Search result for sequence:
TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGGATTCGTGG
common ontology terms
term enrichment score
TermScore
biopsy0.190476
guangzhou city prefecture0.166667
czech republic0.158730
bottlenosed dolphin0.125000
short bowel syndrome0.125000
stroke0.125000
children0.125000
tursiops truncatus0.117647
sigmoid colon0.117647
skin of cheek0.117647
age 25-45 years0.117647
colon0.114286
graz city district0.111111
biopsy site0.111111
terminal ileum0.111111
new zealand0.111111
lamb0.111111
age 6 weeks0.105263
crohn's disease0.100000
austria0.095238
skin0.085106
rectum0.083333
sheep0.083333
ovis aries0.076923
homo sapiens0.068193
baoding city prefecture0.066667
high atmospheric pollution0.066667
LOWER IN dalian city prefecture0.066667
LOWER IN low atmospheric pollution0.066667
LOWER IN short bowel syndrome0.066667
LOWER IN scalp0.066667
amsterdam0.062500
contaminant0.060606
LOWER IN jejunum0.060606
adult0.059761
kingdom of the netherlands0.058824
LOWER IN hiv infection0.054054
female0.053333
LOWER IN duodenum0.052632
LOWER IN crohn's disease0.051282
obesity0.050000
high bmi0.048780
LOWER IN ileum0.048780
feces0.045673
italy0.043478
control0.043243
caecum0.040816
united states of america0.031974
child0.031746
china0.024948
research facility0.012903
LOWER IN control0.010204
Fraction of dbbact annotations with this term covered by the query
TermScore
bottlenosed dolphin0.500000
short bowel syndrome0.500000
stroke0.500000
children0.500000
baoding city prefecture0.500000
high atmospheric pollution0.500000
LOWER IN dalian city prefecture0.500000
LOWER IN low atmospheric pollution0.500000
LOWER IN short bowel syndrome0.500000
LOWER IN scalp0.500000
tursiops truncatus0.333333
sigmoid colon0.333333
skin of cheek0.333333
age 25-45 years0.333333
biopsy0.285714
graz city district0.250000
biopsy site0.250000
terminal ileum0.250000
amsterdam0.250000
new zealand0.250000
lamb0.250000
contaminant0.200000
guangzhou city prefecture0.200000
age 6 weeks0.200000
LOWER IN jejunum0.200000
crohn's disease0.166667
kingdom of the netherlands0.166667
austria0.142857
czech republic0.142857
LOWER IN hiv infection0.111111
rectum0.100000
sheep0.100000
LOWER IN duodenum0.100000
colon0.095238
LOWER IN crohn's disease0.090909
obesity0.083333
ovis aries0.083333
high bmi0.076923
LOWER IN ileum0.076923
skin0.060606
italy0.055556
homo sapiens0.035573
female0.032787
adult0.031646
caecum0.028571
child0.028571
feces0.023729
control0.023669
united states of america0.016736
china0.013245
research facility0.007092
LOWER IN control0.005952
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.821429
feces0.607143
adult0.535714
united states of america0.357143
control0.250000
china0.214286
czech republic0.178571
skin0.142857
female0.142857
biopsy0.142857
guangzhou city prefecture0.142857
colon0.142857
tursiops truncatus0.071429
bottlenosed dolphin0.071429
austria0.071429
graz city district0.071429
biopsy site0.071429
short bowel syndrome0.071429
stroke0.071429
crohn's disease0.071429
rectum0.071429
caecum0.071429
sigmoid colon0.071429
terminal ileum0.071429
children0.071429
skin of cheek0.071429
age 25-45 years0.071429
research facility0.071429
ovis aries0.071429
new zealand0.071429
sheep0.071429
lamb0.071429
age 6 weeks0.071429
contaminant0.035714
contamination0.035714
LOWER IN control0.035714
child0.035714
kingdom of the netherlands0.035714
amsterdam0.035714
LOWER IN hiv infection0.035714
italy0.035714
high bmi0.035714
obesity0.035714
baoding city prefecture0.035714
high atmospheric pollution0.035714
LOWER IN dalian city prefecture0.035714
LOWER IN low atmospheric pollution0.035714
LOWER IN short bowel syndrome0.035714
LOWER IN crohn's disease0.035714
LOWER IN ileum0.035714
LOWER IN duodenum0.035714
LOWER IN jejunum0.035714
LOWER IN scalp0.035714
Exp. ID User ID Description Date Region Flag Sequences
79amnondominant united states of america, skin, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 10
152amnonhigh in blanks compares to dust/nose samples (contamination)2017-05-04v4No1 / 10
556amnondominant feces, homo sapiens, united states of america, adult2019-09-14v1No1 / 12
693amnondominant feces, homo sapiens, female, adult, austria, graz city district2028-03-16v1No1 / 14
79amnoncommon united states of america, skin, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 15
51amnondominant homo sapiens, united states of america, biopsy site, biopsy2017-01-19v4No1 / 16
532amnondominant feces, homo sapiens, control, adult, czech republic2019-07-21v1No1 / 16
532amnondominant feces, homo sapiens, adult, czech republic, short bowel syndrome2019-07-21v1No1 / 18
333amnonhigh freq. in healthy controls feces (dominant feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 20
333amnonhigh freq. in stroke patient feces (dominant feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 22
532amnoncommon feces, homo sapiens, adult, czech republic, short bowel syndrome2019-07-21v1No1 / 24
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 34
51amnoncommon homo sapiens, united states of america, biopsy site, biopsy2017-01-19v4No1 / 36
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 41
730amnoncommon feces, homo sapiens, child, kingdom of the netherlands, amsterdam, crohn's disease2021-01-05v1No1 / 51
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
51amnon high in control compared to hiv infection in feces homo sapiens united states of america 2017-01-19v4No1 / 62
556amnoncommon feces, homo sapiens, united states of america, adult2019-09-14v1No1 / 77
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
532amnoncommon feces, homo sapiens, control, adult, czech republic2019-07-21v1No1 / 98
693amnoncommon feces, homo sapiens, female, adult, austria, graz city district2028-03-16v1No1 / 104
819amnon high in baoding city prefecture high atmospheric pollution compared to dalian city prefecture low atmospheric pollution in homo sapiens female skin adult skin of cheek china age 25-45 years 2021-07-12v1No1 / 242
532amnon high in control compared to short bowel syndrome in feces homo sapiens adult czech republic 2019-07-21v1No1 / 334
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
649amnon high in colon compared to ileum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 897
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261
819amnon high in skin of cheek compared to scalp in homo sapiens female skin adult china age 25-45 years 2021-07-12v1No1 / 1684

Problems / suggestions? Please email info AT dbbact DOT org