Search result for sequence:
TACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGGATGGCAAGTCAGATGTGAAATACCGGGGCTTAACTCCGGGGCTGCATTTGAAACTGTCGTTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
LOWER IN crohn's disease0.190476
homo sapiens0.178140
feces0.154953
LOWER IN rural community0.108108
adult0.107422
LOWER IN ulcerative colitis0.102564
low bmi0.100000
united states of america0.098415
LOWER IN high bmi0.097561
united kingdom0.093023
caecum0.090909
state of new york0.085106
LOWER IN male0.076923
age0.076923
colon0.076923
germany0.074074
infant0.072727
female0.065217
control0.061359
child0.060606
LOWER IN graves' disease0.060606
taoyuan city0.060606
LOWER IN active disease0.060606
chronic fatigue syndrome0.060606
new york county0.060606
low fiber0.060606
age<17 years0.060606
LOWER IN hmong0.060606
LOWER IN hmong 2nd generation0.060606
high sugar diet0.060606
age 18 weeks0.060606
LOWER IN age 6 weeks0.060606
janvier labs0.060606
rem sleep behavior disorder0.060606
age 30-400.060606
oslo0.060606
LOWER IN plant diet0.060606
age 3-60.060606
age 8-120.060606
LOWER IN age 30-500.060606
LOWER IN age 60-790.060606
LOWER IN nepal0.060606
LOWER IN himalayas0.060606
children0.060606
pikas0.060606
republic of china0.058824
remission0.058824
LOWER IN plant fiber cell0.058824
atlanta0.058824
hispanic or latin american0.058824
animal product diet0.058824
LOWER IN neomycin0.058824
LOWER IN thailand0.058824
sigmoid colon0.058824
age 30 days0.058824
LOWER IN age 1 week0.058824
european0.058824
LOWER IN asian0.058824
LOWER IN age &lt;1 year0.058824
ochotonidae0.058824
taiwan0.057143
age 1-3 years0.057143
state of texas0.057143
LOWER IN gay0.057143
LOWER IN vancomycin0.057143
terminal ileum0.057143
caucasian0.057143
age > 1 year0.057143
LOWER IN high fiber0.055556
LOWER IN body mass index0.055556
heterosexual0.055556
msw0.055556
LOWER IN homosexual0.055556
LOWER IN msm0.055556
colombia0.054054
LOWER IN age &lt; 1 year0.054054
LOWER IN small intestine0.054054
LOWER IN metronidazole0.052632
biopsy0.052632
finland0.052632
LOWER IN age 1 year0.051282
kingdom of norway0.051282
belgium0.051282
state of michigan0.050000
LOWER IN infant0.050000
LOWER IN stomach0.050000
obsolete_juvenile stage0.048780
c57bl/6j0.048780
hiv infection0.048780
rectum0.048780
crohn's disease0.046512
sweden0.045455
LOWER IN antibiotic0.045455
LOWER IN mouse chow0.044444
gallus gallus0.042553
chicken0.042553
city0.040000
kingdom of spain0.039216
LOWER IN adult0.037037
diet0.036364
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN graves&#39; disease0.500000
taoyuan city0.500000
LOWER IN active disease0.500000
chronic fatigue syndrome0.500000
new york county0.500000
low fiber0.500000
age<17 years0.500000
LOWER IN hmong0.500000
LOWER IN hmong 2nd generation0.500000
high sugar diet0.500000
age 18 weeks0.500000
LOWER IN age 6 weeks0.500000
janvier labs0.500000
rem sleep behavior disorder0.500000
age 30-400.500000
oslo0.500000
LOWER IN plant diet0.500000
age 3-60.500000
age 8-120.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
children0.500000
pikas0.500000
LOWER IN crohn&#39;s disease0.363636
republic of china0.333333
remission0.333333
LOWER IN plant fiber cell0.333333
atlanta0.333333
hispanic or latin american0.333333
animal product diet0.333333
LOWER IN rural community0.333333
LOWER IN neomycin0.333333
LOWER IN thailand0.333333
sigmoid colon0.333333
age 30 days0.333333
LOWER IN age 1 week0.333333
european0.333333
LOWER IN asian0.333333
LOWER IN age &lt;1 year0.333333
ochotonidae0.333333
taiwan0.250000
LOWER IN ulcerative colitis0.250000
age 1-3 years0.250000
state of texas0.250000
LOWER IN gay0.250000
LOWER IN vancomycin0.250000
terminal ileum0.250000
caucasian0.250000
age > 1 year0.250000
low bmi0.222222
LOWER IN high fiber0.200000
LOWER IN body mass index0.200000
LOWER IN high bmi0.200000
heterosexual0.200000
msw0.200000
LOWER IN homosexual0.200000
LOWER IN msm0.200000
colombia0.166667
united kingdom0.166667
LOWER IN age &lt; 1 year0.166667
LOWER IN small intestine0.166667
LOWER IN metronidazole0.142857
biopsy0.142857
finland0.142857
state of new york0.125000
LOWER IN age 1 year0.125000
kingdom of norway0.125000
belgium0.125000
state of michigan0.111111
LOWER IN infant0.111111
LOWER IN stomach0.111111
obsolete_juvenile stage0.100000
c57bl/6j0.100000
hiv infection0.100000
rectum0.100000
homo sapiens0.098814
LOWER IN male0.095238
age0.095238
colon0.095238
germany0.086957
caecum0.085714
feces0.084746
crohn's disease0.083333
infant0.083333
sweden0.076923
LOWER IN antibiotic0.076923
LOWER IN mouse chow0.071429
adult0.063291
gallus gallus0.062500
chicken0.062500
child0.057143
united states of america0.054393
city0.052632
kingdom of spain0.050000
female0.049180
LOWER IN adult0.043478
diet0.041667
state of california0.041667
Fraction of annotations for the query sequences containing the term
TermScore
feces0.903226
homo sapiens0.903226
united states of america0.516129
adult0.354839
control0.225806
LOWER IN crohn&#39;s disease0.129032
female0.096774
caecum0.096774
LOWER IN ulcerative colitis0.064516
child0.064516
low bmi0.064516
LOWER IN high bmi0.064516
LOWER IN male0.064516
state of new york0.064516
germany0.064516
united kingdom0.064516
age0.064516
infant0.064516
china0.064516
LOWER IN rural community0.064516
colon0.064516
LOWER IN graves&#39; disease0.032258
taiwan0.032258
republic of china0.032258
taoyuan city0.032258
remission0.032258
LOWER IN active disease0.032258
crohn's disease0.032258
chronic fatigue syndrome0.032258
LOWER IN control0.032258
new york county0.032258
low fiber0.032258
LOWER IN high fiber0.032258
LOWER IN plant fiber cell0.032258
city0.032258
colombia0.032258
atlanta0.032258
obsolete_juvenile stage0.032258
age<17 years0.032258
LOWER IN body mass index0.032258
hispanic or latin american0.032258
LOWER IN hmong0.032258
LOWER IN hmong 2nd generation0.032258
high sugar diet0.032258
age 18 weeks0.032258
LOWER IN mouse chow0.032258
LOWER IN age 6 weeks0.032258
research facility0.032258
mus musculus0.032258
c57bl/6j0.032258
mouse0.032258
janvier labs0.032258
state of michigan0.032258
rem sleep behavior disorder0.032258
age 30-400.032258
LOWER IN infant0.032258
LOWER IN age 1 year0.032258
kingdom of norway0.032258
oslo0.032258
diet0.032258
animal product diet0.032258
LOWER IN plant diet0.032258
age 1-3 years0.032258
LOWER IN age &lt; 1 year0.032258
state of texas0.032258
heterosexual0.032258
msw0.032258
LOWER IN gay0.032258
LOWER IN homosexual0.032258
LOWER IN msm0.032258
hiv infection0.032258
kingdom of spain0.032258
sweden0.032258
male0.032258
belgium0.032258
age 3-60.032258
age 8-120.032258
LOWER IN adult0.032258
LOWER IN age 30-500.032258
LOWER IN age 60-790.032258
LOWER IN nepal0.032258
LOWER IN himalayas0.032258
LOWER IN antibiotic0.032258
LOWER IN vancomycin0.032258
LOWER IN metronidazole0.032258
LOWER IN neomycin0.032258
state of california0.032258
LOWER IN thailand0.032258
rectum0.032258
sigmoid colon0.032258
terminal ileum0.032258
biopsy0.032258
children0.032258
age 30 days0.032258
LOWER IN age 1 week0.032258
gallus gallus0.032258
chicken0.032258
caucasian0.032258
european0.032258
LOWER IN asian0.032258
Exp. ID User ID Description Date Region Flag Sequences
796amnon high in control compared to graves' disease in feces homo sapiens adult taiwan republic of china taoyuan city 2021-06-10v3No1 / 12
713amnon high in remission compared to active disease in feces homo sapiens crohn's disease 2028-05-21v3No1 / 13
12amnon high in chronic fatigue syndrome compared to control in feces homo sapiens new york county 2016-11-02v4No1 / 18
404amnonnegatively correlated with fiber intake ( high in low fiber compared to high fiber plant fiber cell in feces homo sapiens city adult colombia )2018-11-20v4No1 / 32
297amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years 2018-02-12v4No1 / 38
644amnonnegatively correalted with bmi ( high in low bmi compared to body mass index high bmi in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 42
400amnonlower in children of hmong migrands born in the usa compared to non-migrant usa people ( high in united states of america compared to hmong hmong 2nd generation in feces homo sapiens )2018-11-18v4No1 / 52
650amnon high in female compared to male in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 57
522amnon high in high sugar diet age 18 weeks compared to mouse chow age 6 weeks in feces female research facility mus musculus c57bl/6j germany mouse janvier labs 2019-07-03v3No1 / 81
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in feces homo sapiens united states of america adult )2018-02-07v4No1 / 96
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
330amnon high in adult age 30-40 compared to infant age 1 year in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 145
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in feces homo sapiens united states of america )2017-02-27v4No1 / 149
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in feces homo sapiens infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces homo sapiens united states of america 2018-11-16v4No1 / 180
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 220
398amnon high in control compared to crohn's disease in feces homo sapiens belgium 2018-11-15v4No1 / 248
438amnon high in child age 3-6 age 8-12 compared to adult age 30-50 age 60-79 in feces homo sapiens china 2018-12-30v4No1 / 279
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v4No1 / 384
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
738amnon high in age 30 days compared to age 1 week in gallus gallus chicken united kingdom caecum 2021-01-30v3No1 / 474
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
279amnon high in caecum colon compared to stomach small intestine in ochotonidae pikas china 2018-01-24v4No1 / 634

Problems / suggestions? Please email info AT dbbact DOT org