Search result for sequence:
TACGTAGGGAGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGCTTTGCAAGTCAGATGTGAAATCTATGGGCTCAACCCATAAACTGCATTTGAAACTGTAGAGCTTGAGTGAAGTAGAGGCAGGCGGGATTCCCCG
common ontology terms
term enrichment score
TermScore
guangzhou city prefecture0.200000
stroke0.166667
herd0.166667
lower sabie herd0.166667
LOWER IN croc bridge herd0.166667
belgium0.153846
syncerus caffer caffer0.153846
cape buffalo0.153846
LOWER IN age <1 year0.153846
age > 1 year0.142857
south africa0.117647
finland0.117647
LOWER IN hiv infection0.105263
LOWER IN crohn's disease0.095238
high fat diet0.090909
obesity0.090909
high bmi0.086957
italy0.071429
age0.064516
LOWER IN female0.060606
diet0.058824
infant0.058824
feces0.052805
homo sapiens0.046065
male0.040000
control0.033994
mouse0.030769
mus musculus0.027778
adult0.024291
united states of america0.024096
research facility0.013245
china0.012821
Fraction of dbbact annotations with this term covered by the query
TermScore
stroke0.500000
herd0.500000
lower sabie herd0.500000
LOWER IN croc bridge herd0.500000
syncerus caffer caffer0.333333
cape buffalo0.333333
LOWER IN age <1 year0.333333
age > 1 year0.250000
guangzhou city prefecture0.200000
south africa0.142857
finland0.142857
belgium0.125000
LOWER IN hiv infection0.111111
LOWER IN crohn's disease0.090909
high fat diet0.083333
obesity0.083333
high bmi0.076923
italy0.055556
age0.047619
LOWER IN female0.043478
diet0.041667
infant0.041667
feces0.027119
male0.025000
homo sapiens0.023715
mouse0.018182
control0.017751
mus musculus0.016129
adult0.012658
united states of america0.012552
research facility0.007092
china0.006623
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens0.800000
control0.400000
united states of america0.300000
adult0.300000
guangzhou city prefecture0.200000
china0.200000
belgium0.200000
male0.100000
LOWER IN female0.100000
research facility0.100000
mus musculus0.100000
diet0.100000
high fat diet0.100000
mouse0.100000
stroke0.100000
LOWER IN hiv infection0.100000
italy0.100000
high bmi0.100000
obesity0.100000
herd0.100000
lower sabie herd0.100000
LOWER IN croc bridge herd0.100000
south africa0.100000
syncerus caffer caffer0.100000
cape buffalo0.100000
LOWER IN crohn's disease0.100000
age0.100000
age > 1 year0.100000
LOWER IN age <1 year0.100000
infant0.100000
finland0.100000

Problems / suggestions? Please email info AT dbbact DOT org