Search result for sequence:
TACGTAGGGAGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGCTTTGCAAGTCAGATGTGAAATCTATGGGCTCAACCCATAAACTGCATTTGAAACTGTAGAGCTTGAGTGAAGTAGAGGCAGGCGGAATTTCCCG
common ontology terms
term enrichment score
TermScore
stroke0.333333
herd0.333333
lower sabie herd0.333333
LOWER IN croc bridge herd0.333333
guangzhou city prefecture0.285714
syncerus caffer caffer0.285714
cape buffalo0.285714
south africa0.181818
obesity0.125000
high bmi0.117647
italy0.090909
feces0.020134
homo sapiens0.015645
china0.013072
adult0.012500
control0.011561
Fraction of dbbact annotations with this term covered by the query
TermScore
stroke0.500000
herd0.500000
lower sabie herd0.500000
LOWER IN croc bridge herd0.500000
syncerus caffer caffer0.333333
cape buffalo0.333333
guangzhou city prefecture0.200000
south africa0.142857
obesity0.083333
high bmi0.076923
italy0.055556
feces0.010169
homo sapiens0.007905
china0.006623
adult0.006329
control0.005917
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens0.750000
adult0.500000
guangzhou city prefecture0.500000
china0.500000
stroke0.250000
control0.250000
italy0.250000
high bmi0.250000
obesity0.250000
herd0.250000
lower sabie herd0.250000
LOWER IN croc bridge herd0.250000
south africa0.250000
syncerus caffer caffer0.250000
cape buffalo0.250000

Problems / suggestions? Please email info AT dbbact DOT org