Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGTGGCATGGTAAGTCAGAAGTGAAAGCCCGGGGCTTAACCCCGGGACTGCTTTTGAAACTGTCATGCTGGAGTGCAGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
infant0.298851
feces0.199396
age 1 year0.165289
homo sapiens0.158730
mus musculus0.152866
antibiotic0.152672
mouse0.144330
united states of america0.123871
age0.115942
research facility0.112408
formula fed0.105263
LOWER IN control0.103774
state of georgia0.102564
crohn's disease0.100000
rattus norvegicus0.095238
rat0.083333
c57bl/60.081633
LOWER IN age 2 months0.078431
high fat diet + inulin0.076923
pulsed antibiotic treatment, macrolide tylosin tartrate0.076923
mus musculoides0.076923
nyulmc0.076923
nod/shiltj (no. 001976, jackson labs)0.076923
age 7 months0.076923
LOWER IN estonia0.076923
age >940.076923
age < 3 years0.074074
LOWER IN rural community0.074074
finland0.072727
caecum0.067797
jackson laboratories0.066667
gallus gallus0.062500
chicken0.062500
LOWER IN adult0.056338
state of california0.055556
sweden0.054054
germany0.051282
adult0.048544
child0.048193
male0.045455
icr/cd-1 mice0.040000
chronic fatigue syndrome0.040000
new york county0.040000
LOWER IN age 30-400.040000
oslo0.040000
mammalian milk beverage0.040000
stress: chronic subordinate colony housing0.040000
LOWER IN no stress: single housed control0.040000
mouse strain c57bc/6ncrl0.040000
no immunization: vehicle as control0.040000
salmune vaccination0.040000
cefoperazone0.040000
age 14-28 days0.040000
little physical activity0.040000
LOWER IN physical activity0.040000
LOWER IN cron diet0.040000
cast/eij0.040000
LOWER IN diet induced metabolic disease0.040000
age 3-60.040000
LOWER IN age 8-120.040000
LOWER IN age 13-140.040000
LOWER IN peru0.040000
LOWER IN tunapuco0.040000
glasgow0.040000
LOWER IN age 0-6 months0.040000
indonesia0.040000
municipality of yogyakarta0.040000
LOWER IN age 30-500.040000
LOWER IN age 60-790.040000
age one year0.040000
LOWER IN age one month0.040000
age 60-790.040000
LOWER IN age 19-240.040000
LOWER IN soldiers0.040000
probiotic0.039216
LOWER IN age 1-3 years0.039216
fiber diet0.039216
LOWER IN breast milk0.039216
LOWER IN non c. diff diarrhea0.039216
LOWER IN breast fed0.039216
vaccination0.039216
LOWER IN age 2 years0.039216
american diet0.039216
LOWER IN c57bl/6j0.039216
state of oklahoma0.039216
LOWER IN neomycin0.039216
age 2-4 years0.039216
LOWER IN thailand0.039216
european0.039216
LOWER IN asian0.039216
LOWER IN age &lt;1 year0.039216
age 30-500.039216
clostridium difficile infection0.038462
systemic lupus erythematosus0.038462
charles river laboratories0.038462
LOWER IN caloric restriction diet0.038462
neomycin0.038462
taconic farms0.038462
LOWER IN jackson laboratories0.038462
age 8 weeks0.038462
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN age 2 months0.666667
high fat diet + inulin0.500000
pulsed antibiotic treatment, macrolide tylosin tartrate0.500000
mus musculoides0.500000
nyulmc0.500000
nod/shiltj (no. 001976, jackson labs)0.500000
icr/cd-1 mice0.500000
chronic fatigue syndrome0.500000
new york county0.500000
LOWER IN age 30-400.500000
oslo0.500000
mammalian milk beverage0.500000
stress: chronic subordinate colony housing0.500000
LOWER IN no stress: single housed control0.500000
mouse strain c57bc/6ncrl0.500000
no immunization: vehicle as control0.500000
age 7 months0.500000
salmune vaccination0.500000
LOWER IN estonia0.500000
cefoperazone0.500000
age 14-28 days0.500000
little physical activity0.500000
LOWER IN physical activity0.500000
LOWER IN cron diet0.500000
cast/eij0.500000
LOWER IN diet induced metabolic disease0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
LOWER IN peru0.500000
LOWER IN tunapuco0.500000
glasgow0.500000
LOWER IN age 0-6 months0.500000
indonesia0.500000
municipality of yogyakarta0.500000
age >940.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
age one year0.500000
LOWER IN age one month0.500000
age 60-790.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
age 1 year0.400000
probiotic0.333333
LOWER IN age 1-3 years0.333333
infant0.333333
fiber diet0.333333
LOWER IN breast milk0.333333
LOWER IN non c. diff diarrhea0.333333
formula fed0.333333
LOWER IN breast fed0.333333
vaccination0.333333
age < 3 years0.333333
LOWER IN age 2 years0.333333
american diet0.333333
LOWER IN c57bl/6j0.333333
state of oklahoma0.333333
LOWER IN rural community0.333333
LOWER IN neomycin0.333333
age 2-4 years0.333333
LOWER IN thailand0.333333
european0.333333
LOWER IN asian0.333333
LOWER IN age &lt;1 year0.333333
age 30-500.333333
antibiotic0.285714
state of georgia0.285714
finland0.285714
clostridium difficile infection0.250000
systemic lupus erythematosus0.250000
charles river laboratories0.250000
crohn's disease0.250000
LOWER IN caloric restriction diet0.250000
neomycin0.250000
taconic farms0.250000
LOWER IN jackson laboratories0.250000
age 8 weeks0.250000
LOWER IN small village0.250000
LOWER IN vancomycin0.250000
caucasian0.250000
age > 1 year0.250000
state of north carolina0.200000
commonwealth of virginia0.200000
rattus norvegicus0.200000
ampicillin0.200000
age0.190476
jackson laboratories0.166667
clostridium difficile intestinal infectious disease0.166667
LOWER IN age 3 months0.166667
age < 1 year0.142857
body mass index0.142857
old age0.142857
LOWER IN young age0.142857
LOWER IN metronidazole0.142857
kingdom of denmark0.142857
mus musculus0.129032
mouse0.127273
kingdom of norway0.125000
diarrhea0.125000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.916667
homo sapiens0.625000
united states of america0.479167
research facility0.270833
infant0.270833
LOWER IN control0.250000
mus musculus0.187500
mouse0.166667
antibiotic0.104167
adult0.104167
age 1 year0.104167
age0.083333
caecum0.083333
c57bl/60.062500
state of georgia0.062500
rattus norvegicus0.062500
rat0.062500
crohn's disease0.062500
formula fed0.062500
germany0.062500
gallus gallus0.062500
chicken0.062500
china0.062500
jackson laboratories0.041667
high fat diet + inulin0.041667
pulsed antibiotic treatment, macrolide tylosin tartrate0.041667
female0.041667
mus musculoides0.041667
nyulmc0.041667
nod/shiltj (no. 001976, jackson labs)0.041667
LOWER IN adult0.041667
male0.041667
age 7 months0.041667
LOWER IN age 2 months0.041667
state of california0.041667
sweden0.041667
finland0.041667
LOWER IN estonia0.041667
age < 3 years0.041667
LOWER IN rural community0.041667
child0.041667
age >940.041667
probiotic0.020833
israel0.020833
clostridium difficile infection0.020833
canis lupus familiaris0.020833
state of north carolina0.020833
dog0.020833
age < 1 year0.020833
LOWER IN age 1-3 years0.020833
systemic lupus erythematosus0.020833
commonwealth of virginia0.020833
fiber diet0.020833
LOWER IN control diet0.020833
dentition0.020833
charles river laboratories0.020833
icr/cd-1 mice0.020833
chronic fatigue syndrome0.020833
new york county0.020833
LOWER IN age 30-400.020833
kingdom of norway0.020833
oslo0.020833
mammalian milk beverage0.020833
LOWER IN breast milk0.020833
stress: chronic subordinate colony housing0.020833
LOWER IN no stress: single housed control0.020833
mouse strain c57bc/6ncrl0.020833
no immunization: vehicle as control0.020833
clostridium difficile intestinal infectious disease0.020833
LOWER IN non c. diff diarrhea0.020833
hospital0.020833
australia0.020833
diarrhea0.020833
LOWER IN breast fed0.020833
vaccination0.020833
salmune vaccination0.020833
LOWER IN age 3 months0.020833
cefoperazone0.020833
c57bl/6j0.020833
age 14-28 days0.020833
LOWER IN child0.020833
LOWER IN age 2 years0.020833
little physical activity0.020833
LOWER IN physical activity0.020833
diet0.020833
american diet0.020833
LOWER IN cron diet0.020833
LOWER IN caloric restriction diet0.020833
cast/eij0.020833
LOWER IN c57bl/6j0.020833
LOWER IN diet induced metabolic disease0.020833
belgium0.020833
age 3-60.020833
LOWER IN age 8-120.020833
LOWER IN age 13-140.020833
body mass index0.020833
high bmi0.020833
LOWER IN low bmi0.020833
united kingdom0.020833
ampicillin0.020833
Exp. ID User ID Description Date Region Flag Sequences
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in feces research facility antibiotic mus musculus israel mouse )2018-10-23v4No1 / 3
702amnon high in clostridium difficile infection compared to control in feces united states of america canis lupus familiaris state of north carolina dog 2028-04-02v4No1 / 6
589amnondominant feces, united states of america, research facility, mus musculus, c57bl/6, state of georgia, mouse, jackson laboratories, high fat diet + inulin2020-02-10v4No1 / 12
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in age age < 1 year compared to age 1-3 years in feces homo sapiens infant )2017-11-13v4No1 / 13
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 16
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v4No1 / 17
719amnonhigher in diet containing fiber compared to non fiber containing diet ( high in fiber diet compared to control diet in united states of america research facility dentition mus musculus state of georgia mouse charles river laboratories icr/cd-1 mice )2028-05-23v4No1 / 17
12amnon high in chronic fatigue syndrome compared to control in feces homo sapiens new york county 2016-11-02v4No1 / 18
330amnon high in infant age 1 year compared to adult age 30-40 in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 19
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in feces homo sapiens infant )2016-12-01v4No1 / 21
47amnonsmj: higher in bullied, non-immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in feces united states of america research facility mus musculus male mouse strain c57bc/6ncrl no immunization: vehicle as control )2017-01-13v4No1 / 21
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in feces homo sapiens hospital australia diarrhea )2018-11-04v4No1 / 24
399amnondominant feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v4No1 / 27
399amnon high in crohn's disease compared to control in feces homo sapiens united states of america 2018-11-16v4No1 / 27
46amnonsmj: higher in mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 28
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 31
127amnonhigher in vaccinated chickens ( high in vaccination salmune vaccination compared to control in united states of america caecum gallus gallus chicken )2017-04-14v4No1 / 34
284amnon high in age 1 year compared to age 2 months in feces homo sapiens female infant state of california 2018-01-27v4No1 / 35
669amnoncommon feces, homo sapiens, infant, sweden, age 1 year2020-09-26v4No1 / 35
797amnon high in age 7 months compared to age 3 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 44
241amnonhigher in babies from finland compared to estonia ( high in finland compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 45
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 50
127amnoncommon united states of america, caecum, gallus gallus, chicken, age 14-28 days2017-04-14v4No1 / 51
797amnon high in infant age 1 year compared to child age 2 years in feces homo sapiens germany formula fed 2021-06-13v3No1 / 52
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 59
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in diet american diet compared to cron diet caloric restriction diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 61
125amnonanti-correlated with diet induced metabolic disease in germ free transplantation ( high in cast/eij compared to c57bl/6j diet induced metabolic disease in feces united states of america mus musculus mouse )2017-04-14v4No1 / 63
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in feces homo sapiens china )2018-12-30v4No1 / 76
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 77
589amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, state of georgia, mouse, jackson laboratories, high fat diet + inulin2020-02-10v4No1 / 78
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic ampicillin neomycin compared to control in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 80
127amnonhigh in old (14-28 days) compared to young (0-3 day) chickens ( high in age old age compared to young age in united states of america caecum gallus gallus chicken )2017-04-14v4No1 / 98
538amnon high in taconic farms compared to jackson laboratories in feces research facility mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 135
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 146
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
399amnoncommon feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v4No1 / 184
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
669amnon high in age 1 year compared to age 2 months in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
723amnon high in age 2-4 years compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in feces homo sapiens china )2018-12-30v4No1 / 474
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
372amnon high in mouse chow compared to high fat diet in feces united states of america research facility mus musculus mouse 2018-09-07v4No1 / 579
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in feces homo sapiens china )2018-12-30v4No1 / 617

Problems / suggestions? Please email info AT dbbact DOT org