Search result for sequence:
TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGACAGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCTGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG
common ontology terms
term enrichment score
TermScore
feces0.648549
homo sapiens0.603361
adult0.498550
united states of america0.302161
china0.199336
control0.150332
research facility0.132188
child0.123288
infant0.093385
female0.093260
rat0.078624
city0.074349
wild0.072893
germany0.067568
kingdom of spain0.063804
male0.061538
sprague dawley0.060150
mouse0.059416
australia0.058658
mus musculus0.057911
guangzhou city prefecture0.055932
hospital0.053441
heterosexual0.051613
msw0.051613
taiwan0.051502
rattus norvegicus0.050000
israel0.048193
LOWER IN control0.046679
ulcerative colitis0.046332
caecum0.046154
biopsy0.046065
obesity0.045802
kingdom of denmark0.040644
rectum0.040506
age 50-80 years0.040506
obsolete_juvenile stage0.040506
south korea0.039900
diarrhea0.039312
c57bl/6j0.035146
colon0.034001
farm0.032092
rattus0.031250
formula fed0.030534
sweden0.029925
dog0.029630
italy0.029197
canis lupus familiaris0.029197
jiangsu province0.028777
state of florida0.028571
sigmoid colon0.026144
age < 3 years0.026144
republic of china0.026144
india0.026110
czech republic0.026059
terminal ileum0.025974
urocyon littoralis0.025974
urocyon littoralis catalinae0.025974
santa catalina island fox0.025974
taipei city0.025974
santa catalina island0.025641
crohn's disease0.025316
state of colorado0.025316
gallus gallus0.025316
chicken0.025316
state of new york0.025316
zoological garden0.025000
state of california0.024096
LOWER IN homosexual0.021053
LOWER IN msm0.021053
estonia0.020997
colombia0.020997
LOWER IN rural community0.020997
parkinson's disease0.020961
rectal swab0.020961
colitis0.020961
tucson0.020888
phascolarctos cinereus0.020888
koala0.020888
cape otway0.020888
caribbean latino0.020888
nanning city prefecture0.020888
age 50-60 years0.020888
biopsy site0.020888
clostridium difficile intestinal infectious disease0.020888
obese body mass index status0.020888
indonesia0.020888
municipality of yogyakarta0.020888
adula0.020888
snake farm0.020888
africa0.020888
finland0.020815
nanchang city prefecture0.020672
juvenile organism0.020672
snake0.020672
zhejiang province0.020566
state of georgia0.020566
pregnancy0.020460
united kingdom0.020460
commonwealth of virginia0.020253
high bmi0.019950
Fraction of dbbact annotations with this term covered by the query
TermScore
heterosexual0.800000
msw0.800000
LOWER IN homosexual0.800000
LOWER IN msm0.800000
taiwan0.750000
LOWER IN gay0.750000
tursiops truncatus0.666667
sigmoid colon0.666667
ulcerative colitis0.666667
age < 3 years0.666667
overweight body mass index status0.666667
estonia0.666667
colombia0.666667
republic of china0.666667
age 30-500.666667
age 19-240.666667
rattus0.666667
LOWER IN rural community0.666667
central african republic0.666667
metabolic syndrome0.666667
LOWER IN age 1 week0.666667
south america0.666667
wistar rat0.666667
india0.625000
parkinson's disease0.600000
guangzhou city prefecture0.600000
rectal swab0.600000
colitis0.600000
biopsy0.571429
czech republic0.571429
adult0.531646
city0.526316
feces0.522034
homo sapiens0.513834
tucson0.500000
schizophrenia0.500000
sprague dawley0.500000
rat0.500000
bottlenosed dolphin0.500000
terminal ileum0.500000
children0.500000
phascolarctos cinereus0.500000
koala0.500000
cape otway0.500000
eucalyptus viminalis diet0.500000
acute severe colitis0.500000
systemic lupus erythematosus0.500000
acute pancreatitis0.500000
pancreatitis0.500000
icr/cd-1 mice0.500000
LOWER IN visceral leishmaniasis0.500000
bihar state0.500000
age one month0.500000
age 200.500000
perianal skin0.500000
urocyon littoralis0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
clostridium difficile infection0.500000
type 2 diabetes mellitus0.500000
caribbean latino0.500000
age one week0.500000
age one year0.500000
nanning city prefecture0.500000
age 50-60 years0.500000
nephrolithiasis0.500000
salmonella gastroenteritis0.500000
biopsy site0.500000
clostridium difficile intestinal infectious disease0.500000
obesity0.500000
obese body mass index status0.500000
age 50-70 years0.500000
taipei city0.500000
low anterior resection0.500000
valladolid0.500000
inflammatory bowel disease0.500000
stroke0.500000
eucalyptus obliqua diet0.500000
insomnia0.500000
oslo0.500000
juvenile0.500000
indonesia0.500000
municipality of yogyakarta0.500000
age 0-6 months0.500000
age 7 months0.500000
LOWER IN plant based diet0.500000
LOWER IN endospore enriched fraction0.500000
LOWER IN lysis0.500000
myrmecophaga tridactyla0.500000
giant anteater0.500000
daycare0.500000
age 1-5 years0.500000
iron deficient diet0.500000
low iron0.500000
LOWER IN iron0.500000
LOWER IN iron supplemented diet0.500000
typhlitis0.500000
intestinal disease0.500000
free range chicken0.500000
short beaked common dolphin0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.856000
homo sapiens0.730667
adult0.469333
united states of america0.346667
china0.200000
control0.120000
research facility0.114667
child0.072000
female0.056000
infant0.053333
rat0.042667
wild0.042667
city0.040000
germany0.040000
mus musculus0.037333
mouse0.037333
male0.037333
LOWER IN control0.034667
australia0.034667
kingdom of spain0.034667
sprague dawley0.032000
hospital0.029333
guangzhou city prefecture0.029333
israel0.026667
rattus norvegicus0.026667
caecum0.026667
heterosexual0.026667
msw0.026667
taiwan0.026667
biopsy0.024000
ulcerative colitis0.024000
obesity0.024000
diarrhea0.021333
rectum0.021333
age 50-80 years0.021333
kingdom of denmark0.021333
south korea0.021333
obsolete_juvenile stage0.021333
c57bl/6j0.018667
colon0.018667
farm0.018667
sweden0.016000
state of florida0.016000
formula fed0.016000
italy0.016000
canis lupus familiaris0.016000
dog0.016000
rattus0.016000
jiangsu province0.016000
sigmoid colon0.013333
terminal ileum0.013333
india0.013333
santa catalina island0.013333
urocyon littoralis0.013333
urocyon littoralis catalinae0.013333
santa catalina island fox0.013333
crohn's disease0.013333
age < 3 years0.013333
state of colorado0.013333
taipei city0.013333
zoological garden0.013333
gallus gallus0.013333
chicken0.013333
republic of china0.013333
state of new york0.013333
state of california0.013333
czech republic0.013333
zhejiang province0.010667
tucson0.010667
skin0.010667
phascolarctos cinereus0.010667
koala0.010667
cape otway0.010667
commonwealth of virginia0.010667
nanchang city prefecture0.010667
state of georgia0.010667
commonwealth of massachusetts0.010667
caribbean latino0.010667
nanning city prefecture0.010667
age 50-60 years0.010667
biopsy site0.010667
finland0.010667
clostridium difficile intestinal infectious disease0.010667
parkinson's disease0.010667
obese body mass index status0.010667
high bmi0.010667
estonia0.010667
juvenile organism0.010667
indonesia0.010667
municipality of yogyakarta0.010667
colombia0.010667
rectal swab0.010667
pregnancy0.010667
colitis0.010667
hunan province0.010667
adula0.010667
snake0.010667
snake farm0.010667
LOWER IN rural community0.010667
africa0.010667
Exp. ID User ID Description Date Region Flag Sequences
597amnon high in gout compared to control in feces homo sapiens adult zhejiang province china 2020-03-23v3No1 / 4
207amnoncommon in people hospitalized with diarrhea (common feces, homo sapiens, israel, diarrhea)2017-10-05v4No1 / 7
399amnondominant feces, united states of america, research facility, mus musculus, mouse2018-11-18v4No1 / 12
689amnoncommon feces, homo sapiens, united states of america, hospital, adult, non c. diff diarrhea, tucson2028-03-11v4No1 / 12
556amnondominant feces, homo sapiens, united states of america, adult2019-09-14v1No1 / 12
441amnondominant feces, united states of america, research facility, mus musculus, c57bl/6j, mouse, jackson laboratories2019-01-06v4No1 / 13
74amnondominant feces, homo sapiens, united states of america2017-02-27v4No1 / 15
502amnondominant feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 15
586amnoncommon feces, research facility, antibiotic, ampicillin, rattus norvegicus, sprague dawley, israel, rat, neomycin, male2020-02-09v4No1 / 15
651amnondominant feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 15
79amnoncommon united states of america, skin, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 15
19amnonhigh freq in biopsies of children (IBD study) (dominant homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 16
541amnondominant feces, australia, wild, phascolarctos cinereus, koala, cape otway, eucalyptus viminalis diet2019-08-01v4No1 / 16
586amnondominant feces, research facility, antibiotic, ampicillin, rattus norvegicus, sprague dawley, israel, rat, neomycin, male2020-02-09v4No1 / 16
659amnondominant feces, homo sapiens, ulcerative colitis, child, acute severe colitis2020-09-19v4No1 / 16
289amnondominant feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 17
368amnondominant feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 17
428amnondominant feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 17
591amnondominant feces, homo sapiens, control, united states of america, adult, age 50-80 years2020-02-17v4No1 / 17
719amnonhigher in diet containing fiber compared to non fiber containing diet ( high in fiber diet compared to control diet in united states of america research facility dentition mus musculus state of georgia mouse charles river laboratories icr/cd-1 mice )2028-05-23v4No1 / 17
570amnon high in control compared to visceral leishmaniasis in feces homo sapiens india bihar state 2019-12-16v3No1 / 17
207amnonhigh freq. in people hospitalized with diarrhea (dominant feces, homo sapiens, israel, diarrhea)2017-10-05v4No1 / 18
215amnondominant feces, homo sapiens, united states of america2017-10-23v4No1 / 18
273amnondominant feces, homo sapiens, infant, kingdom of denmark, age one month2018-01-14v4No1 / 18
368amnondominant feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 18
387amnonhigh freq. in feces of wild brown bear (dominant feces, sweden, wild, ursus arctos, brown bear)2018-11-03v4No1 / 18
430amnondominant feces, homo sapiens, united states of america, city, adult, state of arizona, age 202018-12-15v4No1 / 18
292amnondominant feces, homo sapiens, control, adult, china2018-02-05v4No1 / 19
582amnondominant united states of america, rectum, wild, perianal skin, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 19
689amnoncommon feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 19
803amnondominant feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, age 50-80 years, type 2 diabetes mellitus, caribbean latino2021-06-18v4No1 / 19
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one week2018-01-14v4No1 / 20
273amnondominant feces, homo sapiens, infant, kingdom of denmark, age one week2018-01-14v4No1 / 20
273amnondominant feces, homo sapiens, infant, kingdom of denmark, age one year2018-01-14v4No1 / 20
286amnonhigh freq. in feces of individuals with kidney stones (dominant feces, homo sapiens, adult, nanning city prefecture, age 50-60 years, nephrolithiasis, china)2018-01-27v4No1 / 20
292amnondominant feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 20
292amnondominant feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 20
390amnondominant feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 20
390amnondominant feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 20
409amnondominant homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 20
803amnondominant feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, age 50-80 years, caribbean latino2021-06-18v4No1 / 20
240amnonhigh freq. in infants age <3 years (dominant feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 21
241amnonhigh freq. in babies age < 3 years in finland (dominant feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 21
390amnondominant feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 21
393amnondominant feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 21
591amnondominant feces, homo sapiens, united states of america, adult, age 50-80 years, parkinson's disease2020-02-17v4No1 / 21
779amnondominant feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 21
814amnondominant feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 21
529amnonhigh freq. in patients that underwent low anterior resection (dominant feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 21
593amnondominant feces, homo sapiens, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 21
728amnondominant feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 21
120amnondominant feces, homo sapiens, brazil2017-04-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (dominant feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
286amnonhigh freq. in feces of individuals without kidney stones (dominant feces, homo sapiens, control, adult, nanning city prefecture, age 50-60 years, china)2018-01-27v4No1 / 22
395amnondominant feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
502amnondominant feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 22
689amnondominant feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 22
779amnoncommon feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 22
779amnondominant feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 22
333amnonhigh freq. in stroke patient feces (dominant feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 22
593amnondominant feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 22
132amnondominant feces, homo sapiens, united states of america2017-04-16v4No1 / 23
241amnonhigh freq. in babies age < 3 years in estonia (dominant feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 23
541amnondominant feces, australia, wild, phascolarctos cinereus, koala, cape otway, eucalyptus obliqua diet2019-08-01v4No1 / 23
566amnon high in insomnia compared to control in feces homo sapiens adult china 2019-11-24v4No1 / 23
779amnondominant feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 23
322amnondominant digestive system, united states of america, research facility, adult, state of florida, frog, osteopilus septentrionalis2018-04-23v4No1 / 24
330amnondominant feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 24
597amnondominant feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 24
641amnoncommon feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
641amnondominant feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
428amnoncommon feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 25
779amnoncommon feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 25
714amnondominant homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 25
689amnondominant feces, homo sapiens, united states of america, hospital, adult, non c. diff diarrhea, tucson2028-03-11v4No1 / 26
723amnondominant feces, homo sapiens, infant, child, indonesia, municipality of yogyakarta, age 0-6 months2021-01-02v3No1 / 26
387amnoncommon in feces of wild brown bear (common feces, sweden, wild, ursus arctos, brown bear)2018-11-03v4No1 / 27
659amnoncommon feces, homo sapiens, ulcerative colitis, child, acute severe colitis2020-09-19v4No1 / 27
529amnondominant feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 27
723amnoncommon feces, homo sapiens, child, indonesia, municipality of yogyakarta, age 2-4 years2021-01-02v3No1 / 30
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 31
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 31
63amnon high in diet animal product diet compared to plant based diet in feces homo sapiens united states of america 2017-04-12v4No1 / 32
407amnon high in dry season compared to wet season in feces costa rica monkey wild cebus capucinus white-faced capuchin 2018-11-21v4No1 / 36
681amnoncommon feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 37
390amnoncommon feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 38
19amnoncommon in biopsies of children (IBD study) (common homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 40
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in feces homo sapiens united states of america adult )2018-11-18v4No1 / 41
36amnoncommon feces, homo sapiens, sichuan province2016-12-06v4No1 / 44
406amnoncommon feces, united states of america, zoological garden, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 44
428amnon high in acute pancreatitis pancreatitis compared to control in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 46
797amnoncommon feces, homo sapiens, child, germany, formula fed, age 2 years2021-06-13v3No1 / 46
482amnoncommon feces, homo sapiens, child, colombia, medellin metropolitan area, daycare, age 1-5 years2019-02-12v4No1 / 47
591amnoncommon feces, homo sapiens, united states of america, adult, age 50-80 years, parkinson's disease2020-02-17v4No1 / 47
708amnonhigher in mice with iron deficient diet ( high in iron deficient diet low iron compared to iron iron supplemented diet in feces united states of america research facility mus musculus c57bl/6 mouse state of montana )2028-05-16v4No1 / 47
779amnoncommon feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 47
597amnoncommon feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 47
495amnon high in typhlitis disease intestinal disease compared to control in farm caecum gallus gallus kingdom of spain chicken free range chicken 2019-03-03v4No1 / 48
666amnoncommon feces, italy, delphinus delphis, rectal swab, short beaked common dolphin2020-09-25v3No1 / 48
720amnoncommon feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 48
651amnoncommon feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 49
736amnoncommon feces, homo sapiens, child, tanzania, age 1-3 years, pemba island2021-01-25v3No1 / 49
406amnoncommon feces, united states of america, zoological garden, equus przewalskii, przewalski horse2018-11-21v4No1 / 50
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 50
797amnoncommon feces, homo sapiens, child, germany, breast fed, age 2 years2021-06-13v3No1 / 50
796amnoncommon feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 51
650amnoncommon feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 52
694amnoncommon feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 52
796amnoncommon feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 52
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
131amnon high in female compared to male in feces homo sapiens south korea 2017-04-16v4No1 / 55
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
390amnoncommon feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 55
814amnoncommon feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, systemic lupus erythematosus, china2028-04-11v3No1 / 55
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
368amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
488amnoncommon feces, canis lupus familiaris, italy, dog, lymphoma2019-02-25v4No1 / 56
591amnoncommon feces, homo sapiens, control, united states of america, adult, age 50-80 years2020-02-17v4No1 / 56
650amnoncommon feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 56
720amnoncommon feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 56
563amnon high in control compared to hiv infection in feces homo sapiens united states of america male homosexual msm rectal swab 2019-11-18v4No1 / 58
651amnoncommon feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 58
666amnoncommon feces, homo sapiens, italy2020-09-25v3No1 / 58
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 60
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
637amnoncommon feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 61
51amnon high in control compared to hiv infection in feces homo sapiens united states of america 2017-01-19v4No1 / 62
593amnoncommon feces, homo sapiens, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
442amnonhigher in tnbs induced colitis compared to controls ( high in tnbs colitis compared to control in feces research facility rattus norvegicus sprague dawley male rat china )2019-01-06v4No1 / 63
502amnoncommon feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 63
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 63
575amnoncommon in professional martial arts athletes (common feces, homo sapiens, adult, high physical activity, age 19-24, china, athlete)2020-01-05v3No1 / 63
650amnoncommon feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 66
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
114amnon high in adult compared to tadpole in united states of america research facility intestine state of wisconsin digesta rana pipiens northern leopard frog 2017-04-10v4No1 / 67
365amnoncommon feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 67
221amnonlower in control compared to tnbs induced colitis in rat feces ( high in colitis compared to control in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 68
574amnoncommon feces, homo sapiens, adult, russia2020-01-05v3No1 / 68
593amnoncommon feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 68
644amnon high in female compared to male in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v4No1 / 69
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 1 month 2021-06-13v3No1 / 69
386amnon high in ecuador compared to bolivia in caecum mus musculus mouse wild 2018-10-28v4No1 / 70
594amnon high in city yaounde compared to rural community ngoantet in feces homo sapiens adult cameroon 2020-03-12v4No1 / 70
803amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, age 50-80 years, type 2 diabetes mellitus, caribbean latino2021-06-18v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
644amnoncommon feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 71
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, switzerland2020-09-22v4No1 / 71
656amnoncommon feces, homo sapiens, sri lanka, age 1-18 years2020-09-13v3No1 / 71
114amnoncommon united states of america, research facility, intestine, adult, state of wisconsin, digesta, rana pipiens, northern leopard frog2017-04-10v4No1 / 72
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in non-steroidal anti-inflammatory drug indomethacin compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 72
541amnoncommon feces, australia, wild, phascolarctos cinereus, koala, cape otway, eucalyptus viminalis diet2019-08-01v4No1 / 72
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
395amnoncommon feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 75
719amnoncommon united states of america, research facility, dentition, mus musculus, state of georgia, mouse, charles river laboratories, icr/cd-1 mice2028-05-23v4No1 / 75
794amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, human immunodeficiency virus infectious disease, municipality of logrono, antiretroviral therapy2021-06-08v4No1 / 75
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 3 months 2021-06-13v3No1 / 75
74amnoncommon feces, homo sapiens, united states of america2017-02-27v4No1 / 76
322amnoncommon digestive system, united states of america, research facility, adult, state of florida, frog, osteopilus septentrionalis2018-04-23v4No1 / 76
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in feces homo sapiens china )2018-12-30v4No1 / 76
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, age 17-292019-02-13v4No1 / 76
666amnoncommon feces, tursiops truncatus, italy, rectal swab, common bottlenose dolphin2020-09-25v3No1 / 76
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 77
541amnoncommon feces, australia, wild, phascolarctos cinereus, koala, cape otway, eucalyptus obliqua diet2019-08-01v4No1 / 77
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
556amnoncommon feces, homo sapiens, united states of america, adult2019-09-14v1No1 / 77
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
401amnoncommon feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 79
425amnoncommon feces, homo sapiens, child, africa, central african republic, bangui2018-12-08v4No1 / 79
529amnoncommon feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 79
732amnoncommon feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 79
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 80
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
643amnoncommon feces, homo sapiens, adult, south korea2020-08-30v4No1 / 81
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 82
562amnoncommon feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 82
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, china2028-04-11v3No1 / 82
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 83
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to enzyme supplementation exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 85
311amnoncommon in salted cabbage (common united states of america, state of rhode island, cabbage, foodon product type)2018-04-09v4No1 / 85
601amnoncommon feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 85
629amnon high in heterosexual msw compared to homosexual msm in feces homo sapiens adult male kingdom of the netherlands amsterdam 2020-05-31v4No1 / 85
663amnoncommon feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 85
804amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens child africa central african republic madagascar age 2-5 years 2021-06-18v4No1 / 85
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
249amnoncommon feces, homo sapiens, united states of america2017-11-22v4No1 / 86
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 86
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, age 202018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
404amnon high in female compared to male in feces homo sapiens city adult colombia 2018-11-20v4No1 / 88
487amnoncommon feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 88
582amnoncommon united states of america, rectum, wild, perianal skin, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 88
293amnoncommon feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 89
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 89
803amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, age 50-80 years, caribbean latino2021-06-18v4No1 / 89
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, naja atra, chinese cobra, china2019-07-21v4No1 / 90
582amnoncommon united states of america, pair of nares, wild, external naris, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 92
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
488amnoncommon feces, control, canis lupus familiaris, italy, dog2019-02-25v4No1 / 94
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 95
736amnoncommon feces, homo sapiens, female, adult, tanzania, pemba island2021-01-25v3No1 / 95
238amnoncommon feces, homo sapiens, colombia2017-11-07v4No1 / 96
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 97
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 97
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
532amnoncommon feces, homo sapiens, control, adult, czech republic2019-07-21v1No1 / 98
441amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6j, mouse, jackson laboratories2019-01-06v4No1 / 99
645amnoncommon cloaca, state of idaho, bird, captive, gymnogyps californianus, california condor2020-09-03v4No1 / 99
124amnonhigher in ifn-gamma knockout comapred to wt ( high in interferon gamma knockout compared to control in feces united states of america caecum mus musculus c57bl/6j mouse )2017-04-14v4No1 / 100
438amnoncommon feces, homo sapiens, age 19-24, china2018-12-30v4No1 / 101
477amnoncommon feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 103
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
693amnoncommon feces, homo sapiens, female, adult, austria, graz city district2028-03-16v1No1 / 104
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 106
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china2018-12-30v4No1 / 106
797amnon high in age 1 year compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
406amnoncommon feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 107
409amnoncommon feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 108
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china2018-12-30v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 60-79, china2018-12-30v4No1 / 111
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 30-50, china2018-12-30v4No1 / 115
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in feces homo sapiens adult taipei city taiwan )2019-07-18v3No1 / 115
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age age 3 months compared to age 1 week in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 116
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy site biopsy compared to feces in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 118
743amnoncommon feces, farm, adult, italy, captive, lepus europaeus, european hare2021-02-21v3No1 / 119
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china2018-12-30v4No1 / 121
386amnonnegatively correlated with altitude (0-4km) in house mouse caecum ( high in low altitude compared to high altitude in caecum mus musculus south america mouse wild )2018-10-28v4No1 / 122
449amnoncommon feces, homo sapiens, colombia2019-01-09v4No1 / 124
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 125
273amnon high in age age 1 week compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 127
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, age 30-402018-05-13v4No1 / 130
586amnon high in fructose diet fructose compared to control diet in feces research facility rattus norvegicus sprague dawley israel rat male 2020-02-09v4No1 / 130
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
108amnoncommon united states of america, research facility, colon, texas, anaxyrus terrestris, southern toad2017-04-07v4No1 / 132
766amnon high in age 8 weeks compared to age 2 days in feces canis lupus familiaris french republic dog rectal swab puppy 2021-04-12v4No1 / 133
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 132017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
797amnon high in child age 2 years compared to infant age 1 year in feces homo sapiens germany formula fed 2021-06-13v3No1 / 139
582amnoncommon united states of america, axilla, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 140
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 148
759amnon high in canis lupus familiaris dog compared to canis lupus wolf wildlife sactuary in feces united states of america state of minnesota 2021-04-06v4No1 / 148
300amnoncommon united states of america, female, research facility, caecum, rattus norvegicus, rat, ovariectomy, age 38 weeks2018-02-27v4No1 / 150
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 154
594amnoncommon feces, homo sapiens, city, adult, cameroon, yaounde2020-03-12v4No1 / 154
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 162
322amnon high in adult compared to tadpole in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2018-04-23v4No1 / 163
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, age 13, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
530amnoncommon feces, farm, hunan province, adula, snake, deinagkistrodon acutus, pit viper, snake farm, china2019-07-21v4No1 / 178
399amnon high in control compared to ulcerative colitis in feces homo sapiens united states of america 2018-11-16v4No1 / 180
639amnoncommon feces, nature reserve, adult, australia, wild, lepus europaeus, european brown hare2020-08-21v3No1 / 182
107amnoncommon united states of america, research facility, colon, texas, eublepharis macularius, leopard gecko2017-04-07v4No1 / 183
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
321amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6j, mouse2018-04-22v4No1 / 183
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to wastewater treatment plant sewer in city south america low income )2017-01-21v4No1 / 187
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
321amnonlower in mice treated with Metronidazole compared to untreated mice ( high in control compared to antibiotic metronidazole in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 193
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
738amnoncommon gallus gallus, chicken, age 30 days, united kingdom, caecum2021-01-30v3No1 / 202
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
669amnon high in age 1 year compared to age 2 months in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v3No1 / 214
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 220
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
351amnoncommon feces, united states of america, research facility, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 233
349amnoncommon feces, research facility, sprague dawley, rattus, male, rat, china2018-07-29v4No1 / 235
639amnon high in lepus europaeus european brown hare compared to oryctolagus cuniculus european rabbit in feces nature reserve adult australia wild 2020-08-21v3No1 / 235
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in feces homo sapiens china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, age 50-60 years, nephrolithiasis, china)2018-01-27v4No1 / 239
161amnoncommon in barn swallows in colorado (common feces, united states of america, hirundo rustica, colorado, barn swallow)2017-07-12v4No1 / 245
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in feces homo sapiens infant india )2016-12-19v4No1 / 253
419amnoncommon feces, research facility, rattus norvegicus, sprague dawley, rat, china2018-12-02v4No1 / 254
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
568amnoncommon feces, gallus gallus, chicken, broiler chicken, viet nam2019-12-08v3No1 / 272
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, age 50-60 years, china)2018-01-27v4No1 / 281
586amnoncommon feces, research facility, rattus norvegicus, sprague dawley, israel, rat, fructose diet, fructose, male2020-02-09v4No1 / 287
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
419amnoncommon in rats with induced constipation (common feces, research facility, rattus norvegicus, sprague dawley, rat, constipation, china)2018-12-02v4No1 / 300
78amnon high in male compared to female in feces tropical grassland biome kenya nanger granti gazelle 2017-03-01v4No1 / 301
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
723amnon high in age 2-4 years compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
358amnoncommon feces, research facility, rattus, czech republic, rat, wistar rat2018-08-19v4No1 / 309
510amnoncommon estuary, water, fresh water, kingdom of spain, estuary water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
338amnonlower in wild salamanders compared to zoo grown salamanders ( high in zoological garden zoo compared to pond area designated as a nature reserve in skin andrias japonicus japanese giant salamander japan )2018-05-21v4No1 / 334
423amnon high in human contact compared to no human contact chernobyl exclusion zone in skin ukraine bank vole myodes glareolus 2018-12-05v4No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 347
187amnoncommon feces, research facility, rattus, czech republic, rat, wistar rat2017-08-23v4No1 / 351
254amnonhigher in river when close to populated region compared to downstream ( high in populated place city upstream compared to downstream in river water fresh water fujian province depth 0.5m jiulong river china )2017-11-23v4No1 / 356
442amnoncommon in tnbs induced colitis in rat feces (common feces, research facility, rattus norvegicus, sprague dawley, male, rat, tnbs, colitis, china)2019-01-06v4No1 / 360
337amnonlower in manhattan compared to queens in feces of house mice from new york city ( high in queens region compared to manhatten region in united states of america city mus musculus new york city mouse house mice )2018-05-18v4No1 / 362
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
442amnoncommon feces, research facility, rattus norvegicus, sprague dawley, male, rat, china2019-01-06v4No1 / 378
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in diet cron diet caloric restriction diet compared to american diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 381
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 400
625amnoncommon feces, united states of america, zoological garden, state of minnesota, pongo abelii, sumatran orangutan, como zoo2020-05-16v4No1 / 414
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
339amnon high in adult compared to infant age < 1 year in feces homo sapiens india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
221amnoncommon feces, research facility, sprague dawley, rattus, rat, china2017-10-25v4No1 / 470
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in feces homo sapiens china )2018-12-30v4No1 / 474
738amnon high in age 30 days compared to age 1 week in gallus gallus chicken united kingdom caecum 2021-01-30v3No1 / 474
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in feces homo sapiens child africa 2018-12-08v4No1 / 564
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, china, spring)2017-07-12v4No1 / 573
399amnoncommon feces, united states of america, research facility, oryctolagus cuniculus, rabbit2018-11-16v4No1 / 577
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium officinale, flowerpot2021-06-20v4No1 / 715
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common soil, compost biofilter, compost, pig manure, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa)2021-04-14v4No1 / 866
649amnon high in colon compared to ileum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 897
767sheryocommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (common soil, compost biofilter, pig manure, compost soil, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, conventional tillage, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa, soil fumigation, dazomet, deep plough)2021-04-18v4No1 / 1109
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261

Problems / suggestions? Please email info AT dbbact DOT org