Search result for sequence:
TACGGAGGGTGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTTTTTAAGTCTGGGGTGAAAGCCCGTTGCTCAACAACGGAACTGCCCTGGAAACTGGAGAGCTTGAGTACAGACGAGGGTGGCGGAATGGACGG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
ice0.666667
glacier0.600000
snow0.600000
lapland0.500000
glacier peak wilderness0.500000
depth (snow) 0-5cm0.500000
medicine bow - routt national forest0.500000
arapaho national forest0.500000
LOWER IN state of wyoming0.500000
LOWER IN medicine bow - routt national forest0.500000
LOWER IN arapaho national forest0.500000
subsurface0.500000
depth 20-100cm0.500000
glacial ice0.500000
shetland islands0.500000
south shetland glacier0.500000
stratovolcano0.333333
depth 0-5cm0.333333
state of wyoming0.333333
LOWER IN state of colorado0.333333
depth 0-20cm0.333333
snow field0.250000
state of colorado0.200000
surface0.166667
filtered 0.2um0.166667
state of oregon0.142857
state of washington0.142857
kingdom of norway0.125000
sweden0.125000
finland0.100000
sediment0.033333
united states of america0.010309
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.666667
snow0.666667
glacier0.466667
depth (snow) 0-5cm0.333333
state of colorado0.266667
ice0.266667
snow field0.200000
stratovolcano0.200000
state of oregon0.200000
sweden0.200000
depth 0-5cm0.200000
state of washington0.200000
glacier peak wilderness0.200000
state of wyoming0.133333
medicine bow - routt national forest0.133333
arapaho national forest0.133333
filtered 0.2um0.133333
glacial ice0.133333
shetland islands0.133333
south shetland glacier0.133333
sediment0.066667
kingdom of norway0.066667
finland0.066667
lapland0.066667
LOWER IN state of wyoming0.066667
LOWER IN state of colorado0.066667
LOWER IN medicine bow - routt national forest0.066667
LOWER IN arapaho national forest0.066667
surface0.066667
depth 0-20cm0.066667
subsurface0.066667
depth 20-100cm0.066667
Number of experiments associating the term to the sequence
TermScore
united states of america3.000000
glacier3.000000
snow3.000000
sweden2.000000
state of colorado2.000000
ice2.000000
snow field1.000000
stratovolcano1.000000
state of oregon1.000000
sediment1.000000
kingdom of norway1.000000
finland1.000000
lapland1.000000
depth 0-5cm1.000000
state of washington1.000000
glacier peak wilderness1.000000
depth (snow) 0-5cm1.000000
state of wyoming1.000000
medicine bow - routt national forest1.000000
arapaho national forest1.000000
LOWER IN state of wyoming1.000000
LOWER IN state of colorado1.000000
LOWER IN medicine bow - routt national forest1.000000
LOWER IN arapaho national forest1.000000
surface1.000000
depth 0-20cm1.000000
filtered 0.2um1.000000
subsurface1.000000
depth 20-100cm1.000000
glacial ice1.000000
shetland islands1.000000
south shetland glacier1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
224amnondominant united states of america, glacier, snow field, stratovolcano, state of oregon, snow2017-10-26v41 / 14approvedNo
811amnondominant glacier, glacial ice, ice, shetland islands, south shetland glacier2021-06-22v31 / 16approvedNo
511amnondominant united states of america, state of colorado, depth 0-5cm, snow2019-03-20v41 / 19approvedNo
915amnondominant united states of america, state of washington, snow, glacier peak wilderness, depth (snow) 0-5cm2022-07-02v41 / 20approvedNo
915amnondominant united states of america, state of wyoming, state of colorado, snow, medicine bow - routt national forest, arapaho national forest, depth (snow) 0-5cm2022-07-02v41 / 21approvedNo
915amnoncommon united states of america, state of washington, snow, glacier peak wilderness, depth (snow) 0-5cm2022-07-02v41 / 68approvedNo
763amnoncommon glacier, sweden, filtered 0.2um, ice, subsurface, depth 20-100cm2021-04-10v31 / 74approvedNo
224amnoncommon united states of america, glacier, snow field, stratovolcano, sediment, state of oregon2017-10-26v41 / 87approvedNo
915amnoncommon united states of america, state of wyoming, state of colorado, snow, medicine bow - routt national forest, arapaho national forest, depth (snow) 0-5cm2022-07-02v41 / 91approvedNo
763amnoncommon glacier, surface, sweden, depth 0-20cm, filtered 0.2um, ice2021-04-10v31 / 98approvedNo
511amnoncommon united states of america, state of colorado, depth 0-5cm, snow2019-03-20v41 / 134approvedNo
915amnon high in state of washington glacier peak wilderness compared to state of wyoming state of colorado medicine bow - routt national forest arapaho national forest in united states of america snow depth (snow) 0-5cm 2022-07-02v41 / 155approvedNo
224amnoncommon united states of america, glacier, snow field, stratovolcano, state of oregon, snow2017-10-26v41 / 204approvedNo
511amnoncommon kingdom of norway, sweden, finland, lapland, depth 0-5cm, snow2019-03-20v41 / 213approvedNo
811amnoncommon glacier, glacial ice, ice, shetland islands, south shetland glacier2021-06-22v31 / 234approvedNo

Problems / suggestions? Please visit the dbBact forum