Search result for sequence:
TACGTAGGGAGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGCTTTGCAAGTCAGATGTGAAATCTATGGGCTCAACCCATAAACTGCATTTGAAACTGTAGAGCTTGAGTGAAGTAGAGGCAGGCGGAATTCCCCG
common ontology terms
term enrichment score
TermScore
feces0.588613
homo sapiens0.545374
adult0.392779
united states of america0.223718
child0.179115
control0.167076
china0.150470
female0.136131
research facility0.117417
rural community0.104499
sus scrofa0.102623
pig0.097365
rat0.096530
city0.083887
rattus norvegicus0.076342
israel0.074074
caecum0.073059
infant0.070928
obsolete_juvenile stage0.068182
zoological garden0.067039
obesity0.063953
kingdom of spain0.061338
sprague dawley0.058480
amsterdam0.052941
germany0.052701
pregnancy0.052386
wild0.052356
monkey0.052250
kingdom of the netherlands0.051576
india0.047337
jiangsu province0.042328
age 5-13 years0.042105
LOWER IN crohn's disease0.042042
obese body mass index status0.036364
overweight body mass index status0.036254
macaca mulatta0.035928
control diet0.034286
canada0.033946
male0.033708
state of california0.032432
small village0.030426
state of oklahoma0.030349
nigeria0.030349
age 10-15 years0.030120
age 4-10 years0.030120
chuquisaca department0.030120
chimpanzee0.030120
czech republic0.029970
state of new york0.029821
food allergy0.029674
age 1 year0.029528
finland0.029455
duodenum0.029383
female organism0.029383
switzerland0.029240
bolivia0.029240
united kingdom0.028409
skin0.027529
captive0.027435
farm0.027341
taiwan0.024440
guangzhou city prefecture0.024341
tanzania0.024242
hunter gatherer0.024242
age 130.024242
denver0.024242
kebbi state0.024242
como zoo0.024242
republic of congo0.024242
nouabale-ndoki national park0.024242
rhesus macaque0.024242
water0.024174
heterosexual0.024096
msw0.024096
rattus0.023952
homosexual0.023952
msm0.023952
kingdom of denmark0.023810
russia0.023669
belgium0.023669
river0.023669
south korea0.023576
commonwealth of pennsylvania0.023529
age0.023324
italy0.023121
juvenile organism0.023121
high bmi0.022989
state of minnesota0.022857
state of colorado0.022599
mus musculus0.019769
metabolic syndrome0.018377
age < 3 years0.018377
nanchang city prefecture0.018377
myanmar0.018293
karen0.018293
hadza0.018293
age 50-70 years0.018293
glasgow0.018293
gaz:000521000.018293
age 8-120.018293
Fraction of dbbact annotations with this term covered by the query
TermScore
rural community0.800000
taiwan0.750000
small village0.750000
obese body mass index status0.750000
rattus norvegicus0.700000
republic of china0.666667
state of oklahoma0.666667
age 2-4 years0.666667
overweight body mass index status0.666667
metabolic syndrome0.666667
nigeria0.666667
age < 3 years0.666667
age 5-13 years0.666667
age 30-500.666667
village0.666667
nanchang city prefecture0.666667
LOWER IN crohn&#39;s disease0.636364
sus scrofa0.625000
pig0.625000
guangzhou city prefecture0.600000
rat0.562500
sprague dawley0.500000
myanmar0.500000
karen0.500000
omnivore diet0.500000
LOWER IN vegetarian diet0.500000
LOWER IN exercise0.500000
age 38 weeks0.500000
low capacity running strain0.500000
amsterdam0.500000
irritable bowel syndrome0.500000
india0.500000
camp sengeli0.500000
LOWER IN camp hukamako0.500000
tanzania0.500000
hunter gatherer0.500000
hadza0.500000
age 130.500000
cheyenne0.500000
native american0.500000
arapaho0.500000
denver0.500000
rem sleep behavior disorder0.500000
obesity0.500000
age 50-70 years0.500000
kebbi state0.500000
age 10-15 years0.500000
ateles geoffroyi0.500000
como zoo0.500000
black-handed spider monkey0.500000
el salvador0.500000
glasgow0.500000
spondyloarthritis0.500000
spondylitis0.500000
schistosomiasis0.500000
urinary schistosomiasis0.500000
oslo0.500000
midwest region0.500000
lima0.500000
shantytown0.500000
third trimester0.500000
gaz:000521000.500000
LOWER IN weight loss0.500000
LOWER IN weight loss diet0.500000
LOWER IN high protein diet0.500000
graves' disease0.500000
taoyuan city0.500000
cornell university0.500000
age 8-120.500000
milk allergy0.500000
age 4-10 years0.500000
jordan0.500000
quito0.500000
centererians0.500000
age 3-60.500000
sesame allergy0.500000
fresh0.500000
LOWER IN late timpoint0.500000
LOWER IN food spoilage0.500000
LOWER IN chronic fatigue syndrome0.500000
new york county0.500000
LOWER IN premature birth0.500000
new delhi0.500000
sudan0.500000
age one year0.500000
LOWER IN salt0.500000
LOWER IN salt rich diet0.500000
dahl salt-sensitive0.500000
przewalski horse0.500000
stroke0.500000
chengdu city prefecture0.500000
gestational age 8-12 weeks0.500000
schizophrenia0.500000
indonesia0.500000
municipality of yogyakarta0.500000
human immunodeficiency virus infectious disease0.500000
municipality of logrono0.500000
antiretroviral therapy0.500000
coturnix coturnix0.500000
common quail0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.872671
homo sapiens0.720497
adult0.375776
united states of america0.267081
china0.142857
control0.142857
child0.118012
research facility0.108696
female0.090062
rural community0.055901
sus scrofa0.055901
rat0.052795
pig0.052795
city0.046584
caecum0.043478
israel0.043478
rattus norvegicus0.040373
infant0.040373
obsolete_juvenile stage0.037267
zoological garden0.037267
kingdom of spain0.034161
obesity0.034161
sprague dawley0.031056
germany0.031056
wild0.031056
kingdom of the netherlands0.027950
amsterdam0.027950
pregnancy0.027950
monkey0.027950
india0.024845
jiangsu province0.024845
male0.021739
age 5-13 years0.021739
LOWER IN crohn&#39;s disease0.021739
control diet0.018634
obese body mass index status0.018634
overweight body mass index status0.018634
state of california0.018634
canada0.018634
macaca mulatta0.018634
state of oklahoma0.015528
small village0.015528
finland0.015528
switzerland0.015528
state of new york0.015528
united kingdom0.015528
nigeria0.015528
age 10-15 years0.015528
czech republic0.015528
age 1 year0.015528
food allergy0.015528
age 4-10 years0.015528
duodenum0.015528
bolivia0.015528
chuquisaca department0.015528
skin0.015528
chimpanzee0.015528
female organism0.015528
water0.015528
farm0.015528
captive0.015528
rattus0.012422
taiwan0.012422
italy0.012422
russia0.012422
tanzania0.012422
hunter gatherer0.012422
juvenile organism0.012422
age 130.012422
state of colorado0.012422
denver0.012422
homosexual0.012422
msm0.012422
heterosexual0.012422
msw0.012422
belgium0.012422
high bmi0.012422
kingdom of denmark0.012422
kebbi state0.012422
state of minnesota0.012422
como zoo0.012422
commonwealth of pennsylvania0.012422
south korea0.012422
guangzhou city prefecture0.012422
mus musculus0.012422
age0.012422
republic of congo0.012422
nouabale-ndoki national park0.012422
river0.012422
rhesus macaque0.012422
myanmar0.009317
thailand0.009317
karen0.009317
hadza0.009317
age 50-70 years0.009317
metabolic syndrome0.009317
toronto0.009317
glasgow0.009317
age < 3 years0.009317
french republic0.009317
Exp. ID User ID Description Date Region Flag Sequences
186amnondominant united states of america, research facility, caecum, sprague dawley, rattus, rat2017-08-23v4No1 / 14
400amnonhigh freq. in karen (burma) females from thailand (dominant feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 14
734amnon high in omnivore diet compared to vegetarian diet in feces homo sapiens adult taiwan republic of china 2021-01-22v3No1 / 14
276amnondominant feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 15
290amnondominant feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 17
300amnon high in sedentary low physical activity compared to exercise high physical activity in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks low capacity running strain 2018-02-27v4No1 / 17
400amnonhigh freq. in feces of european american females (dominant feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 17
730amnondominant feces, homo sapiens, control, child, kingdom of the netherlands, amsterdam2021-01-05v1No1 / 17
294amnondominant feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 18
294amnonhigh freq. in non-IBS healthy controls (dominant feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 18
339amnondominant feces, homo sapiens, adult, india2018-05-24v4No1 / 18
564amnondominant feces, homo sapiens, control, child, italy, age 2-4 years2019-11-18v3No1 / 18
574amnondominant feces, homo sapiens, adult, russia2020-01-05v3No1 / 19
190amnonlower in Hadza camp Hukamako compared to hadza camp Sengeli ( high in camp sengeli compared to camp hukamako in feces homo sapiens tanzania hunter gatherer hadza )2017-09-04v4No1 / 20
197amnondominant feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 132017-09-12v4No1 / 20
242amnonhigh freq. in native-americans (dominant feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 20
344amnonhigh freq. in feces of homosexual males (dominant feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 20
434amnondominant feces, research facility, caecum, rattus norvegicus, sprague dawley, switzerland, rat2018-12-20v4No1 / 20
629amnondominant feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 20
629amnondominant feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 20
650amnondominant feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 20
122amnondominant feces, homo sapiens, united kingdom2017-04-13v4No1 / 21
398amnonhigh freq. in feces of healthy adults from belgium (dominant feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 21
586amnondominant feces, research facility, rattus norvegicus, sprague dawley, israel, rat, control diet, male2020-02-09v4No1 / 21
607amnondominant feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 21
814amnondominant feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 21
284amnondominant feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 22
293amnondominant feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 22
467amnondominant feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 22
509amnondominant feces, homo sapiens, control, child, nigeria, kebbi state, rural community, age 10-15 years2019-03-18v4No1 / 22
625amnondominant feces, united states of america, zoological garden, state of minnesota, ateles geoffroyi, como zoo, black-handed spider monkey2020-05-16v4No1 / 22
629amnondominant feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 22
552amnondominant feces, homo sapiens, czech republic2019-09-05v3No1 / 22
10amnondominant feces, homo sapiens, toronto2016-10-27v4No1 / 23
53amnondominant feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 23
73amnondominant feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 23
132amnondominant feces, homo sapiens, united states of america2017-04-16v4No1 / 23
241amnonhigh freq. in babies age < 3 years in russia (dominant feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 23
303amnondominant feces, homo sapiens, adult, germany2018-03-12v4No1 / 23
312amnondominant feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 23
344amnonhigh freq. in feces of heterosexuals (dominant feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 23
394amnondominant feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 23
509amnondominant feces, homo sapiens, child, nigeria, kebbi state, rural community, age 10-15 years, schistosomiasis, urinary schistosomiasis2019-03-18v4No1 / 23
669amnondominant feces, homo sapiens, infant, sweden, age 1 year2020-09-26v4No1 / 23
239amnondominant feces, homo sapiens, united states of america2017-11-08v4No1 / 24
330amnondominant feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 24
395amnondominant feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 24
580amnondominant feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 24
643amnondominant feces, homo sapiens, adult, south korea2020-08-30v4No1 / 24
683amnondominant feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 24
745amnondominant feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 24
53amnondominant feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 25
290amnondominant feces, homo sapiens, city, adult, china2018-02-01v4No1 / 25
580amnondominant feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 25
721amnondominant feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 25
721amnon high in high fiber fiber diet compared to weight loss weight loss diet high protein diet in feces homo sapiens obesity adult scotland overweight body mass index status gaz:00052100 2028-05-23v4No1 / 25
796amnondominant feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 25
802amnondominant feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 26
438amnondominant feces, homo sapiens, child, jiangsu province, age 8-12, china2018-12-30v4No1 / 27
695amnondominant feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 27
319amnondominant feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 28
365amnondominant feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 28
562amnondominant feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 28
36amnonhigher in centernarians ( high in centererians compared to adult in feces homo sapiens sichuan province )2016-12-06v4No1 / 30
438amnondominant feces, homo sapiens, child, jiangsu province, age 3-6, china2018-12-30v4No1 / 30
695amnondominant feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 30
269amnondecreases during one month in refrigeration of yao meat ( high in early timepoint fresh compared to late timpoint food spoilage in foodon product type china )2018-01-09v4No1 / 34
12amnon high in control compared to chronic fatigue syndrome in feces homo sapiens new york county 2016-11-02v4No1 / 35
669amnoncommon feces, homo sapiens, infant, sweden, age 1 year2020-09-26v4No1 / 35
240amnoncommon in infants age <3 years (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 36
191amnonlower in preterm birth vaginal samples ( high in control compared to premature birth in homo sapiens united states of america female pregnancy vagina )2017-09-05v4No1 / 37
814amnonlower after 2 months of caloric restriction diet ( high in control diet compared to caloric restriction diet in feces homo sapiens female obesity adult obese body mass index status germany high bmi overweight body mass index status age 50-70 years )2021-06-30v4No1 / 37
352amnoncommon feces, homo sapiens, new delhi, india2018-07-30v4No1 / 41
36amnoncommon feces, homo sapiens, sichuan province2016-12-06v4No1 / 44
241amnoncommon in babies age < 3 years in russia (common feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 44
365amnoncommon feces, homo sapiens, child, sudan, obsolete_juvenile stage2018-08-30v4No1 / 44
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one year2018-01-14v4No1 / 46
429amnonlower in salt sensitive rates fed salt rich diet compared to control diet ( high in control diet compared to salt salt rich diet in feces research facility rattus norvegicus dahl salt-sensitive israel rat )2018-12-13v4No1 / 47
591amnoncommon feces, homo sapiens, united states of america, adult, age 50-80 years, parkinson's disease2020-02-17v4No1 / 47
406amnoncommon feces, united states of america, zoological garden, equus przewalskii, przewalski horse2018-11-21v4No1 / 50
730amnon high in control compared to crohn's disease in feces homo sapiens child kingdom of the netherlands amsterdam 2021-01-05v1No1 / 52
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
814amnoncommon feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 55
591amnoncommon feces, homo sapiens, control, united states of america, adult, age 50-80 years2020-02-17v4No1 / 56
586amnon high in control diet compared to fructose diet fructose in feces research facility rattus norvegicus sprague dawley israel rat male 2020-02-09v4No1 / 61
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
637amnoncommon feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 61
51amnon high in control compared to hiv infection in feces homo sapiens united states of america 2017-01-19v4No1 / 62
502amnoncommon feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 63
242amnoncommon in native-americans (common feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 65
365amnoncommon feces, homo sapiens, child, nigeria, obsolete_juvenile stage2018-08-30v4No1 / 66
650amnoncommon feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 66
365amnoncommon feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 67
574amnoncommon feces, homo sapiens, adult, russia2020-01-05v3No1 / 68
593amnoncommon feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
644amnoncommon feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 71
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, switzerland2020-09-22v4No1 / 71
794amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, human immunodeficiency virus infectious disease, municipality of logrono, antiretroviral therapy2021-06-08v4No1 / 75
108amnondecreases during fasting in quail caecum ( high in early timepoints compared to fasting late timepoints in united states of america research facility caecum texas coturnix coturnix common quail )2017-04-07v4No1 / 76
477amnoncommon feces, homo sapiens, nepal, himalayas, rural community, raute2019-01-29v4No1 / 76
404amnoncommon feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 79
732amnoncommon feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 79
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 80
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
339amnoncommon feces, homo sapiens, adult, india2018-05-24v4No1 / 81
643amnoncommon feces, homo sapiens, adult, south korea2020-08-30v4No1 / 81
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 82
562amnoncommon feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 82
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, china2028-04-11v3No1 / 82
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to enzyme supplementation exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 85
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
601amnoncommon feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 85
663amnoncommon feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 85
249amnoncommon feces, homo sapiens, united states of america2017-11-22v4No1 / 86
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 86
344amnoncommon in feces of homosexual males (common feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 87
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, age 202018-12-15v4No1 / 87
477amnoncommon feces, homo sapiens, raji, nepal, himalayas, rural community2019-01-29v4No1 / 88
487amnoncommon feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 88
293amnoncommon feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 89
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 89
803amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, age 50-80 years, caribbean latino2021-06-18v4No1 / 89
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
759amnoncommon feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 94
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
736amnoncommon feces, homo sapiens, female, adult, tanzania, pemba island2021-01-25v3No1 / 95
238amnoncommon feces, homo sapiens, colombia2017-11-07v4No1 / 96
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, forager, rural community, chepang2019-01-28v4No1 / 97
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 97
730amnoncommon feces, homo sapiens, control, child, kingdom of the netherlands, amsterdam2021-01-05v1No1 / 97
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
532amnoncommon feces, homo sapiens, control, adult, czech republic2019-07-21v1No1 / 98
673amnoncommon research facility, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta, caecum2020-09-28v4No1 / 99
438amnoncommon feces, homo sapiens, age 19-24, china2018-12-30v4No1 / 101
425amnon high in madagascar antananarivo compared to central african republic bangui in homo sapiens duodenum child africa 2018-12-08v4No1 / 103
477amnoncommon feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 103
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
693amnoncommon feces, homo sapiens, female, adult, austria, graz city district2028-03-16v1No1 / 104
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china2018-12-30v4No1 / 106
797amnon high in age 1 year compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
695amnon high in milk allergy compared to sesame allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 107
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 60-79, china2018-12-30v4No1 / 111
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
269amnoncommon in fresh yao meat food (common foodon product type, china)2018-01-09v4No1 / 113
517amnoncommon feces, homo sapiens, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 113
567amnon high in control compared to sinusitis chronic rhinosinusitis in homo sapiens nasopharynx adult belgium 2019-12-05v4No1 / 114
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 30-50, china2018-12-30v4No1 / 115
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in feces homo sapiens adult taipei city taiwan )2019-07-18v3No1 / 115
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
212amnoncommon feces, control, united states of america, research facility, mus musculus, lean body mass, mouse2017-10-22v4No1 / 120
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china2018-12-30v4No1 / 121
517amnoncommon homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 121
660amnoncommon feces, homo sapiens, ecuador, rural community, village, shuar population2020-09-20v4No1 / 123
449amnoncommon feces, homo sapiens, colombia2019-01-09v4No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in feces homo sapiens toronto )2016-10-27v4No1 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to child obsolete_juvenile stage crohn's disease in feces homo sapiens glasgow )2017-02-26v4No1 / 125
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 125
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 126
779amnon high in control compared to crohn's disease in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 127
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, age 30-402018-05-13v4No1 / 130
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
39amnoncommon in obese lepr-db mice (common feces, research facility, mus musculus, obesity)2016-12-09v4No1 / 132
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 132017-09-12v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 136
212amnoncommon feces, united states of america, research facility, mus musculus, obese body mass index status, mouse, db/db mouse, obesity2017-10-22v4No1 / 137
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens juvenile organism obsolete_juvenile stage age 13 2017-09-12v4No1 / 138
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 141
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
509amnoncommon feces, homo sapiens, child, nigeria, kebbi state, rural community, age 10-15 years, schistosomiasis, urinary schistosomiasis2019-03-18v4No1 / 146
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
509amnoncommon feces, homo sapiens, control, child, nigeria, kebbi state, rural community, age 10-15 years2019-03-18v4No1 / 147
300amnoncommon united states of america, female, research facility, caecum, rattus norvegicus, rat, ovariectomy, age 38 weeks2018-02-27v4No1 / 150
411amnon high in wild papio kindae papio ursinus compared to zoological garden papio anubis in feces papio zambia monkey baboon 2018-11-23v4No1 / 151
594amnoncommon feces, homo sapiens, city, adult, cameroon, yaounde2020-03-12v4No1 / 154
673amnoncommon control, research facility, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, province of alberta, caecum2020-09-28v4No1 / 154
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, bile, gallbladder, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
190amnoncommon feces, homo sapiens, tanzania, hunter gatherer, hadza2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, age 13, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in feces homo sapiens infant )2017-11-13v4No1 / 173
625amnoncommon feces, united states of america, zoological garden, state of minnesota, pithecia pithecia, white-faced saki, como zoo2020-05-16v4No1 / 179
399amnon high in control compared to ulcerative colitis in feces homo sapiens united states of america 2018-11-16v4No1 / 180
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
88amnondifferent between herds in cape buffalo feces ( high in herd lower sabie herd compared to croc bridge herd in feces south africa syncerus caffer caffer cape buffalo )2017-03-08v4No1 / 194
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
620amnoncommon feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 197
411amnoncommon feces, zambia, monkey, wild, papio kindae, kinda baboon2018-11-23v4No1 / 200
603amnonlower in inital batches of baijiu fermentation pit mud ( high in days 180-270 compared to days 0-90 in mud fermentation pit mud china hefei city prefecture baijiu )2020-04-05v3No1 / 205
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
669amnon high in age 1 year compared to age 2 months in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v3No1 / 214
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
666amnoncommon feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 223
411amnoncommon feces, zambia, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
673amnon high in ascending colon caecum compared to ileum in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v4No1 / 228
434amnonlower in antibiotics treated rats compared to controls ( high in control compared to antibiotic ampicillin neomycin in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 238
434amnoncommon feces, research facility, caecum, rattus norvegicus, sprague dawley, switzerland, rat2018-12-20v4No1 / 238
620amnoncommon feces, wild, chimpanzee, pan troglodytes troglodytes, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, age 50-60 years, nephrolithiasis, china)2018-01-27v4No1 / 239
406amnoncommon feces, zoological garden, gorilla gorilla, french republic, monkey, gorilla2018-11-21v4No1 / 239
688amnon high in female female organism compared to male male organism in feces research facility sus scrofa nanchang city prefecture pig china duroc pig age 140 days 2028-03-09v4No1 / 239
586amnoncommon feces, research facility, rattus norvegicus, sprague dawley, israel, rat, control diet, male2020-02-09v4No1 / 241
666amnoncommon feces, italy, tapirus terrestris, south american tapir2020-09-25v3No1 / 242
483amnoncommon united states of america, research facility, hawaii, pearl harbor, hydroides elegans, tubeworm, shelled egg2019-02-13v4No1 / 243
161amnoncommon in barn swallows in colorado (common feces, united states of america, hirundo rustica, colorado, barn swallow)2017-07-12v4No1 / 245
398amnon high in control compared to crohn's disease in feces homo sapiens belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in feces homo sapiens infant india )2016-12-19v4No1 / 253
625amnoncommon feces, united states of america, zoological garden, state of minnesota, ateles geoffroyi, como zoo, black-handed spider monkey2020-05-16v4No1 / 256
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 263
759amnon high in state of alabama wild wild boar compared to farm pig state of vermont in feces united states of america sus scrofa 2021-04-04v4No1 / 268
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, china, spring)2017-07-12v4No1 / 278
688amnoncommon feces, research facility, sus scrofa, nanchang city prefecture, pig, china, duroc pig, age 140 days2028-03-09v4No1 / 278
438amnon high in child age 3-6 age 8-12 compared to adult age 30-50 age 60-79 in feces homo sapiens china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, age 50-60 years, china)2018-01-27v4No1 / 281
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 288
419amnoncommon in rats with induced constipation (common feces, research facility, rattus norvegicus, sprague dawley, rat, constipation, china)2018-12-02v4No1 / 300
723amnon high in age 2-4 years compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
358amnoncommon feces, research facility, rattus, czech republic, rat, wistar rat2018-08-19v4No1 / 309
190amnon high in dry season compared to wet season in feces homo sapiens tanzania hunter gatherer hadza 2017-09-04v4No1 / 311
816amnon high in late pregnancy compared to early pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism 2021-07-04v4No1 / 312
510amnoncommon estuary, water, fresh water, kingdom of spain, estuary water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
399amnoncommon feces, united states of america, state of tennessee, zoological garden, sus scrofa, pig2018-11-16v4No1 / 319
429amnoncommon feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, control diet2018-12-13v4No1 / 327
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in myanmar karen compared to hmong china in feces homo sapiens thailand rural community )2018-11-18v4No1 / 329
532amnon high in control compared to short bowel syndrome in feces homo sapiens adult czech republic 2019-07-21v1No1 / 334
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
620amnon high in wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park compared to united states of america zoological garden pan troglodytes in feces chimpanzee 2020-05-06v4No1 / 351
254amnonhigher in river when close to populated region compared to downstream ( high in populated place city upstream compared to downstream in river water fresh water fujian province depth 0.5m jiulong river china )2017-11-23v4No1 / 356
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chicago, chimpanzee, lincoln park zoo2020-05-06v4No1 / 358
565amnoncommon zoological garden, skin, captive, canada, african lion safari, macropus rufus, red kangaroo2019-11-21v3No1 / 360
759amnoncommon feces, united states of america, sus scrofa, state of alabama, wild, wild boar2021-04-04v4No1 / 362
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
816amnonhigher in sows in first pregnancy compared to later pregnancies ( high in first pregnancy compared to multiple pregnancies in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 374
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
442amnoncommon feces, research facility, rattus norvegicus, sprague dawley, male, rat, china2019-01-06v4No1 / 378
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
620amnoncommon feces, united states of america, zoological garden, gorilla gorilla, chicago, lincoln park zoo2020-05-06v4No1 / 384
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
770amnoncommon feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 396
314amnoncommon farm, caecum, sus scrofa, tibet autonomous region, pig, cecal content, china2018-04-10v4No1 / 402
399amnoncommon feces, united states of america, state of tennessee, zoological garden, macaca mulatta, macaque2018-11-16v4No1 / 404
186amnoncommon united states of america, research facility, caecum, sprague dawley, rattus, rat2017-08-23v4No1 / 407
399amnoncommon feces, united states of america, state of tennessee, zoological garden, pan troglodytes, chimpanzee2018-11-16v4No1 / 407
625amnoncommon feces, united states of america, zoological garden, state of minnesota, pongo abelii, sumatran orangutan, como zoo2020-05-16v4No1 / 414
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
75amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 442
424amnoncommon feces, farm, sus scrofa, jinhua city prefecture, pig, jinhua pig, china2018-12-06v4No1 / 452
339amnon high in adult compared to infant age < 1 year in feces homo sapiens india 2018-05-24v4No1 / 457
470amnoncommon feces, female, pregnancy, farm, adult, sus scrofa, canada, province of quebec, pig2019-01-14v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
620amnon high in chimpanzee pan troglodytes troglodytes compared to gorilla gorilla in feces wild republic of congo nouabale-ndoki national park 2020-05-06v4No1 / 478
274amnoncommon feces, ethiopia, monkey, chlorocebus djamdjamensis, bale monkey2018-01-16v4No1 / 489
256amnoncommon caecum, left colon, right colon, sus scrofa, pig, united kingdom2017-11-26v4No1 / 490
214amnon high in diet mouse chow nih 31m chow compared to high fat diet in feces united states of america research facility mus musculus mouse 2017-10-23v4No1 / 495
748amnoncommon feces, united states of america, research facility, bos taurus, cow, female organism, state of mississippi, jersey cow2021-03-10v4No1 / 516
671amnon high in state of oregon compared to state of california in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 534
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in feces homo sapiens child africa 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, china, spring)2017-07-12v4No1 / 573
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592
781amnon high in damaliscus lunatus tsessebe compared to aepyceros melampus impala in feces kenya wild masai mara national park 2021-04-28v4No1 / 599
517amnon high in feces compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 606
603amnoncommon in baijiu fermentation pit mud in later batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 180-270)2020-04-05v3No1 / 608
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned corn and soybean diet age 4-7 weeks compared to suckling preweaned age 2-4 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 681
671amnon high in age 3 months compared to age 1 month in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 714
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
358amnonlower in dnbs induced colitis compared to controls in rat feces ( high in control compared to dnbs induced colitis colitis in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 754
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
671amnon high in female adult compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 947
671amnon high in age 8 months compared to age 3 months age 6 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 955
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
83amnon high in control diet normal diet compared to restricted diet in rumen bos taurus ireland holstein-friesian bull 2017-03-05v4No1 / 1023
252amnoncommon in river sand biofilm (common river, biofilm, sand, kingdom of spain)2017-11-22v4No1 / 1181
819amnon high in skin of cheek compared to scalp in homo sapiens female skin adult china age 25-45 years 2021-07-12v1No1 / 1684
748amnon high in feces compared to rumen ruminal fluid in united states of america research facility bos taurus cow female organism state of mississippi 2021-03-10v4No1 / 2467

Problems / suggestions? Please email info AT dbbact DOT org