Search result for sequence:
TACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCCGGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
western australia0.193548
low bmi0.169492
LOWER IN high bmi0.166667
age 1 year0.150000
macaca mulatta0.131868
feces0.115596
monkey0.108108
edo state0.107143
abomasum0.101695
city0.097561
homo sapiens0.096781
nigeria0.088235
sheep0.085714
adult0.079321
ovis aries0.078947
zoological garden0.077922
small village0.074074
cron diet0.074074
LOWER IN republic of congo0.074074
LOWER IN nouabale-ndoki national park0.074074
age 8 months0.074074
cobb broiler chicken0.074074
LOWER IN body mass index0.072727
united states of america0.072600
age < 3 years0.071429
nanning city prefecture0.071429
sixth decade human stage0.071429
rhesus macaque0.071429
age 35 days0.071429
body mass index0.070175
65-79 year-old human stage0.068966
hispanic or latin american0.068966
LOWER IN finland0.066667
caloric restriction diet0.066667
fifth decade human stage0.066667
infant0.064516
africa0.064516
LOWER IN infant0.062500
LOWER IN rumen0.062500
fourth decade human stage0.060606
rural community0.059701
jejunum0.058824
LOWER IN crohn&#39;s disease0.057143
ileum0.056075
LOWER IN wild0.051282
state of new york0.051282
australia0.050847
LOWER IN colon0.046512
LOWER IN caecum0.045455
chicken0.043478
gallus gallus0.042553
child0.042403
china0.041280
el salvador0.038462
LOWER IN lima0.038462
LOWER IN shantytown0.038462
LOWER IN sewer0.038462
low income0.038462
physical activity0.038462
LOWER IN little physical activity0.038462
LOWER IN nephrolithiasis0.038462
LOWER IN venezuela0.038462
LOWER IN amerindian0.038462
myanmar0.038462
karen0.038462
LOWER IN hmong0.038462
bangui0.038462
LOWER IN madagascar0.038462
LOWER IN antananarivo0.038462
LOWER IN acute pancreatitis0.038462
LOWER IN pancreatitis0.038462
age >940.038462
tenth decade human stage0.038462
LOWER IN soldiers0.038462
LOWER IN age 3-60.038462
LOWER IN age 8-120.038462
gorilla gorilla gorilla0.038462
LOWER IN cuba0.038462
LOWER IN state of california0.038462
LOWER IN age 6 months0.038462
age 10-15 years0.038462
LOWER IN age &lt; 1 year0.038462
cayo santiago0.038462
indian rhesus macaque0.038462
age 20 months0.038462
LOWER IN neonate0.038462
LOWER IN 9-month-old human stage0.038462
pongo sp.0.038462
columbus0.038462
orangutan0.038462
LOWER IN abomasum0.038462
research facility0.038244
control0.037783
LOWER IN wastewater treatment plant0.037736
south america0.037736
estonia0.037736
LOWER IN american diet0.037736
LOWER IN hunter gatherer0.037736
central african republic0.037736
nanchang city prefecture0.037736
Fraction of dbbact annotations with this term covered by the query
TermScore
low bmi0.555556
el salvador0.500000
small village0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
LOWER IN sewer0.500000
low income0.500000
LOWER IN high bmi0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
LOWER IN nephrolithiasis0.500000
cron diet0.500000
LOWER IN venezuela0.500000
LOWER IN amerindian0.500000
myanmar0.500000
karen0.500000
LOWER IN hmong0.500000
bangui0.500000
LOWER IN madagascar0.500000
LOWER IN antananarivo0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN pancreatitis0.500000
age >940.500000
tenth decade human stage0.500000
LOWER IN soldiers0.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN republic of congo0.500000
LOWER IN nouabale-ndoki national park0.500000
gorilla gorilla gorilla0.500000
LOWER IN cuba0.500000
LOWER IN state of california0.500000
age 8 months0.500000
LOWER IN age 6 months0.500000
age 10-15 years0.500000
LOWER IN age &lt; 1 year0.500000
cayo santiago0.500000
indian rhesus macaque0.500000
age 20 months0.500000
LOWER IN neonate0.500000
edo state0.500000
LOWER IN 9-month-old human stage0.500000
pongo sp.0.500000
columbus0.500000
orangutan0.500000
cobb broiler chicken0.500000
western australia0.500000
LOWER IN abomasum0.500000
LOWER IN body mass index0.400000
macaca mulatta0.375000
LOWER IN wastewater treatment plant0.333333
south america0.333333
age < 3 years0.333333
estonia0.333333
nanning city prefecture0.333333
sixth decade human stage0.333333
LOWER IN american diet0.333333
LOWER IN hunter gatherer0.333333
central african republic0.333333
nanchang city prefecture0.333333
ninth decade human stage0.333333
LOWER IN young adult stage0.333333
LOWER IN 6-12 year-old child stage0.333333
LOWER IN pan troglodytes troglodytes0.333333
asian0.333333
rhesus macaque0.333333
LOWER IN neomycin0.333333
9-month-old human stage0.333333
LOWER IN 18-month-old human stage0.333333
wild boar0.333333
age 35 days0.333333
LOWER IN cloaca0.333333
abomasum0.333333
body mass index0.285714
LOWER IN china0.250000
65-79 year-old human stage0.250000
hispanic or latin american0.250000
LOWER IN european0.250000
18-month-old human stage0.250000
LOWER IN finland0.200000
caloric restriction diet0.200000
fifth decade human stage0.200000
LOWER IN 2-5 year-old child stage0.200000
pan troglodytes0.200000
LOWER IN caucasian0.200000
LOWER IN vancomycin0.200000
puerto rico0.200000
LOWER IN age 1 week0.200000
age 1 year0.200000
tibet autonomous region0.200000
qinghai province0.200000
yak0.200000
africa0.166667
chimpanzee0.166667
monkey0.166667
LOWER IN 3-month-old human stage0.166667
LOWER IN 1-month-old human stage0.166667
nigeria0.166667
bos grunniens0.166667
state of oregon0.142857
Fraction of annotations for the query sequences containing the term
TermScore
feces0.840000
homo sapiens0.660000
united states of america0.380000
adult0.340000
research facility0.220000
china0.160000
control0.120000
ovis aries0.120000
australia0.120000
age 1 year0.120000
sheep0.120000
western australia0.120000
low bmi0.100000
LOWER IN high bmi0.100000
city0.080000
infant0.080000
macaca mulatta0.080000
monkey0.080000
child0.060000
zoological garden0.060000
nigeria0.060000
edo state0.060000
abomasum0.060000
ileum0.060000
small village0.040000
body mass index0.040000
LOWER IN finland0.040000
age < 3 years0.040000
nanning city prefecture0.040000
sixth decade human stage0.040000
rural community0.040000
LOWER IN crohn&#39;s disease0.040000
cron diet0.040000
caloric restriction diet0.040000
africa0.040000
65-79 year-old human stage0.040000
fourth decade human stage0.040000
fifth decade human stage0.040000
LOWER IN republic of congo0.040000
LOWER IN nouabale-ndoki national park0.040000
LOWER IN wild0.040000
LOWER IN body mass index0.040000
hispanic or latin american0.040000
state of new york0.040000
captive0.040000
rhesus macaque0.040000
age 8 months0.040000
LOWER IN infant0.040000
caecum0.040000
gallus gallus0.040000
male0.040000
chicken0.040000
cobb broiler chicken0.040000
age 35 days0.040000
jejunum0.040000
LOWER IN feces0.040000
LOWER IN caecum0.040000
LOWER IN colon0.040000
LOWER IN rumen0.040000
el salvador0.020000
LOWER IN lima0.020000
LOWER IN shantytown0.020000
LOWER IN wastewater treatment plant0.020000
LOWER IN sewer0.020000
south america0.020000
low income0.020000
obsolete_juvenile stage0.020000
united kingdom0.020000
russia0.020000
estonia0.020000
physical activity0.020000
LOWER IN little physical activity0.020000
LOWER IN nephrolithiasis0.020000
LOWER IN ulcerative colitis0.020000
diet0.020000
LOWER IN american diet0.020000
LOWER IN venezuela0.020000
LOWER IN amerindian0.020000
LOWER IN hunter gatherer0.020000
myanmar0.020000
karen0.020000
LOWER IN hmong0.020000
LOWER IN china0.020000
thailand0.020000
central african republic0.020000
bangui0.020000
LOWER IN madagascar0.020000
LOWER IN antananarivo0.020000
LOWER IN duodenum0.020000
LOWER IN acute pancreatitis0.020000
LOWER IN pancreatitis0.020000
nanchang city prefecture0.020000
age >940.020000
ninth decade human stage0.020000
tenth decade human stage0.020000
LOWER IN soldiers0.020000
LOWER IN young adult stage0.020000
LOWER IN child0.020000
LOWER IN age 3-60.020000
LOWER IN age 8-120.020000
Number of experiments associating the term to the sequence
TermScore
feces27.000000
homo sapiens20.000000
united states of america12.000000
adult11.000000
low bmi5.000000
LOWER IN high bmi5.000000
control5.000000
china5.000000
research facility4.000000
city3.000000
macaca mulatta3.000000
monkey3.000000
small village2.000000
child2.000000
body mass index2.000000
infant2.000000
rural community2.000000
LOWER IN crohn&#39;s disease2.000000
zoological garden2.000000
LOWER IN body mass index2.000000
LOWER IN infant2.000000
el salvador1.000000
LOWER IN lima1.000000
LOWER IN shantytown1.000000
LOWER IN wastewater treatment plant1.000000
LOWER IN sewer1.000000
south america1.000000
low income1.000000
obsolete_juvenile stage1.000000
united kingdom1.000000
russia1.000000
LOWER IN finland1.000000
age < 3 years1.000000
estonia1.000000
physical activity1.000000
LOWER IN little physical activity1.000000
LOWER IN nephrolithiasis1.000000
nanning city prefecture1.000000
sixth decade human stage1.000000
LOWER IN ulcerative colitis1.000000
diet1.000000
cron diet1.000000
caloric restriction diet1.000000
LOWER IN american diet1.000000
LOWER IN venezuela1.000000
LOWER IN amerindian1.000000
LOWER IN hunter gatherer1.000000
myanmar1.000000
karen1.000000
LOWER IN hmong1.000000
LOWER IN china1.000000
thailand1.000000
central african republic1.000000
bangui1.000000
LOWER IN madagascar1.000000
LOWER IN antananarivo1.000000
africa1.000000
LOWER IN duodenum1.000000
LOWER IN acute pancreatitis1.000000
LOWER IN pancreatitis1.000000
nanchang city prefecture1.000000
age >941.000000
65-79 year-old human stage1.000000
fourth decade human stage1.000000
fifth decade human stage1.000000
ninth decade human stage1.000000
tenth decade human stage1.000000
LOWER IN soldiers1.000000
LOWER IN young adult stage1.000000
LOWER IN child1.000000
LOWER IN age 3-61.000000
LOWER IN age 8-121.000000
LOWER IN 2-5 year-old child stage1.000000
LOWER IN 6-12 year-old child stage1.000000
LOWER IN republic of congo1.000000
LOWER IN nouabale-ndoki national park1.000000
LOWER IN wild1.000000
gorilla gorilla gorilla1.000000
pan troglodytes1.000000
LOWER IN pan troglodytes troglodytes1.000000
chimpanzee1.000000
hispanic or latin american1.000000
LOWER IN cuba1.000000
state of new york1.000000
asian1.000000
LOWER IN caucasian1.000000
LOWER IN european1.000000
state of oregon1.000000
LOWER IN state of california1.000000
captive1.000000
rhesus macaque1.000000
age 8 months1.000000
LOWER IN age 6 months1.000000
LOWER IN 3-month-old human stage1.000000
LOWER IN vancomycin1.000000
LOWER IN neomycin1.000000
age 10-15 years1.000000
LOWER IN age &lt; 1 year1.000000
cayo santiago1.000000
puerto rico1.000000
indian rhesus macaque1.000000
age 20 months1.000000
LOWER IN age 1 week1.000000
LOWER IN neonate1.000000
9-month-old human stage1.000000
LOWER IN 1-month-old human stage1.000000
nigeria1.000000
edo state1.000000
18-month-old human stage1.000000
LOWER IN 9-month-old human stage1.000000
LOWER IN 18-month-old human stage1.000000
pongo sp.1.000000
columbus1.000000
orangutan1.000000
wild boar1.000000
caecum1.000000
gallus gallus1.000000
male1.000000
chicken1.000000
cobb broiler chicken1.000000
age 35 days1.000000
LOWER IN cloaca1.000000
abomasum1.000000
ovis aries1.000000
australia1.000000
age 1 year1.000000
sheep1.000000
western australia1.000000
ileum1.000000
jejunum1.000000
LOWER IN feces1.000000
LOWER IN caecum1.000000
LOWER IN colon1.000000
LOWER IN abomasum1.000000
LOWER IN rumen1.000000
bos grunniens1.000000
tibet autonomous region1.000000
qinghai province1.000000
yak1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
644amnonnegatively correalted with bmi ( high in low bmi compared to body mass index high bmi in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v41 / 42approvedNo
650amnonnegatively correlated with BMI ( high in low bmi compared to body mass index high bmi in feces homo sapiens united states of america adult state of new york )2020-09-09v41 / 75approvedNo
905amnon high in abomasum compared to rumen in research facility ovis aries australia age 1 year sheep western australia 2022-05-19v31 / 78approvedNo
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v41 / 83approvedNo
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in feces homo sapiens united states of america adult )2018-02-07v41 / 96approvedNo
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v41 / 134approvedNo
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v41 / 136approvedNo
905amnoncommon research facility, ileum, ovis aries, australia, age 1 year, sheep, western australia2022-05-18v31 / 137approvedNo
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in feces homo sapiens united states of america )2017-12-04v41 / 140approvedNo
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in feces homo sapiens united states of america )2017-04-12v41 / 141approvedNo
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v41 / 157approvedNo
292amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens adult china 2018-02-05v41 / 161approvedNo
1044amnon high in human late adulthood stage compared to human early adulthood stage in feces homo sapiens adult japan human adult stage 2023-08-20v31 / 161pendingNo
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v41 / 162approvedNo
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to wastewater treatment plant sewer in city south america low income )2017-01-21v41 / 187approvedNo
744amnon high in caecum compared to cloaca in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v31 / 187approvedNo
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v41 / 218approvedNo
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta monkey captive rhesus macaque age 8 months 2020-09-27v41 / 232approvedNo
960amnon high in 9-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant nigeria edo state 2022-12-20v41 / 244approvedNo
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v41 / 281approvedNo
744amnon high in caecum compared to ileum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v31 / 286approvedNo
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v41 / 288approvedNo
53amnon high in el salvador small village compared to lima shantytown in feces homo sapiens city 2017-01-21v41 / 296approvedNo
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v41 / 301approvedNo
770amnon high in age 10-15 years adult organism compared to infant age < 1 year in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v41 / 304approvedNo
666amnoncommon feces, sus scrofa, italy, wild boar2020-09-25v31 / 305approvedNo
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v41 / 306approvedNo
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v41 / 317approvedNo
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in myanmar karen compared to hmong china in feces homo sapiens thailand rural community )2018-11-18v41 / 329approvedNo
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in feces homo sapiens united kingdom )2017-04-13v41 / 345approvedNo
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v41 / 373approvedNo
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in diet cron diet caloric restriction diet compared to american diet in feces homo sapiens united states of america adult )2018-02-07v41 / 381approvedNo
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v41 / 390approvedNo
960amnon high in 18-month-old human stage compared to 9-month-old human stage in feces homo sapiens infant nigeria edo state 2022-12-20v41 / 407approvedNo
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v41 / 416approvedNo
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v41 / 417approvedNo
905amnoncommon research facility, abomasum, ovis aries, australia, age 1 year, sheep, western australia2022-05-18v31 / 460approvedNo
438amnon high in adult 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage in feces homo sapiens china 2018-12-30v41 / 486approvedNo
905amnon high in jejunum ileum compared to abomasum rumen in research facility ovis aries australia age 1 year sheep western australia 2022-05-18v31 / 563approvedNo
425amnon high in central african republic bangui compared to madagascar antananarivo in feces homo sapiens child africa 2018-12-08v41 / 564approvedNo
914amnoncommon feces, bos grunniens, tibet autonomous region, qinghai province, yak2022-06-26v31 / 575approvedNo
995amnoncommon feces, united states of america, zoological garden, state of ohio, monkey, pongo sp., columbus, orangutan2022-12-27v41 / 613approvedNo
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v41 / 617approvedNo
671amnon high in age 8 months compared to age 6 months 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v41 / 955approvedNo
620amnon high in united states of america zoological garden pan troglodytes compared to pan troglodytes troglodytes republic of congo nouabale-ndoki national park wild in feces chimpanzee 2020-05-06v41 / 964approvedNo
620amnon high in united states of america zoological garden compared to republic of congo nouabale-ndoki national park wild in feces gorilla gorilla gorilla 2020-05-06v41 / 1019approvedNo
876amnon high in juvenile organism age 20 months compared to age 1 week neonate in feces united states of america research facility macaca mulatta state of washington monkey 2022-03-06v41 / 1065approvedNo
905amnon high in jejunum ileum compared to feces caecum colon in research facility ovis aries australia age 1 year sheep western australia 2022-05-18v31 / 1092approvedNo
960amnon high in female adult compared to infant 18-month-old human stage in feces homo sapiens nigeria edo state 2022-12-20v41 / 1392approvedNo
905amnon high in abomasum rumen compared to feces caecum colon in research facility ovis aries australia age 1 year sheep western australia 2022-05-19v31 / 2737approvedNo

Problems / suggestions? Please visit the dbBact forum