Search result for sequence:
TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACGCTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGGTGTCTTGAGTACAGTAGAGGCAGGCGGGATTCGTGG
common ontology terms
term enrichment score
TermScore
obsolete_juvenile stage0.169492
guangzhou city prefecture0.148148
bottlenosed dolphin0.105263
stroke0.105263
mouse strain c57bc/6ncrl0.105263
lima0.105263
shantytown0.105263
glasgow0.105263
tropical grassland biome0.105263
nanger granti0.105263
gazelle0.105263
homo sapiens0.103462
tursiops truncatus0.100000
biopsy0.097561
feces0.095974
kenya0.095238
LOWER IN crohn's disease0.088889
child0.082305
age0.072727
united states of america0.070039
infant0.068966
city0.065934
male0.063830
immunization heat killed mycobacterium vaccae0.055556
LOWER IN vehicle bbs0.055556
midwest region0.055556
plant diet0.055556
no stress: single housed control0.055556
LOWER IN stress: chronic subordinate colony housing0.055556
no immunization: vehicle as control0.055556
LOWER IN egypt0.055556
LOWER IN age 7 months0.055556
hypopharynx0.055556
age<17 years0.055556
LOWER IN sewer0.055556
low income0.055556
LOWER IN el salado0.055556
children0.055556
vaccination0.054054
LOWER IN animal product diet0.054054
formula fed0.054054
LOWER IN age 1 week0.054054
viet nam0.054054
LOWER IN thailand0.054054
LOWER IN obsolete_juvenile stage0.054054
atlanta0.054054
LOWER IN wastewater treatment plant0.054054
south america0.054054
sigmoid colon0.054054
biopsy site0.052632
LOWER IN small village0.052632
terminal ileum0.052632
control0.050676
broiler chicken0.050000
egypt0.050000
age 3 months0.048780
kingdom of denmark0.048780
old age0.048780
LOWER IN young age0.048780
belgium0.047619
LOWER IN hiv infection0.046512
adult0.045714
age 1 year0.045455
rectum0.045455
obesity0.043478
LOWER IN child0.043478
high bmi0.042553
skin0.040000
gallus gallus0.040000
chicken0.040000
italy0.038462
colon0.036364
germany0.035088
LOWER IN female0.035088
diet0.034483
caecum0.028986
mus musculus0.025316
research facility0.012658
china0.012539
Fraction of dbbact annotations with this term covered by the query
TermScore
bottlenosed dolphin0.500000
stroke0.500000
immunization heat killed mycobacterium vaccae0.500000
LOWER IN vehicle bbs0.500000
mouse strain c57bc/6ncrl0.500000
midwest region0.500000
plant diet0.500000
no stress: single housed control0.500000
LOWER IN stress: chronic subordinate colony housing0.500000
no immunization: vehicle as control0.500000
LOWER IN egypt0.500000
LOWER IN age 7 months0.500000
lima0.500000
shantytown0.500000
hypopharynx0.500000
glasgow0.500000
age<17 years0.500000
LOWER IN sewer0.500000
low income0.500000
LOWER IN el salado0.500000
tropical grassland biome0.500000
nanger granti0.500000
gazelle0.500000
children0.500000
tursiops truncatus0.333333
vaccination0.333333
LOWER IN animal product diet0.333333
formula fed0.333333
LOWER IN age 1 week0.333333
viet nam0.333333
LOWER IN thailand0.333333
LOWER IN obsolete_juvenile stage0.333333
atlanta0.333333
LOWER IN wastewater treatment plant0.333333
south america0.333333
sigmoid colon0.333333
biopsy0.285714
biopsy site0.250000
LOWER IN small village0.250000
kenya0.250000
terminal ileum0.250000
guangzhou city prefecture0.200000
obsolete_juvenile stage0.200000
LOWER IN crohn&#39;s disease0.181818
broiler chicken0.166667
egypt0.166667
age 3 months0.142857
kingdom of denmark0.142857
old age0.142857
LOWER IN young age0.142857
belgium0.125000
LOWER IN hiv infection0.111111
age 1 year0.100000
rectum0.100000
age0.095238
obesity0.083333
infant0.083333
LOWER IN child0.083333
high bmi0.076923
gallus gallus0.062500
chicken0.062500
child0.057143
italy0.055556
homo sapiens0.055336
city0.052632
feces0.050847
male0.050000
colon0.047619
germany0.043478
LOWER IN female0.043478
diet0.041667
united states of america0.037657
skin0.030303
control0.029586
caecum0.028571
adult0.025316
mus musculus0.016129
research facility0.007092
china0.006623
Fraction of annotations for the query sequences containing the term
TermScore
feces0.852941
homo sapiens0.794118
united states of america0.500000
adult0.235294
control0.176471
child0.147059
obsolete_juvenile stage0.147059
guangzhou city prefecture0.117647
china0.117647
male0.088235
city0.088235
skin0.058824
tursiops truncatus0.058824
bottlenosed dolphin0.058824
stroke0.058824
research facility0.058824
mus musculus0.058824
mouse strain c57bc/6ncrl0.058824
biopsy0.058824
infant0.058824
lima0.058824
shantytown0.058824
age0.058824
LOWER IN crohn&#39;s disease0.058824
glasgow0.058824
tropical grassland biome0.058824
kenya0.058824
nanger granti0.058824
gazelle0.058824
vaccination0.029412
immunization heat killed mycobacterium vaccae0.029412
LOWER IN vehicle bbs0.029412
midwest region0.029412
biopsy site0.029412
diet0.029412
plant diet0.029412
LOWER IN animal product diet0.029412
LOWER IN hiv infection0.029412
no stress: single housed control0.029412
LOWER IN stress: chronic subordinate colony housing0.029412
no immunization: vehicle as control0.029412
italy0.029412
high bmi0.029412
obesity0.029412
LOWER IN egypt0.029412
age 1 year0.029412
LOWER IN age 7 months0.029412
germany0.029412
formula fed0.029412
belgium0.029412
age 3 months0.029412
LOWER IN age 1 week0.029412
hypopharynx0.029412
kingdom of denmark0.029412
viet nam0.029412
LOWER IN thailand0.029412
gallus gallus0.029412
chicken0.029412
broiler chicken0.029412
LOWER IN child0.029412
LOWER IN obsolete_juvenile stage0.029412
atlanta0.029412
age<17 years0.029412
LOWER IN wastewater treatment plant0.029412
LOWER IN sewer0.029412
south america0.029412
low income0.029412
LOWER IN el salado0.029412
LOWER IN small village0.029412
old age0.029412
LOWER IN young age0.029412
LOWER IN female0.029412
egypt0.029412
rectum0.029412
caecum0.029412
colon0.029412
sigmoid colon0.029412
terminal ileum0.029412
children0.029412
Exp. ID User ID Description Date Region Flag Sequences
79amnondominant united states of america, skin, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 10
74amnondominant feces, homo sapiens, united states of america2017-02-27v4No1 / 15
79amnoncommon united states of america, skin, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 15
333amnonhigh freq. in healthy controls feces (dominant feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 20
333amnonhigh freq. in stroke patient feces (dominant feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 22
47amnonsmj: higher in mice immunized with M. vaccae ( high in vaccination immunization heat killed mycobacterium vaccae compared to vehicle bbs in feces united states of america research facility mus musculus male mouse strain c57bc/6ncrl )2017-01-13v4No1 / 24
745amnondominant feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 24
62amnondominant feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 26
51amnoncommon homo sapiens, united states of america, biopsy site, biopsy2017-01-19v4No1 / 36
74amnonHigher in plant diet compared to animal product diet ( high in diet plant diet compared to animal product diet in feces homo sapiens united states of america )2017-02-27v4No1 / 39
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 41
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
51amnon high in control compared to hiv infection in feces homo sapiens united states of america 2017-01-19v4No1 / 62
47amnonsmj: lower in non-bullied, non-immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in feces united states of america research facility mus musculus male mouse strain c57bc/6ncrl no immunization: vehicle as control )2017-01-13v4No1 / 70
74amnoncommon feces, homo sapiens, united states of america2017-02-27v4No1 / 76
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
797amnon high in age 1 year compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
53amnoncommon feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 110
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age age 3 months compared to age 1 week in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 116
568amnon high in viet nam compared to thailand in feces gallus gallus chicken broiler chicken 2019-12-08v3No1 / 119
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to child obsolete_juvenile stage crohn's disease in feces homo sapiens glasgow )2017-02-26v4No1 / 125
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 162
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to wastewater treatment plant sewer in city south america low income )2017-01-21v4No1 / 187
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
78amnonhigher in older gazelles ( high in age old age compared to young age in feces tropical grassland biome kenya nanger granti gazelle )2017-03-01v4No1 / 273
78amnon high in male compared to female in feces tropical grassland biome kenya nanger granti gazelle 2017-03-01v4No1 / 301
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459

Problems / suggestions? Please email info AT dbbact DOT org