Search result for sequence:
TACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTAGTAAGTCAGCGGTGAAATTTTGGTGCTTAACACCAAACGTGCCGTTGATACTGCTGGGCTAGAGAGTAGTTGCGGTAGGCGGAATGTATGG
common ontology terms
term enrichment score
TermScore
homo sapiens0.426603
feces0.415030
adult0.349391
united states of america0.153009
control0.149466
china0.108687
child0.099723
city0.093230
caecum0.091603
female0.087197
LOWER IN crohn's disease0.086331
kingdom of spain0.085890
infant0.076531
sprague dawley0.071174
germany0.068966
rat0.067568
israel0.064655
gallus gallus0.064655
chicken0.064655
LOWER IN infant0.058394
obesity0.057143
poland0.057143
jiangsu province0.056338
united kingdom0.055556
obsolete_juvenile stage0.054054
age0.053691
italy0.052632
LOWER IN male0.051282
research facility0.050633
male0.047619
LOWER IN rural community0.044776
nanning city prefecture0.044776
age 50-60 years0.044776
india0.044118
kingdom of norway0.042857
low bmi0.042403
rattus norvegicus0.041958
state of california0.039474
south korea0.035928
farm0.033241
overweight body mass index status0.030534
obese body mass index status0.030303
municipality of logrono0.030303
milk allergy0.030303
age 4-10 years0.030303
age 60-790.030303
low anterior resection0.030303
taipei city0.030303
lepus europaeus0.030303
age >940.030303
oslo0.030303
age 30-400.030303
cron diet0.030303
age 13-140.030303
age 130.030303
LOWER IN small village0.030303
LOWER IN age 3-60.030303
free range chicken0.030303
coturnix coturnix0.030303
common quail0.030303
LOWER IN age 30-500.030303
LOWER IN age 60-790.030303
parkinson's disease0.030075
food allergy0.029851
age 19-240.029851
formula fed0.029851
LOWER IN age < 1 year0.029851
rattus0.029851
finland0.029630
oryctolagus cuniculus0.029630
kingdom of denmark0.029630
state of colorado0.029412
taiwan0.029412
caloric restriction diet0.029412
LOWER IN age 1 year0.029412
LOWER IN ulcerative colitis0.029412
texas0.029412
africa0.029412
LOWER IN hiv infection0.029197
rectum0.028986
LOWER IN child0.028571
juvenile organism0.028571
broiler chicken0.028571
high bmi0.028369
state of new york0.027778
belgium0.027778
LOWER IN colon0.027778
diet0.026316
pregnancy0.026316
small waist circumference0.015385
LOWER IN waist circumference0.015385
LOWER IN large waist circumference0.015385
primary progressive multiple sclerosis0.015385
LOWER IN chronic kidney disease0.015385
LOWER IN plant based diet0.015385
LOWER IN endospore enriched fraction0.015385
LOWER IN lysis0.015385
age 50-70 years0.015385
yaounde0.015385
LOWER IN ngoantet0.015385
Fraction of dbbact annotations with this term covered by the query
TermScore
overweight body mass index status0.666667
LOWER IN crohn's disease0.545455
small waist circumference0.500000
LOWER IN waist circumference0.500000
LOWER IN large waist circumference0.500000
primary progressive multiple sclerosis0.500000
LOWER IN chronic kidney disease0.500000
LOWER IN plant based diet0.500000
LOWER IN endospore enriched fraction0.500000
LOWER IN lysis0.500000
obese body mass index status0.500000
age 50-70 years0.500000
yaounde0.500000
LOWER IN rural community0.500000
LOWER IN ngoantet0.500000
LOWER IN switzerland0.500000
human immunodeficiency virus infectious disease0.500000
municipality of logrono0.500000
antiretroviral therapy0.500000
quito0.500000
LOWER IN nephrolithiasis0.500000
nanning city prefecture0.500000
age 50-60 years0.500000
milk allergy0.500000
age 4-10 years0.500000
third trimester0.500000
LOWER IN age 7 months0.500000
LOWER IN sesame allergy0.500000
age 60-790.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
low anterior resection0.500000
taipei city0.500000
lepus europaeus0.500000
irritable bowel syndrome0.500000
age >940.500000
glasgow0.500000
oslo0.500000
age 30-400.500000
gaz:000521000.500000
cron diet0.500000
age 13-140.500000
rem sleep behavior disorder0.500000
age 130.500000
LOWER IN peru0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
age 8-120.500000
LOWER IN age 3-60.500000
LOWER IN russia0.500000
nature reserve0.500000
european brown hare0.500000
LOWER IN sewer0.500000
low income0.500000
free range chicken0.500000
spondyloarthritis0.500000
spondylitis0.500000
coturnix coturnix0.500000
common quail0.500000
atherosclerosis0.500000
lima0.500000
shantytown0.500000
LOWER IN el salado0.500000
soldiers0.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN age >940.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
LOWER IN acute pancreatitis0.500000
LOWER IN pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
constipation0.500000
LOWER IN age 0-6 months0.500000
indonesia0.500000
municipality of yogyakarta0.500000
LOWER IN short bowel syndrome0.500000
tnbs0.500000
LOWER IN venezuela0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
children0.500000
LOWER IN age 8-120.500000
age one year0.500000
LOWER IN age one month0.500000
bangui0.500000
LOWER IN madagascar0.500000
LOWER IN antananarivo0.500000
LOWER IN infant0.444444
parkinson's disease0.400000
sprague dawley0.400000
india0.375000
animal product diet0.333333
obesity0.333333
cameroon0.333333
poland0.333333
madrid0.333333
age 5-13 years0.333333
Fraction of annotations for the query sequences containing the term
TermScore
feces0.921875
homo sapiens0.851562
adult0.468750
united states of america0.257812
control0.187500
china0.171875
female0.070312
child0.070312
caecum0.062500
research facility0.062500
city0.054688
kingdom of spain0.054688
germany0.046875
infant0.046875
LOWER IN crohn's disease0.046875
israel0.039062
gallus gallus0.039062
chicken0.039062
sprague dawley0.039062
rat0.039062
LOWER IN male0.031250
obesity0.031250
male0.031250
italy0.031250
poland0.031250
jiangsu province0.031250
obsolete_juvenile stage0.031250
LOWER IN infant0.031250
united kingdom0.031250
age0.031250
south korea0.023438
LOWER IN rural community0.023438
nanning city prefecture0.023438
age 50-60 years0.023438
low bmi0.023438
state of california0.023438
farm0.023438
kingdom of norway0.023438
india0.023438
rattus norvegicus0.023438
LOWER IN control0.015625
state of colorado0.015625
diet0.015625
parkinson's disease0.015625
obese body mass index status0.015625
high bmi0.015625
overweight body mass index status0.015625
LOWER IN hiv infection0.015625
municipality of logrono0.015625
state of new york0.015625
food allergy0.015625
milk allergy0.015625
age 4-10 years0.015625
age 19-240.015625
pregnancy0.015625
formula fed0.015625
belgium0.015625
age 60-790.015625
low anterior resection0.015625
taipei city0.015625
taiwan0.015625
lepus europaeus0.015625
age >940.015625
LOWER IN child0.015625
oslo0.015625
age 30-400.015625
cron diet0.015625
caloric restriction diet0.015625
age 13-140.015625
juvenile organism0.015625
finland0.015625
age 130.015625
LOWER IN age 1 year0.015625
LOWER IN ulcerative colitis0.015625
LOWER IN small village0.015625
LOWER IN age 3-60.015625
LOWER IN colon0.015625
LOWER IN age < 1 year0.015625
free range chicken0.015625
texas0.015625
coturnix coturnix0.015625
common quail0.015625
rectum0.015625
rattus0.015625
LOWER IN age 30-500.015625
LOWER IN age 60-790.015625
oryctolagus cuniculus0.015625
broiler chicken0.015625
kingdom of denmark0.015625
africa0.015625
small waist circumference0.007812
LOWER IN waist circumference0.007812
LOWER IN large waist circumference0.007812
primary progressive multiple sclerosis0.007812
russia0.007812
LOWER IN chronic kidney disease0.007812
felis catus0.007812
cat0.007812
animal product diet0.007812
LOWER IN plant based diet0.007812
Exp. ID User ID Description Date Region Flag Sequences
131amnonnegatively correlated with waist circumference ( high in small waist circumference compared to waist circumference large waist circumference in feces homo sapiens south korea )2017-04-16v4No1 / 15
574amnon high in primary progressive multiple sclerosis compared to control in feces homo sapiens adult russia 2020-01-05v3No1 / 17
436amnonlower in cats with chronic kidney disease compared to healthy controls ( high in control compared to chronic kidney disease in feces united states of america felis catus state of colorado cat )2018-12-25v4No1 / 31
63amnon high in diet animal product diet compared to plant based diet in feces homo sapiens united states of america 2017-04-12v4No1 / 32
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in feces homo sapiens united states of america adult )2018-11-18v4No1 / 41
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
591amnoncommon feces, homo sapiens, united states of america, adult, age 50-80 years, parkinson's disease2020-02-17v4No1 / 47
131amnon high in female compared to male in feces homo sapiens south korea 2017-04-16v4No1 / 55
814amnoncommon feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 55
563amnon high in control compared to hiv infection in feces homo sapiens united states of america male homosexual msm rectal swab 2019-11-18v4No1 / 58
666amnoncommon feces, homo sapiens, italy2020-09-25v3No1 / 58
22amnon high in control compared to hiv infection in feces homo sapiens united states of america 2016-11-28v4No1 / 70
594amnon high in city yaounde compared to rural community ngoantet in feces homo sapiens adult cameroon 2020-03-12v4No1 / 70
663amnon high in poland compared to switzerland in feces homo sapiens adult 2020-09-22v4No1 / 72
794amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, human immunodeficiency virus infectious disease, municipality of logrono, antiretroviral therapy2021-06-08v4No1 / 75
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
401amnoncommon feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 79
562amnoncommon feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 82
650amnon high in male compared to female in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 82
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in feces homo sapiens adult nanning city prefecture age 50-60 years china )2018-01-27v4No1 / 83
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 83
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
663amnoncommon feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 85
249amnoncommon feces, homo sapiens, united states of america2017-11-22v4No1 / 86
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 86
404amnon high in female compared to male in feces homo sapiens city adult colombia 2018-11-20v4No1 / 88
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
438amnoncommon feces, homo sapiens, age 19-24, china2018-12-30v4No1 / 101
477amnoncommon feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 103
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
797amnon high in age 1 year compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
695amnon high in milk allergy compared to sesame allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 107
409amnoncommon feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 108
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 60-79, china2018-12-30v4No1 / 111
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in feces homo sapiens adult taipei city taiwan )2019-07-18v3No1 / 115
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
743amnoncommon feces, farm, adult, italy, captive, lepus europaeus, european hare2021-02-21v3No1 / 119
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china2018-12-30v4No1 / 121
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to child obsolete_juvenile stage crohn's disease in feces homo sapiens glasgow )2017-02-26v4No1 / 125
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 125
779amnon high in control compared to crohn's disease in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 127
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, age 30-402018-05-13v4No1 / 130
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 132017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
797amnon high in child age 2 years compared to infant age 1 year in feces homo sapiens germany formula fed 2021-06-13v3No1 / 139
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 145
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens adult china 2018-02-05v4No1 / 161
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in feces homo sapiens china )2018-12-30v4No1 / 168
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, age 13, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in feces homo sapiens infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces homo sapiens united states of america 2018-11-16v4No1 / 180
639amnoncommon feces, nature reserve, adult, australia, wild, lepus europaeus, european brown hare2020-08-21v3No1 / 182
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to wastewater treatment plant sewer in city south america low income )2017-01-21v4No1 / 187
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 8 weeks2019-03-03v4No1 / 189
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
108amnoncommon united states of america, research facility, caecum, texas, coturnix coturnix, common quail2017-04-07v4No1 / 216
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
349amnoncommon feces, research facility, sprague dawley, rattus, male, rat, china2018-07-29v4No1 / 235
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in feces homo sapiens china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, age 50-60 years, nephrolithiasis, china)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in feces homo sapiens belgium 2018-11-15v4No1 / 248
666amnoncommon feces, oryctolagus cuniculus, italy, european rabbit2020-09-25v3No1 / 252
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in feces homo sapiens infant india )2016-12-19v4No1 / 253
419amnoncommon feces, research facility, rattus norvegicus, sprague dawley, rat, china2018-12-02v4No1 / 254
568amnoncommon feces, gallus gallus, chicken, broiler chicken, viet nam2019-12-08v3No1 / 272
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, age 50-60 years, china)2018-01-27v4No1 / 281
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, age 6 weeks, free range chicken2019-03-03v4No1 / 290
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
419amnoncommon in rats with induced constipation (common feces, research facility, rattus norvegicus, sprague dawley, rat, constipation, china)2018-12-02v4No1 / 300
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
723amnon high in age 2-4 years compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
568amnoncommon feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 320
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in feces homo sapiens adult czech republic 2019-07-21v1No1 / 334
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 345
442amnoncommon in tnbs induced colitis in rat feces (common feces, research facility, rattus norvegicus, sprague dawley, male, rat, tnbs, colitis, china)2019-01-06v4No1 / 360
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
108amnon high in caecum compared to colon in united states of america research facility texas coturnix coturnix common quail 2017-04-07v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in diet cron diet caloric restriction diet compared to american diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 381
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v4No1 / 384
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
186amnoncommon united states of america, research facility, caecum, sprague dawley, rattus, rat2017-08-23v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
339amnon high in adult compared to infant age < 1 year in feces homo sapiens india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in feces homo sapiens china )2018-12-30v4No1 / 474
738amnon high in age 30 days compared to age 1 week in gallus gallus chicken united kingdom caecum 2021-01-30v3No1 / 474
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
438amnon high in adult age 30-50 age 60-79 compared to child age 3-6 age 8-12 in feces homo sapiens china 2018-12-30v4No1 / 486
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in feces homo sapiens child africa 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
264amnoncommon research facility, caecum, oryctolagus cuniculus, rex rabbit, jiangsu province, china2017-12-11v4No1 / 622

Problems / suggestions? Please email info AT dbbact DOT org