Search result for sequence:
TACGGAGGATTCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAATTTCGGGGCTCAACCCTGAACGTGCCTCTAATACTGTTGAGCTAGAGAGTAGTTGCGGTAGGCGGAATGTATGG
common ontology terms
term enrichment score
TermScore
homo sapiens0.626549
feces0.568024
adult0.508559
united states of america0.246739
china0.173554
control0.162702
child0.143251
female0.099436
obesity0.092879
kingdom of spain0.089324
city0.086807
heterosexual0.071720
msw0.071720
taiwan0.065288
obsolete_juvenile stage0.062893
high bmi0.061444
age 50-80 years0.058442
guangzhou city prefecture0.058442
italy0.053973
germany0.052212
LOWER IN crohn's disease0.046053
jiangsu province0.045845
united kingdom0.043614
estonia0.039735
republic of china0.039735
obese body mass index status0.039344
state of new york0.037855
state of colorado0.037855
south korea0.037618
infant0.037290
gallus gallus0.035191
chicken0.035191
age 30-500.033278
LOWER IN ulcerative colitis0.033223
biopsy0.033140
caecum0.033058
rectum0.032733
rural community0.032733
poland0.032468
low bmi0.031696
state of california0.030030
israel0.030030
LOWER IN homosexual0.026846
LOWER IN msm0.026846
biopsy site0.026816
age 19-240.026756
colombia0.026756
age 2-4 years0.026756
LOWER IN rural community0.026756
parkinson's disease0.026696
type 2 diabetes mellitus0.026578
caribbean latino0.026578
taipei city0.026578
india0.026578
LOWER IN infant0.026490
thailand0.026230
pregnancy0.025890
state of michigan0.025723
hiv infection0.025559
age0.025478
sweden0.025078
commonwealth of massachusetts0.024922
switzerland0.024615
brazil0.024169
colon0.023881
water0.021838
male0.021448
research facility0.020870
LOWER IN gay0.020202
overweight body mass index status0.020168
metabolic syndrome0.020168
state of oklahoma0.020168
age 5-13 years0.020168
age 60-790.020067
taoyuan city0.020067
oslo0.020067
age 30-400.020067
low anterior resection0.020067
zhengzhou city prefecture0.020067
nanning city prefecture0.020067
age 50-60 years0.020067
age<17 years0.020067
denver0.020067
age 4-10 years0.020067
age 130.020067
age 30 days0.019868
european0.019868
atlanta0.019868
food allergy0.019868
kingdom of denmark0.019769
finland0.019769
diarrhea0.019672
caucasian0.019672
amsterdam0.019672
LOWER IN child0.019672
new zealand0.019672
lamb0.019672
hospital0.019481
commonwealth of virginia0.019481
ketogenic diet0.019481
Fraction of dbbact annotations with this term covered by the query
TermScore
heterosexual0.800000
msw0.800000
LOWER IN homosexual0.800000
LOWER IN msm0.800000
taiwan0.750000
biopsy site0.750000
LOWER IN gay0.750000
estonia0.666667
age 19-240.666667
colombia0.666667
republic of china0.666667
age 2-4 years0.666667
overweight body mass index status0.666667
metabolic syndrome0.666667
age 30-500.666667
animal product diet0.666667
state of oklahoma0.666667
LOWER IN rural community0.666667
age 5-13 years0.666667
LOWER IN crohn&#39;s disease0.636364
LOWER IN ulcerative colitis0.625000
age 50-80 years0.600000
parkinson's disease0.600000
guangzhou city prefecture0.600000
biopsy0.571429
LOWER IN clostridium difficile colitis0.500000
tucson0.500000
santa catarina state0.500000
small waist circumference0.500000
LOWER IN waist circumference0.500000
LOWER IN large waist circumference0.500000
systemic lupus erythematosus0.500000
age 200.500000
obesity0.500000
obese body mass index status0.500000
age 60-790.500000
atherosclerosis0.500000
daycare0.500000
age 1-5 years0.500000
type 2 diabetes mellitus0.500000
caribbean latino0.500000
municipality of reus0.500000
taoyuan city0.500000
age 17-290.500000
oslo0.500000
age 30-400.500000
rem sleep behavior disorder0.500000
age 50-70 years0.500000
taipei city0.500000
low anterior resection0.500000
zhengzhou city prefecture0.500000
nanning city prefecture0.500000
age 50-60 years0.500000
age<17 years0.500000
denver0.500000
LOWER IN age 25-50 years0.500000
midwest region0.500000
age 13-140.500000
centererians0.500000
before hsct0.500000
LOWER IN plant based diet0.500000
LOWER IN endospore enriched fraction0.500000
LOWER IN lysis0.500000
autoimmune hepatitis0.500000
breast fed0.500000
graves' disease0.500000
stroke0.500000
salmonella gastroenteritis0.500000
vegetarian diet0.500000
chengdu city prefecture0.500000
gestational age 8-12 weeks0.500000
schizophrenia0.500000
athlete0.500000
cheyenne0.500000
native american0.500000
arapaho0.500000
coronary heart disease0.500000
omnivore diet0.500000
indonesia0.500000
municipality of yogyakarta0.500000
yaounde0.500000
LOWER IN ngoantet0.500000
human immunodeficiency virus infectious disease0.500000
municipality of logrono0.500000
antiretroviral therapy0.500000
common bottlenose dolphin0.500000
age 4-10 years0.500000
sesame allergy0.500000
quito0.500000
LOWER IN egypt0.500000
metabolic syndrome x0.500000
perianal skin0.500000
urocyon littoralis0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
milk allergy0.500000
azerbaijan0.500000
third trimester0.500000
age 8-120.500000
LOWER IN inflammatory bowel disease0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.894198
feces0.890785
adult0.556314
united states of america0.331058
china0.191126
control0.150171
child0.088737
female0.064846
kingdom of spain0.051195
obesity0.051195
city0.047782
heterosexual0.037543
msw0.037543
high bmi0.034130
taiwan0.034130
obsolete_juvenile stage0.034130
age 50-80 years0.030717
italy0.030717
germany0.030717
guangzhou city prefecture0.030717
jiangsu province0.027304
united kingdom0.023891
LOWER IN crohn&#39;s disease0.023891
south korea0.020478
obese body mass index status0.020478
estonia0.020478
gallus gallus0.020478
chicken0.020478
caecum0.020478
republic of china0.020478
state of new york0.020478
state of colorado0.020478
research facility0.020478
infant0.020478
low bmi0.017065
poland0.017065
state of california0.017065
age 30-500.017065
LOWER IN ulcerative colitis0.017065
biopsy0.017065
israel0.017065
rectum0.017065
rural community0.017065
brazil0.013652
state of michigan0.013652
switzerland0.013652
age 19-240.013652
colombia0.013652
commonwealth of massachusetts0.013652
type 2 diabetes mellitus0.013652
caribbean latino0.013652
age 2-4 years0.013652
hiv infection0.013652
sweden0.013652
male0.013652
parkinson's disease0.013652
taipei city0.013652
thailand0.013652
biopsy site0.013652
pregnancy0.013652
LOWER IN rural community0.013652
LOWER IN homosexual0.013652
LOWER IN msm0.013652
LOWER IN control0.013652
colon0.013652
LOWER IN infant0.013652
india0.013652
age0.013652
water0.013652
hospital0.010239
diarrhea0.010239
commonwealth of virginia0.010239
ketogenic diet0.010239
age 60-790.010239
age 30 days0.010239
taoyuan city0.010239
caucasian0.010239
european0.010239
kingdom of norway0.010239
oslo0.010239
age 30-400.010239
overweight body mass index status0.010239
low anterior resection0.010239
zhengzhou city prefecture0.010239
nanning city prefecture0.010239
age 50-60 years0.010239
atlanta0.010239
age<17 years0.010239
metabolic syndrome0.010239
kingdom of denmark0.010239
denver0.010239
broiler chicken0.010239
commonwealth of pennsylvania0.010239
diet0.010239
australia0.010239
state of oklahoma0.010239
food allergy0.010239
age 4-10 years0.010239
age 5-13 years0.010239
kingdom of the netherlands0.010239
Exp. ID User ID Description Date Region Flag Sequences
689amnon high in non c. diff diarrhea compared to clostridium difficile colitis clostridium difficile infection in feces homo sapiens united states of america hospital diarrhea adult tucson 2028-03-11v4No1 / 1
757amnon high in female compared to male in feces homo sapiens adult brazil santa catarina state 2021-03-28v3No1 / 11
74amnondominant feces, homo sapiens, united states of america2017-02-27v4No1 / 15
131amnonnegatively correlated with waist circumference ( high in small waist circumference compared to waist circumference large waist circumference in feces homo sapiens south korea )2017-04-16v4No1 / 15
289amnondominant feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 17
368amnondominant feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 17
400amnonhigh freq. in feces of european american females (dominant feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 17
591amnondominant feces, homo sapiens, control, united states of america, adult, age 50-80 years2020-02-17v4No1 / 17
663amnondominant feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 17
630amnondominant feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 17
215amnondominant feces, homo sapiens, united states of america2017-10-23v4No1 / 18
368amnondominant feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 18
430amnondominant feces, homo sapiens, united states of america, city, adult, state of arizona, age 202018-12-15v4No1 / 18
663amnondominant feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 18
663amnondominant feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 18
799amnondominant in obese participant fecal samples before ketogenic diet (dominant feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 18
799amnondominant in obese participant fecal samples after 1 month ketogenic diet (dominant feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 18
438amnondominant feces, homo sapiens, age 19-24, china2018-12-30v4No1 / 19
438amnondominant feces, homo sapiens, adult, jiangsu province, age 60-79, china2018-12-30v4No1 / 19
455amnondominant feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 19
477amnondominant feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 19
482amnondominant feces, homo sapiens, child, colombia, medellin metropolitan area, daycare, age 1-5 years2019-02-12v4No1 / 19
803amnondominant feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, age 50-80 years, type 2 diabetes mellitus, caribbean latino2021-06-18v4No1 / 19
732amnondominant feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 19
738amnondominant gallus gallus, chicken, age 30 days, united kingdom, caecum2021-01-30v3No1 / 19
796amnondominant feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 19
484amnondominant feces, homo sapiens, united states of america, adult, state of michigan, age 17-292019-02-13v4No1 / 20
650amnondominant feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 20
663amnondominant feces, homo sapiens, obesity, adult, obese body mass index status, switzerland2020-09-22v4No1 / 20
803amnondominant feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, age 50-80 years, caribbean latino2021-06-18v4No1 / 20
564amnondominant feces, homo sapiens, autistic disorder, child, italy, age 2-4 years2019-11-18v3No1 / 20
578amnondominant feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 20
122amnondominant feces, homo sapiens, united kingdom2017-04-13v4No1 / 21
247amnondominant feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 21
249amnondominant feces, homo sapiens, united states of america2017-11-22v4No1 / 21
330amnondominant feces, homo sapiens, adult, kingdom of norway, oslo, age 30-402018-05-13v4No1 / 21
393amnondominant feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 21
591amnondominant feces, homo sapiens, united states of america, adult, age 50-80 years, parkinson's disease2020-02-17v4No1 / 21
607amnondominant feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 21
814amnondominant feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 21
529amnonhigh freq. in patients that underwent low anterior resection (dominant feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 21
720amnondominant feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 21
120amnondominant feces, homo sapiens, brazil2017-04-12v4No1 / 22
284amnondominant feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 22
286amnonhigh freq. in feces of individuals without kidney stones (dominant feces, homo sapiens, control, adult, nanning city prefecture, age 50-60 years, china)2018-01-27v4No1 / 22
297amnondominant feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 22
467amnondominant feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 22
779amnondominant feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 22
132amnondominant feces, homo sapiens, united states of america2017-04-16v4No1 / 23
344amnonhigh freq. in feces of heterosexuals (dominant feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 23
601amnondominant feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 23
568amnondominant feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 23
666amnondominant feces, homo sapiens, italy2020-09-25v3No1 / 23
239amnondominant feces, homo sapiens, united states of america2017-11-08v4No1 / 24
395amnondominant feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 24
745amnon high in age 50-80 years compared to age 25-50 years in feces homo sapiens united states of america adult midwest region 2021-02-25v3No1 / 24
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, china2028-04-11v3No1 / 25
650amnonpositively correlated with BMI ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america adult state of new york )2020-09-09v4No1 / 26
131amnondominant feces, homo sapiens, south korea2017-04-16v4No1 / 27
601amnondominant feces, homo sapiens, control, adult, china2020-03-30v4No1 / 27
779amnon high in control compared to ulcerative colitis in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 28
438amnondominant feces, homo sapiens, jiangsu province, age 13-14, china2018-12-30v4No1 / 29
36amnonhigher in centernarians ( high in centererians compared to adult in feces homo sapiens sichuan province )2016-12-06v4No1 / 30
655amnoncommon in patients before hematopoietic stem cell transplant (common feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 31
63amnon high in diet animal product diet compared to plant based diet in feces homo sapiens united states of america 2017-04-12v4No1 / 32
51amnoncommon homo sapiens, united states of america, biopsy site, biopsy2017-01-19v4No1 / 36
297amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years 2018-02-12v4No1 / 38
390amnoncommon feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 38
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 41
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in feces homo sapiens united states of america adult )2018-11-18v4No1 / 41
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, age 2-4 years2019-11-18v3No1 / 42
36amnoncommon feces, homo sapiens, sichuan province2016-12-06v4No1 / 44
591amnoncommon feces, homo sapiens, united states of america, adult, age 50-80 years, parkinson's disease2020-02-17v4No1 / 47
779amnoncommon feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 47
597amnoncommon feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 47
720amnoncommon feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 48
651amnoncommon feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 49
564amnoncommon feces, homo sapiens, control, child, italy, age 2-4 years2019-11-18v3No1 / 50
797amnoncommon feces, homo sapiens, child, germany, breast fed, age 2 years2021-06-13v3No1 / 50
796amnoncommon feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 51
650amnoncommon feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 52
694amnoncommon feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 52
796amnoncommon feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 52
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
131amnon high in female compared to male in feces homo sapiens south korea 2017-04-16v4No1 / 55
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
390amnoncommon feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 55
814amnoncommon feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, systemic lupus erythematosus, china2028-04-11v3No1 / 55
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
591amnoncommon feces, homo sapiens, control, united states of america, adult, age 50-80 years2020-02-17v4No1 / 56
650amnoncommon feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 56
720amnoncommon feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 56
651amnoncommon feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 58
666amnoncommon feces, homo sapiens, italy2020-09-25v3No1 / 58
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 60
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
637amnoncommon feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 61
51amnon high in control compared to hiv infection in feces homo sapiens united states of america 2017-01-19v4No1 / 62
593amnoncommon feces, homo sapiens, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
502amnoncommon feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 63
575amnoncommon in professional martial arts athletes (common feces, homo sapiens, adult, high physical activity, age 19-24, china, athlete)2020-01-05v3No1 / 63
242amnoncommon in native-americans (common feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 65
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
757amnoncommon feces, homo sapiens, adult, brazil, santa catarina state2021-03-28v3No1 / 67
574amnoncommon feces, homo sapiens, adult, russia2020-01-05v3No1 / 68
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 68
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
22amnon high in control compared to hiv infection in feces homo sapiens united states of america 2016-11-28v4No1 / 70
594amnon high in city yaounde compared to rural community ngoantet in feces homo sapiens adult cameroon 2020-03-12v4No1 / 70
803amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, age 50-80 years, type 2 diabetes mellitus, caribbean latino2021-06-18v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
644amnoncommon feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 71
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, switzerland2020-09-22v4No1 / 71
395amnoncommon feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 75
794amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, human immunodeficiency virus infectious disease, municipality of logrono, antiretroviral therapy2021-06-08v4No1 / 75
74amnoncommon feces, homo sapiens, united states of america2017-02-27v4No1 / 76
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, age 17-292019-02-13v4No1 / 76
666amnoncommon feces, tursiops truncatus, italy, rectal swab, common bottlenose dolphin2020-09-25v3No1 / 76
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 77
799amnonlower before ketogenic diet compared to after ketogenic diet in obese participants ( high in ketogenic diet compared to control diet in feces homo sapiens obesity adult estonia high bmi )2021-06-13v3No1 / 77
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
401amnoncommon feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 79
529amnoncommon feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 79
732amnoncommon feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 79
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 80
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
643amnoncommon feces, homo sapiens, adult, south korea2020-08-30v4No1 / 81
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 82
562amnoncommon feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 82
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, china2028-04-11v3No1 / 82
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 83
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
601amnoncommon feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 85
629amnon high in heterosexual msw compared to homosexual msm in feces homo sapiens adult male kingdom of the netherlands amsterdam 2020-05-31v4No1 / 85
663amnoncommon feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 85
249amnoncommon feces, homo sapiens, united states of america2017-11-22v4No1 / 86
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 86
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, age 202018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
487amnoncommon feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 88
582amnoncommon united states of america, rectum, wild, perianal skin, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 88
293amnoncommon feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 89
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 89
803amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, age 50-80 years, caribbean latino2021-06-18v4No1 / 89
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
238amnoncommon feces, homo sapiens, colombia2017-11-07v4No1 / 96
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 97
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 97
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
702amnon high in felis catus cat compared to canis lupus familiaris dog in feces united states of america state of north carolina 2028-04-02v4No1 / 100
438amnoncommon feces, homo sapiens, age 19-24, china2018-12-30v4No1 / 101
477amnoncommon feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 103
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 106
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china2018-12-30v4No1 / 106
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
695amnon high in milk allergy compared to sesame allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 107
409amnoncommon feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 108
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in feces homo sapiens united states of america child )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 60-79, china2018-12-30v4No1 / 111
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 30-50, china2018-12-30v4No1 / 115
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in feces homo sapiens adult taipei city taiwan )2019-07-18v3No1 / 115
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy site biopsy compared to feces in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 118
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china2018-12-30v4No1 / 121
449amnoncommon feces, homo sapiens, colombia2019-01-09v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to child obsolete_juvenile stage crohn's disease in feces homo sapiens glasgow )2017-02-26v4No1 / 125
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 125
779amnon high in control compared to crohn's disease in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 127
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
649amnoncommon research facility, ovis aries, new zealand, sheep, lamb, age 6 weeks, colon2020-09-07v3No1 / 128
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, age 30-402018-05-13v4No1 / 130
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
526amnon high in cholelithiasis compared to control in homo sapiens bile gallbladder adult kingdom of spain 2019-07-14v3No1 / 131
660amnonlower in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in upano valley compared to cross-cutucu in feces homo sapiens ecuador rural community village shuar population )2020-09-20v4No1 / 132
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 132017-09-12v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 136
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens juvenile organism obsolete_juvenile stage age 13 2017-09-12v4No1 / 138
797amnon high in child age 2 years compared to infant age 1 year in feces homo sapiens germany formula fed 2021-06-13v3No1 / 139
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in feces homo sapiens united states of america )2017-02-27v4No1 / 149
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, bile, gallbladder, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens adult china 2018-02-05v4No1 / 161
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, age 13, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in feces homo sapiens infant )2017-11-13v4No1 / 173
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
738amnoncommon gallus gallus, chicken, age 30 days, united kingdom, caecum2021-01-30v3No1 / 202
568amnon high in thailand compared to viet nam in feces gallus gallus chicken broiler chicken 2019-12-08v3No1 / 206
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
669amnon high in age 1 year compared to age 2 months in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v3No1 / 214
108amnoncommon united states of america, research facility, caecum, texas, coturnix coturnix, common quail2017-04-07v4No1 / 216
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 220
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in feces homo sapiens china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, age 50-60 years, nephrolithiasis, china)2018-01-27v4No1 / 239
161amnoncommon in barn swallows in colorado (common feces, united states of america, hirundo rustica, colorado, barn swallow)2017-07-12v4No1 / 245
781amnoncommon feces, kenya, wild, masai mara national park, madoqua kirkii, kirk's dik-dik2021-04-28v4No1 / 248
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in feces homo sapiens infant india )2016-12-19v4No1 / 253
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, age 50-60 years, china)2018-01-27v4No1 / 281
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
723amnon high in age 2-4 years compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
510amnoncommon estuary, water, fresh water, kingdom of spain, estuary water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
568amnoncommon feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 320
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 345
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in populated place city upstream compared to downstream in river water fresh water fujian province depth 0.5m jiulong river china )2017-11-23v4No1 / 356
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
108amnon high in caecum compared to colon in united states of america research facility texas coturnix coturnix common quail 2017-04-07v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in diet cron diet caloric restriction diet compared to american diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 381
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 400
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
339amnon high in adult compared to infant age < 1 year in feces homo sapiens india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
738amnon high in age 30 days compared to age 1 week in gallus gallus chicken united kingdom caecum 2021-01-30v3No1 / 474
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
438amnon high in adult age 30-50 age 60-79 compared to child age 3-6 age 8-12 in feces homo sapiens china 2018-12-30v4No1 / 486
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 0-90)2020-04-05v3No1 / 542
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in feces homo sapiens child africa 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common soil, compost biofilter, compost, pig manure, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa)2021-04-14v4No1 / 866
649amnon high in colon compared to ileum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 897
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common soil, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil fumigation, dazomet)2021-04-14v4No1 / 946
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261

Problems / suggestions? Please email info AT dbbact DOT org