0.060345
hyplus rabbit0.059524
child0.058564
age 5 weeks0.056980
clostridium difficile intestinal infectious disease0.056729
rabbit0.054645
oryctolagus cuniculus0.053846
biopsy0.053502
french republic0.053237
terminal ileum0.052209
hospital0.051079
cecal content0.050505
3-month-old human stage0.048662
sigmoid colon0.045545
clostridium difficile infection0.045545
state of georgia0.043986
cystic fibrosis0.043766
caecum0.042463
juvenile organism0.041070
suckling0.040900
preweaned0.040900
age 2-4 weeks0.040900
cftr s489x0.040900
after hcst0.040900
hematopoietic stem cell transplant0.040900
valladolid0.040900
age 7 months0.040900
exclusive breastmilk diet0.040900
green turtle0.039683
chelonia mydas0.039683
remission0.039683
farm0.038924
breast fed0.038536
sus scrofa0.038526
pig0.038526
kingdom of spain0.037580
control0.037166
jiangxi province0.036430
canada0.031481
wild0.028386
ulcerative colitis0.027778
c57bl/60.027160
monkey0.027096
state of california0.026954
LOWER IN 1-month-old human stage0.026626
guangzhou city prefecture0.026490
rat0.026038
age 3-5 weeks0.024147
1-month-old human stage0.023303
captive0.022569
hispanic or latin american0.021407
LOWER IN weaned0.021097
LOWER IN corn and soybean diet0.021097
LOWER IN age 4-7 weeks0.021097
taipei city0.021097
low anterior resection0.021097
algonquin provincial park0.021097
peromyscus maniculatus0.021097
deer mice0.021097
before hsct0.021097
rattus rattus0.021097
LOWER IN age 7 months0.021097
adriatic sea coastal waters of italy0.021097
caretta caretta0.021097
loggerhead sea turtle0.021097
hangzhou city prefecture0.021097
age 6-14 years0.021097
soild food supplemented diet0.021097
solid food diet0.021097
LOWER IN cameroon0.020768
taiwan0.020450
province of ontario0.020141
gorilla gorilla0.019841
LOWER IN 2-year-old human stage0.019841
2-year-old human stage0.019841
mediterranean sea0.019841
obsolete_juvenile stage0.018265
rectum0.018141
Fraction of dbbact annotations with this term covered by the query
TermScore
crohn's disease3.666667
juvenile0.444444
terminal ileum0.333333
lima0.333333
glasgow0.333333
diarrhea0.333333
bangladesh0.333333
atlanta0.333333
acute pancreatitis0.333333
pancreatitis0.333333
atherosclerosis0.333333
age 3-5 weeks0.333333
cuba0.333333
los angeles district0.333333
neonate0.333333
cystic fibrosis0.333333
bordeaux0.333333
gastric carcinoma0.333333
stomach neoplasm0.333333
suckling0.333333
preweaned0.333333
age 2-4 weeks0.333333
LOWER IN weaned0.333333
LOWER IN corn and soybean diet0.333333
LOWER IN age 4-7 weeks0.333333
taipei city0.333333
low anterior resection0.333333
algonquin provincial park0.333333
peromyscus maniculatus0.333333
deer mice0.333333
seattle0.333333
cftr s489x0.333333
colonized germ free0.333333
before hsct0.333333
after hcst0.333333
hematopoietic stem cell transplant0.333333
rattus rattus0.333333
valladolid0.333333
age 7 months0.333333
LOWER IN age 7 months0.333333
adriatic sea coastal waters of italy0.333333
caretta caretta0.333333
loggerhead sea turtle0.333333
hangzhou city prefecture0.333333
age 6-14 years0.333333
hyplus rabbit0.333333
exclusive breastmilk diet0.333333
soild food supplemented diet0.333333
solid food diet0.333333
dhaka0.333333
clostridium difficile intestinal infectious disease0.277778
sigmoid colon0.250000
biopsy0.250000
biopsy site0.250000
ulcerative colitis0.250000
clostridium difficile infection0.250000
formula fed0.250000
LOWER IN breast fed0.250000
colon0.222222
age < 3 years0.222222
state of oklahoma0.222222
LOWER IN 1-month-old human stage0.222222
green turtle0.222222
chelonia mydas0.222222
remission0.222222
LOWER IN cameroon0.222222
age 5 weeks0.222222
12-month-old human stage0.190476
chronic fatigue syndrome0.166667
new york county0.166667
children0.166667
mammalian milk beverage0.166667
shantytown0.166667
LOWER IN el salado0.166667
LOWER IN small village0.166667
LOWER IN plant diet0.166667
LOWER IN diarrhea0.166667
juvenile organism0.166667
13-year-old human stage0.166667
LOWER IN bacterial vaginosis0.166667
LOWER IN ulcer0.166667
LOWER IN wound0.166667
cheyenne0.166667
native american0.166667
arapaho0.166667
epilithic0.166667
little physical activity0.166667
LOWER IN tunapuco0.166667
nephrolithiasis0.166667
nanning city prefecture0.166667
sixth decade human stage0.166667
irritable bowel syndrome0.166667
age<17 years0.166667
spondyloarthritis0.166667
spondylitis0.166667
oslo0.166667
denver0.166667
gangcha region0.166667
LOWER IN gannan tibetan autonomous prefecture0.166667
age 1-3 weeks0.166667
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.772876
feces0.577887
adult0.468954
china0.419935
LOWER IN control0.375817
gastric carcinoma0.334967
stomach neoplasm0.334967
stomach0.334967
zhejiang province0.334967
united states of america0.184641
research facility0.149782
infant0.130719
germany0.130719
formula fed0.092048
mus musculus0.071351
mouse0.071351
juvenile0.054466
italy0.054466
control0.052288
crohn's disease0.044662
seattle0.043573
colonized germ free0.043573
child0.039760
caecum0.039216
12-month-old human stage0.037582
french republic0.035948
oryctolagus cuniculus0.034314
LOWER IN breast fed0.034314
3-month-old human stage0.032680
cecal content0.032680
rabbit0.032680
age 5 weeks0.032680
hyplus rabbit0.032680
clostridium difficile intestinal infectious disease0.031590
hospital0.031590
biopsy0.029956
farm0.029956
terminal ileum0.028322
kingdom of spain0.026688
state of georgia0.026688
sigmoid colon0.025054
sus scrofa0.025054
pig0.025054
clostridium difficile infection0.025054
juvenile organism0.023420
cystic fibrosis0.023420
canada0.022331
suckling0.021786
preweaned0.021786
age 2-4 weeks0.021786
jiangxi province0.021786
cftr s489x0.021786
green turtle0.021786
chelonia mydas0.021786
after hcst0.021786
hematopoietic stem cell transplant0.021786
remission0.021786
valladolid0.021786
age 7 months0.021786
breast fed0.021786
exclusive breastmilk diet0.021786
wild0.019063
c57bl/60.017974
state of california0.016340
rat0.015795
monkey0.015795
ulcerative colitis0.014706
guangzhou city prefecture0.014706
LOWER IN 1-month-old human stage0.014161
captive0.014161
age 3-5 weeks0.012527
1-month-old human stage0.012527
australia0.011438
hispanic or latin american0.011438
LOWER IN weaned0.010893
LOWER IN corn and soybean diet0.010893
LOWER IN age 4-7 weeks0.010893
taipei city0.010893
taiwan0.010893
low anterior resection0.010893
LOWER IN research facility0.010893
LOWER IN captive0.010893
province of ontario0.010893
algonquin provincial park0.010893
peromyscus maniculatus0.010893
deer mice0.010893
before hsct0.010893
rattus rattus0.010893
zoological garden0.010893
europe0.010893
LOWER IN wild0.010893
LOWER IN cameroon0.010893
gorilla gorilla0.010893
LOWER IN age 7 months0.010893
LOWER IN child0.010893
LOWER IN 2-year-old human stage0.010893
2-year-old human stage0.010893
mediterranean sea0.010893
adriatic sea coastal waters of italy0.010893
caretta caretta0.010893
Exp. ID User ID Description Date Region Flag Sequences
655amnoncommon in patients after hematopoietic stem cell transplant (common feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No2 / 10
797amnon high in 12-month-old human stage compared to age 7 months in feces homo sapiens infant germany breast fed 2021-06-13v3No2 / 15
728amnoncommon feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No2 / 16
713amnondominant feces, homo sapiens, remission, crohn's disease2028-05-21v3No2 / 18
619amnondominant feces, united states of america, research facility, mus musculus, mouse, cystic fibrosis, seattle, cftr s489x, colonized germ free2020-05-04v3No2 / 20
797amnondominant feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No2 / 20
797amnondominant feces, homo sapiens, infant, germany, formula fed, 3-month-old human stage2021-06-13v3No2 / 20
728amnondominant feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No2 / 21
853amnondominant research facility, oryctolagus cuniculus, french republic, cecal content, rabbit, caecum, juvenile, age 5 weeks, hyplus rabbit, soild food supplemented diet, solid food diet2021-12-20v3No2 / 21
619amnondominant feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No2 / 22
655amnondominant in patients after hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No2 / 22
713amnoncommon feces, homo sapiens, remission, crohn's disease2028-05-21v3No2 / 22
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 12-month-old human stage2021-06-13v3No2 / 23
641amnoncommon feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No2 / 24
641amnondominant feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No2 / 24
853amnondominant research facility, caecum, oryctolagus cuniculus, french republic, cecal content, rabbit, juvenile, age 5 weeks, hyplus rabbit, exclusive breastmilk diet2021-12-20v3No2 / 24
714amnondominant homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No2 / 25
655amnoncommon in patients before hematopoietic stem cell transplant (common feces, homo sapiens, italy, before hsct)2020-09-13v3No2 / 31
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No2 / 31
797amnon high in 3-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No2 / 39
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No2 / 40
825amnoncommon feces, homo sapiens, control, child, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No2 / 40
797amnoncommon feces, homo sapiens, child, germany, breast fed, 2-year-old human stage2021-06-13v3No2 / 50
797amnon high in infant 12-month-old human stage compared to child 2-year-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No2 / 52
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in feces research facility antibiotic mus musculus israel mouse )2018-10-23v4No1 / 3
619amnoncommon feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No2 / 61
619amnoncommon feces, united states of america, research facility, cystic fibrosis, mus musculus, mouse, seattle, cftr s489x, colonized germ free2020-05-04v3No2 / 64
394amnon high in ulcerative colitis compared to control in feces homo sapiens united states of america adult state of california 2018-11-06v4No1 / 8
294amnon high in irritable bowel syndrome compared to control in feces homo sapiens adult kingdom of spain 2018-02-09v4No1 / 9
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 1-month-old human stage 2021-06-13v3No2 / 69
629amnon high in hiv infection acquired immunodeficiency syndrome compared to control in feces homo sapiens adult kingdom of the netherlands amsterdam 2020-05-31v4No1 / 10
810amnoncommon in sea turtle feces from sea turtle rescue center (common feces, research facility, mediterranean sea, italy, adriatic sea coastal waters of italy, caretta caretta, loggerhead sea turtle)2021-06-22v3No2 / 72
689amnoncommon feces, homo sapiens, united states of america, hospital, adult, non c. diff diarrhea, tucson2028-03-11v4No1 / 12
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 3-month-old human stage 2021-06-13v3No2 / 75
502amnon high in schizophrenia compared to control in feces homo sapiens united states of america adult 2019-03-12v4No1 / 13
51amnonlower in stool compared to biopsies ( high in biopsy site biopsy compared to feces in homo sapiens united states of america )2017-01-19v4No1 / 14
185amnoncommon in patients with c. diff infection before treatment (common feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
779amnon high in crohn's disease compared to control in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 15
94amnoncommon feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child inflammatory bowel disease crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
659amnon high in before antibiotics compared to antibiotic vancomycin metronidazole amoxicillin doxycycline in feces homo sapiens ulcerative colitis child acute severe colitis 2020-09-19v4No1 / 16
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v4No1 / 17
12amnon high in chronic fatigue syndrome compared to control in feces homo sapiens new york county 2016-11-02v4No1 / 18
330amnon high in infant age 1 year compared to adult fourth decade human stage in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 19
689amnoncommon feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 19
866amnon high in crohn's disease crohn's disease compared to control in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 19
292amnondominant feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 20
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in feces homo sapiens infant )2016-12-01v4No1 / 21
779amnondominant feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 21
859amnoncommon feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v4No1 / 21
94amnondominant feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (dominant feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
689amnondominant feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 22
779amnoncommon feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 22
859amnondominant feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v4No1 / 22
241amnoncommon in babies age < 3 years in finland (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 23
779amnondominant feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 23
853amnoncommon research facility, caecum, oryctolagus cuniculus, french republic, cecal content, rabbit, juvenile, age 5 weeks, hyplus rabbit, exclusive breastmilk diet2021-12-20v3No2 / 96
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in feces homo sapiens hospital australia diarrhea )2018-11-04v4No1 / 24
541amnonlower in koalas eating Eucalyptus obliqua leaves comapred to Eucalyptus viminalis ( high in eucalyptus viminalis eucalyptus viminalis diet compared to eucalyptus obliqua diet eucalyptus obliqua in feces australia wild phascolarctos cinereus koala cape otway )2019-08-01v4No1 / 24
395amnoncommon feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 25
428amnoncommon feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 25
779amnoncommon feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 25
399amnondominant feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v4No1 / 27
399amnon high in crohn's disease compared to control in feces homo sapiens united states of america 2018-11-16v4No1 / 27
320amnoncommon feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 30
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in feces homo sapiens adult guangzhou city prefecture china )2018-05-15v4No1 / 30
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 31
404amnonnegatively correlated with fiber intake ( high in low fiber compared to high fiber plant fiber cell in feces homo sapiens city adult colombia )2018-11-20v4No1 / 32
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 34
284amnon high in 12-month-old human stage compared to age 2 months in feces homo sapiens female infant state of california 2018-01-27v4No1 / 35
669amnoncommon feces, homo sapiens, infant, sweden, 12-month-old human stage2020-09-26v4No1 / 35
240amnoncommon in infants age <3 years (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 36
233amnon high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens united states of america infant 2017-11-05v4No1 / 37
390amnoncommon feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 38
330amnoncommon feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 39
19amnoncommon in biopsies of children (IBD study) (common homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 40
859amnon high in formula fed compared to breast fed in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 6-month-old human stage 2022-01-12v4No1 / 41
876amnon high in age 1 week neonate compared to juvenile organism age 20 months in feces united states of america research facility macaca mulatta state of washington monkey 2022-03-06v4No1 / 43
36amnoncommon feces, homo sapiens, sichuan province2016-12-06v4No1 / 44
241amnonhigher in babies from finland compared to estonia ( high in finland compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 45
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 46
428amnon high in acute pancreatitis pancreatitis compared to control in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 46
591amnoncommon feces, homo sapiens, united states of america, adult, parkinson's disease, human late adulthood stage2020-02-17v4No1 / 47
779amnoncommon feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 47
651amnoncommon feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 49
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 50
650amnoncommon feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 52
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v4No1 / 54
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
368amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
591amnoncommon feces, homo sapiens, control, united states of america, adult, human late adulthood stage2020-02-17v4No1 / 56
650amnon high in female compared to male in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 57
651amnoncommon feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 58
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 59
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No2 / 169
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No2 / 172
502amnoncommon feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 63
671amnon high in age 1 month compared to 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 64
242amnoncommon in native-americans (common feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 65
448amnoncommon feces, farm, equus caballus, horse, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 65
895amnoncommon feces, homo sapiens, child, french republic, cystic fibrosis, bordeaux, 6-12 year-old child stage2022-04-16v4No1 / 65
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
902amnoncommon feces, united states of america, colitis, antibiotic, equus caballus, horse, adult organism, colitis, antibiotics induced colitis2022-05-02v4No1 / 68
644amnon high in female compared to male in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v4No1 / 69
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in non-steroidal anti-inflammatory drug indomethacin compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 72
448amnon high in equine grass sickness disease compared to control in feces farm equus caballus horse united kingdom 2019-01-08v4No1 / 72
541amnoncommon feces, australia, wild, phascolarctos cinereus, koala, cape otway, eucalyptus viminalis diet2019-08-01v4No1 / 72
859amnon high in 6-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 2022-01-12v4No1 / 72
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 2-5 year-old child stage compared to age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage in feces homo sapiens china )2018-12-30v4No1 / 76
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 77
541amnoncommon feces, australia, wild, phascolarctos cinereus, koala, cape otway, eucalyptus obliqua diet2019-08-01v4No1 / 77
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 77
589amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, state of georgia, mouse, jackson laboratories, high fat diet + inulin2020-02-10v4No1 / 78
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic ampicillin neomycin compared to control in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 80
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v3No2 / 214
590amnoncommon farm, intestine, age 3-5 weeks, china, hainan autonomous prefecture, trachemys scripta elegans, red-eared slider turtle, turtle farm2020-02-10v4No1 / 83
249amnoncommon feces, homo sapiens, united states of america2017-11-22v4No1 / 86
841amnoncommon feces, homo sapiens, united states of america, adult, state of texas, human adult stage2021-11-08v4No1 / 86
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
582amnoncommon united states of america, rectum, wild, perianal skin, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 88
884amnoncommon feces, homo sapiens, united states of america, adult, state of california, human adult stage2022-03-24v4No1 / 88
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
538amnon high in taconic farms compared to jackson laboratories in research facility ileum mus musculus c57bl/6 terminal ileum canada mouse age 8 weeks 2019-07-29v4No1 / 104
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
538amnon high in taconic farms compared to jackson laboratories in research facility colon right colon mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 108
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy site biopsy compared to feces in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 118
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
538amnoncommon feces, research facility, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 120
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 121
538amnoncommon research facility, colon, right colon, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 130
538amnoncommon research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 132
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v4No1 / 134
644amnonlower in individuals born in mexico compared to cuba ( high in cuba compared to mexico in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
538amnon high in taconic farms compared to jackson laboratories in feces research facility mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 135
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 148
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No2 / 347
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in feces homo sapiens united states of america )2017-02-27v4No1 / 149
589amnoncommon feces, united states of america, research facility, mus musculus, low fat diet, c57bl/6, state of georgia, mouse, mouse chow, jackson laboratories2020-02-10v4No1 / 151
866amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, stress, state of illinois, mouse, restraint stress2022-02-08v4No1 / 152
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to research facility captive in feces canada province of ontario algonquin provincial park peromyscus maniculatus deer mice age 3-5 weeks )2019-07-28v3No2 / 358
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
123amnon high in diet high fat diet compared to normal diet mouse chow in feces united states of america research facility mus musculus c57bl/6j mouse 2017-04-13v4No1 / 170
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in feces farm sus scrofa jinhua city prefecture pig jinhua pig china )2018-12-06v4No1 / 171
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common feces, united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of georgia, mouse, jackson laboratories)2020-02-10v4No1 / 172
666amnoncommon feces, italy, rat, rattus rattus2020-09-25v3No2 / 406
179amnoncommon united states of america, research facility, oral cavity, mus musculus, balb/c, mouse, mouth2017-08-13v4No1 / 183
399amnoncommon feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v4No1 / 184
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
197amnon high in india compared to finland in feces homo sapiens juvenile organism obsolete_juvenile stage 13-year-old human stage 2017-09-12v4No1 / 189
389amnon high in age 1-3 weeks compared to age 4 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 189
866amnoncommon feces, control, united states of america, research facility, mus musculus, c57bl/6, state of illinois, mouse2022-02-08v4No1 / 193
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
669amnon high in 12-month-old human stage compared to 2-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 217
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
902amnon high in salmonella gastroenteritis salmonellosis compared to control in feces united states of america equus caballus horse adult organism 2022-05-02v4No1 / 226
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
25amnon high in antibiotic compared to control in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v4No1 / 231
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
729amnon high in zoological garden captive europe compared to wild cameroon in feces gorilla gorilla monkey 2021-01-05v3No2 / 656
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
891amnon high in 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant bangladesh dhaka infant stage urban slum 2022-04-03v4No1 / 363
902amnon high in colitis antibiotic colitis antibiotics induced colitis compared to control in feces united states of america equus caballus horse adult organism 2022-05-02v4No1 / 364
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v4No1 / 384
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 400
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
438amnonhigher in centenarians compared to adults ( high in age >94 ninth decade human stage tenth decade human stage compared to 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 474
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
657amnoncommon research facility, rumen, ovis aries, qinghai province, rumen liquid, age < 1 year, sheep, lamb, china2020-09-13v4No1 / 517
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 567
372amnon high in mouse chow compared to high fat diet in feces united states of america research facility mus musculus mouse 2018-09-07v4No1 / 579
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic, biofilm)2017-11-22v4No1 / 1081

Problems / suggestions? Please email info AT dbbact DOT org