Search result for sequence:
TACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGATCGCAAGTCAGATGTGAAAACTATGGGCTTAACCCATAAACTGCATTTGAAACTGTGGTTCTTGAGTGAAGTAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.551658
feces0.504456
adult0.444297
united states of america0.190952
control0.170505
child0.166774
china0.121356
female0.116479
city0.101919
kingdom of spain0.098802
obesity0.095238
rural community0.079208
germany0.075710
obsolete_juvenile stage0.068796
infant0.065421
high bmi0.064715
LOWER IN crohn's disease0.060241
jiangsu province0.052632
india0.051020
macaca mulatta0.049751
duodenum0.048940
age0.047114
state of california0.044248
state of oklahoma0.041667
overweight body mass index status0.041667
age 5-13 years0.041667
LOWER IN ulcerative colitis0.041237
rhesus macaque0.041237
LOWER IN infant0.041026
heterosexual0.040816
msw0.040816
estonia0.040404
small intestine0.040404
kingdom of denmark0.040000
state of new york0.039604
pregnancy0.039604
sus scrofa0.039604
pig0.039604
south korea0.037736
sweden0.037736
israel0.036697
monkey0.035398
male0.034965
small village0.031579
captive0.031496
taiwan0.031250
obese body mass index status0.031250
nanning city prefecture0.031250
age 50-60 years0.031250
africa0.031250
chuquisaca department0.031250
jejunum0.031008
biopsy0.030534
kingdom of norway0.030303
bolivia0.030303
ketogenic diet0.029851
zoological garden0.029851
italy0.029412
hiv infection0.027778
research facility0.027184
water0.024896
age 2-4 years0.021164
central african republic0.021164
municipality of logrono0.021053
age 200.021053
gaz:000521000.021053
cornell university0.021053
age 50-70 years0.021053
caribbean latino0.021053
himalayas0.021053
taipei city0.021053
age 4-10 years0.021053
LOWER IN gay0.021053
age 60-790.021053
new delhi0.021053
oslo0.021053
age 30-400.021053
age 130.021053
jinzhou city prefecture0.021053
rectal swab0.020942
LOWER IN homosexual0.020942
LOWER IN msm0.020942
metabolic syndrome0.020833
osteoarthritis0.020833
asian0.020833
nepal0.020833
food allergy0.020833
nanchang city prefecture0.020833
poland0.020833
formula fed0.020833
age 30-500.020833
homosexual0.020833
msm0.020833
LOWER IN rural community0.020833
LOWER IN age < 1 year0.020833
czech republic0.020725
finland0.020725
state of arizona0.020619
scotland0.020619
amsterdam0.020619
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
state of oklahoma0.666667
overweight body mass index status0.666667
age 2-4 years0.666667
age 5-13 years0.666667
central african republic0.666667
LOWER IN active disease0.500000
municipality of logrono0.500000
age 200.500000
taiwan0.500000
taoyuan city0.500000
cheyenne0.500000
native american0.500000
arapaho0.500000
LOWER IN american0.500000
gaz:000521000.500000
cornell university0.500000
LOWER IN ulcerative colitis0.500000
LOWER IN chronic fatigue syndrome0.500000
new york county0.500000
LOWER IN premature birth0.500000
obese body mass index status0.500000
age 50-70 years0.500000
salmonella gastroenteritis0.500000
santa catarina state0.500000
caribbean latino0.500000
LOWER IN insomnia0.500000
himalayas0.500000
rural community0.500000
tharu0.500000
agrarian0.500000
age 17-290.500000
common bottlenose dolphin0.500000
taipei city0.500000
municipality of reus0.500000
age 4-10 years0.500000
sesame allergy0.500000
quito0.500000
LOWER IN nephrolithiasis0.500000
nanning city prefecture0.500000
age 50-60 years0.500000
africa0.500000
age 2-5 years0.500000
LOWER IN egypt0.500000
raji0.500000
milk allergy0.500000
hmong0.500000
azerbaijan0.500000
third trimester0.500000
age 8-120.500000
LOWER IN age 7 months0.500000
age one month0.500000
LOWER IN age one week0.500000
LOWER IN gay0.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
mild0.500000
LOWER IN severe0.500000
age 60-790.500000
irritable bowel syndrome0.500000
new delhi0.500000
india0.500000
age >940.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
rem sleep behavior disorder0.500000
age 130.500000
LOWER IN cuba0.500000
glasgow0.500000
jinzhou city prefecture0.500000
yaounde0.500000
el salvador0.500000
age<17 years0.500000
LOWER IN peru0.500000
LOWER IN tunapuco0.500000
hadza0.500000
low anterior resection0.500000
spondyloarthritis0.500000
spondylitis0.500000
republic of congo0.500000
nouabale-ndoki national park0.500000
LOWER IN age &gt;940.500000
gastric carcinoma0.500000
stomach neoplasm0.500000
atherosclerosis0.500000
ascending colon0.500000
province of alberta0.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
ateles geoffroyi0.500000
como zoo0.500000
black-handed spider monkey0.500000
bangladesh0.500000
tunapuco0.500000
LOWER IN acute pancreatitis0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.908602
homo sapiens0.892473
adult0.548387
united states of america0.290323
control0.182796
china0.155914
child0.107527
female0.086022
city0.059140
kingdom of spain0.059140
obesity0.053763
germany0.048387
rural community0.043011
high bmi0.037634
obsolete_juvenile stage0.037634
infant0.037634
research facility0.037634
LOWER IN crohn&#39;s disease0.032258
jiangsu province0.032258
state of california0.026882
male0.026882
age0.026882
duodenum0.026882
india0.026882
macaca mulatta0.026882
state of oklahoma0.021505
estonia0.021505
kingdom of denmark0.021505
south korea0.021505
overweight body mass index status0.021505
state of new york0.021505
LOWER IN ulcerative colitis0.021505
pregnancy0.021505
sweden0.021505
heterosexual0.021505
msw0.021505
israel0.021505
age 5-13 years0.021505
small intestine0.021505
LOWER IN infant0.021505
sus scrofa0.021505
pig0.021505
monkey0.021505
captive0.021505
rhesus macaque0.021505
ketogenic diet0.016129
taiwan0.016129
obese body mass index status0.016129
italy0.016129
hiv infection0.016129
nanning city prefecture0.016129
age 50-60 years0.016129
africa0.016129
biopsy0.016129
kingdom of norway0.016129
jejunum0.016129
small village0.016129
zoological garden0.016129
water0.016129
bolivia0.016129
chuquisaca department0.016129
municipality of logrono0.010753
state of arizona0.010753
age 200.010753
metabolic syndrome0.010753
osteoarthritis0.010753
scotland0.010753
gaz:000521000.010753
cornell university0.010753
age 50-70 years0.010753
commonwealth of virginia0.010753
age 2-4 years0.010753
ulcerative colitis0.010753
australia0.010753
asian0.010753
brazil0.010753
commonwealth of massachusetts0.010753
age 50-80 years0.010753
caribbean latino0.010753
czech republic0.010753
switzerland0.010753
nepal0.010753
himalayas0.010753
commonwealth of pennsylvania0.010753
state of michigan0.010753
rectal swab0.010753
taipei city0.010753
food allergy0.010753
age 4-10 years0.010753
low bmi0.010753
central african republic0.010753
kingdom of the netherlands0.010753
amsterdam0.010753
nanchang city prefecture0.010753
thailand0.010753
biopsy site0.010753
poland0.010753
age 1 year0.010753
formula fed0.010753
LOWER IN gay0.010753
Exp. ID User ID Description Date Region Flag Sequences
713amnon high in remission compared to active disease in feces homo sapiens crohn's disease 2028-05-21v3No1 / 13
276amnondominant feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 15
794amnondominant feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 16
430amnondominant feces, homo sapiens, united states of america, city, adult, state of arizona, age 202018-12-15v4No1 / 18
799amnondominant in obese participant fecal samples after 1 month ketogenic diet (dominant feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 18
796amnondominant feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 19
467amnondominant feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 22
593amnondominant feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 22
242amnonhigher in native-americans compared to non native-american ( high in cheyenne native american arapaho compared to american in feces homo sapiens united states of america state of oklahoma )2017-11-14v4No1 / 23
303amnondominant feces, homo sapiens, adult, germany2018-03-12v4No1 / 23
683amnondominant feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 24
721amnondominant feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 25
802amnondominant feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 26
779amnon high in control compared to ulcerative colitis in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 28
12amnon high in control compared to chronic fatigue syndrome in feces homo sapiens new york county 2016-11-02v4No1 / 35
191amnonlower in preterm birth vaginal samples ( high in control compared to premature birth in homo sapiens united states of america female pregnancy vagina )2017-09-05v4No1 / 37
814amnonlower after 2 months of caloric restriction diet ( high in control diet compared to caloric restriction diet in feces homo sapiens female obesity adult obese body mass index status germany high bmi overweight body mass index status age 50-70 years )2021-06-30v4No1 / 37
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v4No1 / 39
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, age 2-4 years2019-11-18v3No1 / 42
399amnon high in ulcerative colitis compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 47
651amnon high in control compared to parkinson's disease in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 52
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
131amnon high in female compared to male in feces homo sapiens south korea 2017-04-16v4No1 / 55
390amnoncommon feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 55
814amnoncommon feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 55
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
650amnoncommon feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 66
757amnoncommon feces, homo sapiens, adult, brazil, santa catarina state2021-03-28v3No1 / 67
574amnoncommon feces, homo sapiens, adult, russia2020-01-05v3No1 / 68
593amnoncommon feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
22amnon high in control compared to hiv infection in feces homo sapiens united states of america 2016-11-28v4No1 / 70
803amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, age 50-80 years, type 2 diabetes mellitus, caribbean latino2021-06-18v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
566amnon high in control compared to insomnia in feces homo sapiens adult china 2019-11-24v4No1 / 71
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, switzerland2020-09-22v4No1 / 71
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
395amnoncommon feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 75
74amnoncommon feces, homo sapiens, united states of america2017-02-27v4No1 / 76
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, age 17-292019-02-13v4No1 / 76
666amnoncommon feces, tursiops truncatus, italy, rectal swab, common bottlenose dolphin2020-09-25v3No1 / 76
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 77
799amnonlower before ketogenic diet compared to after ketogenic diet in obese participants ( high in ketogenic diet compared to control diet in feces homo sapiens obesity adult estonia high bmi )2021-06-13v3No1 / 77
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
529amnoncommon feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 79
732amnoncommon feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 79
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 80
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
368amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 82
562amnoncommon feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 82
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in feces homo sapiens adult nanning city prefecture age 50-60 years china )2018-01-27v4No1 / 83
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
663amnoncommon feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 85
804amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens child africa central african republic madagascar age 2-5 years 2021-06-18v4No1 / 85
249amnoncommon feces, homo sapiens, united states of america2017-11-22v4No1 / 86
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, age 202018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
477amnoncommon feces, homo sapiens, raji, nepal, himalayas, rural community2019-01-29v4No1 / 88
293amnoncommon feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 89
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 89
803amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, age 50-80 years, caribbean latino2021-06-18v4No1 / 89
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 95
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 97
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
438amnoncommon feces, homo sapiens, age 19-24, china2018-12-30v4No1 / 101
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
693amnoncommon feces, homo sapiens, female, adult, austria, graz city district2028-03-16v1No1 / 104
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china2018-12-30v4No1 / 106
797amnon high in age 1 year compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
273amnon high in age age one month compared to age one week in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
409amnoncommon feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 108
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china2018-12-30v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in feces homo sapiens united states of america child )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 60-79, china2018-12-30v4No1 / 111
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 30-50, china2018-12-30v4No1 / 115
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china2018-12-30v4No1 / 121
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 125
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, age 30-402018-05-13v4No1 / 130
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
578amnon high in kingdom of spain compared to sweden in feces homo sapiens hiv infection adult gay homosexual msm male 2020-01-14v3No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 132017-09-12v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 136
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
797amnon high in child age 2 years compared to infant age 1 year in feces homo sapiens germany formula fed 2021-06-13v3No1 / 139
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 141
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
780amnon high in small intestine duodenum jejunum compared to caecum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 153
594amnoncommon feces, homo sapiens, city, adult, cameroon, yaounde2020-03-12v4No1 / 154
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens adult china 2018-02-05v4No1 / 161
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
190amnoncommon feces, homo sapiens, tanzania, hunter gatherer, hadza2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, age 13, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in feces homo sapiens infant )2017-11-13v4No1 / 173
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
620amnoncommon feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 197
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in feces homo sapiens china )2018-12-30v4No1 / 203
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
669amnon high in age 1 year compared to age 2 months in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v3No1 / 214
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 220
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
673amnon high in ascending colon caecum compared to ileum in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v4No1 / 228
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, age 50-60 years, nephrolithiasis, china)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in feces homo sapiens belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in feces homo sapiens infant india )2016-12-19v4No1 / 253
625amnoncommon feces, united states of america, zoological garden, state of minnesota, ateles geoffroyi, como zoo, black-handed spider monkey2020-05-16v4No1 / 256
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, age 50-60 years, china)2018-01-27v4No1 / 281
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
723amnon high in age 2-4 years compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
399amnoncommon feces, united states of america, state of tennessee, zoological garden, sus scrofa, pig2018-11-16v4No1 / 319
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in feces homo sapiens adult czech republic 2019-07-21v1No1 / 334
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
254amnonhigher in river when close to populated region compared to downstream ( high in populated place city upstream compared to downstream in river water fresh water fujian province depth 0.5m jiulong river china )2017-11-23v4No1 / 356
671amnoncommon feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 356
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
770amnoncommon feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 396
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
339amnon high in adult compared to infant age < 1 year in feces homo sapiens india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in feces homo sapiens child africa 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 606
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned corn and soybean diet age 4-7 weeks compared to suckling preweaned age 2-4 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 681
671amnon high in age 3 months compared to age 1 month in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 714
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
671amnon high in female adult compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 947
671amnon high in age 8 months compared to age 3 months age 6 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 955
620amnon high in united states of america zoological garden pan troglodytes compared to wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park in feces chimpanzee 2020-05-06v4No1 / 964
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org