Search result for sequence:
TACGTAGGGAGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGCTTTGCAAGTCAGATGTGAAATCTATGGGCTCAACCCATAAACTGCATTTGAAACTGTAGAGCTTGAGTGAAGTAGAGGCAGGCGGGATTTCCCG
common ontology terms
term enrichment score
TermScore
stroke0.285714
herd0.285714
lower sabie herd0.285714
LOWER IN croc bridge herd0.285714
guangzhou city prefecture0.266667
syncerus caffer caffer0.250000
cape buffalo0.250000
LOWER IN age <1 year0.250000
age > 1 year0.222222
south africa0.166667
finland0.166667
obesity0.117647
high bmi0.111111
italy0.086957
age0.076923
infant0.068966
feces0.026756
homo sapiens0.023369
china0.013029
adult0.012461
control0.011494
Fraction of dbbact annotations with this term covered by the query
TermScore
stroke0.500000
herd0.500000
lower sabie herd0.500000
LOWER IN croc bridge herd0.500000
syncerus caffer caffer0.333333
cape buffalo0.333333
LOWER IN age <1 year0.333333
age > 1 year0.250000
guangzhou city prefecture0.200000
south africa0.142857
finland0.142857
obesity0.083333
high bmi0.076923
italy0.055556
age0.047619
infant0.041667
feces0.013559
homo sapiens0.011858
china0.006623
adult0.006329
control0.005917
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens0.800000
adult0.400000
guangzhou city prefecture0.400000
china0.400000
stroke0.200000
control0.200000
italy0.200000
high bmi0.200000
obesity0.200000
herd0.200000
lower sabie herd0.200000
LOWER IN croc bridge herd0.200000
south africa0.200000
syncerus caffer caffer0.200000
cape buffalo0.200000
age0.200000
age > 1 year0.200000
LOWER IN age <1 year0.200000
infant0.200000
finland0.200000

Problems / suggestions? Please email info AT dbbact DOT org