Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGCAGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCCGGACTGCATTGGAAACTGTTGATCTTGAGTACCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
feces0.413949
homo sapiens0.302581
canis lupus familiaris0.239787
adult0.229117
united states of america0.217904
dog0.216216
gallus gallus0.137221
chicken0.137221
italy0.114286
child0.108844
research facility0.105097
zoological garden0.098544
china0.095895
caecum0.092827
control0.088578
infant0.082569
cat0.081633
felis catus0.080000
male0.073171
cobb broiler chicken0.071429
age 35 days0.068966
sweden0.065934
female0.063564
acinonyx jubatus0.063158
kingdom of spain0.061224
rectum0.060914
obesity0.060000
formula fed0.060000
high bmi0.059553
germany0.058394
LOWER IN control0.057143
colon0.056206
captive0.055556
canis lupus0.053004
age 2-4 years0.052770
heterosexual0.052539
msw0.052539
wolf0.052539
seattle0.052083
colonized germ free0.052083
state of north carolina0.051414
broiler chicken0.050761
south africa0.046083
cheetah0.042553
skin0.042194
state of colorado0.041522
russia0.040404
canada0.035714
wild0.034783
mouse0.034582
mus musculus0.032609
state of oklahoma0.032172
panthera leo0.032172
lion0.032172
age 30-500.032172
age 30 days0.032172
cftr s489x0.031915
indonesia0.031915
municipality of yogyakarta0.031915
midwest region0.031915
lake hulun0.031915
new zealand0.031915
LOWER IN rural community0.031915
jinzhou city prefecture0.031915
guangzhou city prefecture0.031662
estonia0.031414
republic of china0.031414
age 1 year0.031250
LOWER IN duodenum0.031250
age 2 years0.030928
taiwan0.030928
hiv infection0.030457
cystic fibrosis0.030457
mongolia0.030457
obsolete_juvenile stage0.030457
ovis aries0.030000
LOWER IN ileum0.029777
age0.029557
sus scrofa0.029126
pig0.029126
cloaca0.028708
australia0.028103
winter0.025751
LOWER IN age 2 months0.021622
panthera tigris0.021505
tiger0.021505
aardvark0.021505
orycteropus afer0.021505
cheyenne0.021505
native american0.021505
arapaho0.021505
age 7 months0.021505
city of melbourne0.021505
felis silvestris0.021505
wild cat0.021505
flagstaff0.021505
vulpes corsac0.021505
corsac fox0.021505
nephrolithiasis0.021505
nanning city prefecture0.021505
Fraction of dbbact annotations with this term covered by the query
TermScore
acinonyx jubatus0.750000
canis lupus0.750000
age 2-4 years0.666667
cheetah0.666667
state of oklahoma0.666667
panthera leo0.666667
lion0.666667
LOWER IN age 2 months0.666667
age 30-500.666667
age 30 days0.666667
canis lupus familiaris0.625000
dog0.600000
heterosexual0.600000
msw0.600000
wolf0.600000
cat0.571429
LOWER IN primary progressive multiple sclerosis0.500000
acquired immunodeficiency syndrome0.500000
schizophrenia0.500000
panthera tigris0.500000
tiger0.500000
aardvark0.500000
orycteropus afer0.500000
chronic fatigue syndrome0.500000
new york county0.500000
cobb broiler chicken0.500000
cheyenne0.500000
native american0.500000
arapaho0.500000
seattle0.500000
cftr s489x0.500000
colonized germ free0.500000
age 7 months0.500000
city of melbourne0.500000
felis silvestris0.500000
wild cat0.500000
indonesia0.500000
municipality of yogyakarta0.500000
midwest region0.500000
enzyme supplement0.500000
LOWER IN no enzyme supplement0.500000
exocrine pancreatic insufficiency0.500000
flagstaff0.500000
lake hulun0.500000
vulpes corsac0.500000
corsac fox0.500000
new zealand0.500000
stroke0.500000
endospore enriched fraction0.500000
lysis0.500000
age 25-50 years0.500000
myrmecophaga tridactyla0.500000
giant anteater0.500000
bihar state0.500000
przewalski horse0.500000
breast fed0.500000
nephrolithiasis0.500000
nanning city prefecture0.500000
age 50-60 years0.500000
age 2-7 years0.500000
LOWER IN lymphoma0.500000
lymphoma0.500000
state of louisiana0.500000
LOWER IN canis lupus familiaris0.500000
LOWER IN dog0.500000
LOWER IN dog breeding center0.500000
wildlife sactuary0.500000
age 50-70 years0.500000
little physical activity0.500000
LOWER IN physical activity0.500000
vegetarian diet0.500000
LOWER IN cron diet0.500000
sesame allergy0.500000
LOWER IN milk allergy0.500000
age 4-10 years0.500000
coronary heart disease0.500000
omnivore diet0.500000
sri lanka0.500000
age 1-18 years0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
usa born0.500000
LOWER IN non usa born0.500000
age <1 year0.500000
LOWER IN enzyme supplementation0.500000
LOWER IN exocrine pancreatic insufficiency0.500000
novosibirsk0.500000
dairy0.500000
LOWER IN gay0.500000
denver0.500000
LOWER IN age 7 months0.500000
mild0.500000
LOWER IN severe0.500000
canis lupus arctos0.500000
toronto zoo0.500000
arctic wolf0.500000
african lion safari0.500000
beagle dog0.500000
puppy0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.840659
homo sapiens0.478022
united states of america0.346154
adult0.263736
canis lupus familiaris0.148352
research facility0.137363
dog0.131868
china0.120879
control0.104396
gallus gallus0.087912
chicken0.087912
italy0.076923
child0.071429
male0.071429
zoological garden0.060440
caecum0.060440
LOWER IN control0.054945
infant0.049451
germany0.043956
felis catus0.043956
cat0.043956
female0.043956
cobb broiler chicken0.038462
age 35 days0.038462
kingdom of spain0.038462
sweden0.038462
acinonyx jubatus0.032967
obesity0.032967
high bmi0.032967
mus musculus0.032967
mouse0.032967
formula fed0.032967
captive0.032967
rectum0.032967
colon0.032967
age 2-4 years0.027473
south africa0.027473
state of north carolina0.027473
broiler chicken0.027473
seattle0.027473
colonized germ free0.027473
heterosexual0.027473
msw0.027473
canis lupus0.027473
wolf0.027473
skin0.027473
russia0.021978
cheetah0.021978
state of colorado0.021978
wild0.021978
canada0.021978
hiv infection0.016484
cloaca0.016484
estonia0.016484
state of oklahoma0.016484
cystic fibrosis0.016484
cftr s489x0.016484
panthera leo0.016484
lion0.016484
australia0.016484
indonesia0.016484
municipality of yogyakarta0.016484
midwest region0.016484
mongolia0.016484
winter0.016484
lake hulun0.016484
new zealand0.016484
guangzhou city prefecture0.016484
age 1 year0.016484
age 2 years0.016484
age 30-500.016484
taiwan0.016484
republic of china0.016484
LOWER IN duodenum0.016484
LOWER IN ileum0.016484
ovis aries0.016484
obsolete_juvenile stage0.016484
age 30 days0.016484
LOWER IN rural community0.016484
sus scrofa0.016484
pig0.016484
jinzhou city prefecture0.016484
age0.016484
panthera tigris0.010989
tiger0.010989
viet nam0.010989
aardvark0.010989
orycteropus afer0.010989
cheyenne0.010989
native american0.010989
arapaho0.010989
age 7 months0.010989
namibia0.010989
czech republic0.010989
state of tennessee0.010989
thailand0.010989
city of melbourne0.010989
felis silvestris0.010989
wild cat0.010989
state of arizona0.010989
Exp. ID User ID Description Date Region Flag Sequences
574amnon high in control compared to primary progressive multiple sclerosis in feces homo sapiens adult russia 2020-01-05v3No1 / 2
629amnon high in hiv infection acquired immunodeficiency syndrome compared to control in feces homo sapiens adult kingdom of the netherlands amsterdam 2020-05-31v4No1 / 10
502amnon high in schizophrenia compared to control in feces homo sapiens united states of america adult 2019-03-12v4No1 / 13
666amnondominant feces, italy, panthera tigris, tiger2020-09-25v3No1 / 13
564amnon high in control compared to autistic disorder in feces homo sapiens child italy age 2-4 years 2019-11-18v3No1 / 14
406amnondominant feces, acinonyx jubatus, south africa, cheetah2018-11-21v4No1 / 15
406amnondominant feces, acinonyx jubatus, south africa, cheetah2018-11-21v4No1 / 15
702amnoncommon feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-02v4No1 / 15
568amnondominant feces, gallus gallus, chicken, broiler chicken, viet nam2019-12-08v3No1 / 15
406amnondominant feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 17
12amnon high in chronic fatigue syndrome compared to control in feces homo sapiens new york county 2016-11-02v4No1 / 18
744amnondominant research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 18
799amnonhigher before ketogenic diet compared to after ketogenic diet in obese participants ( high in control diet compared to ketogenic diet in feces homo sapiens obesity adult estonia high bmi )2021-06-13v3No1 / 18
574amnondominant feces, homo sapiens, adult, russia2020-01-05v3No1 / 19
242amnonhigh freq. in native-americans (dominant feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 20
399amnondominant feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 20
619amnondominant feces, united states of america, research facility, mus musculus, mouse, cystic fibrosis, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 20
797amnondominant feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 20
15amnondominant feces, acinonyx jubatus, namibia2016-11-08v4No1 / 21
744amnondominant research facility, gallus gallus, male, chicken, caecum, cobb broiler chicken, age 35 days2021-02-21v3No1 / 21
552amnondominant feces, homo sapiens, czech republic2019-09-05v3No1 / 22
619amnondominant feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 22
399amnondominant feces, united states of america, state of tennessee, zoological garden, panthera leo, lion2018-11-16v4No1 / 23
702amnondominant feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-02v4No1 / 23
568amnondominant feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 23
340amnondominant feces, felis catus, australia, city of melbourne, cat2018-05-27v4No1 / 24
702amnondominant feces, united states of america, felis catus, state of north carolina, cat2028-04-02v4No1 / 24
666amnondominant feces, italy, felis silvestris, wild cat2020-09-25v3No1 / 24
723amnondominant feces, homo sapiens, child, indonesia, municipality of yogyakarta, age 2-4 years2021-01-02v3No1 / 24
745amnondominant feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 24
436amnondominant feces, united states of america, felis catus, state of colorado, cat2018-12-25v4No1 / 25
619amnon high in cystic fibrosis cftr s489x compared to control in feces united states of america research facility mus musculus mouse seattle colonized germ free 2020-05-04v3No1 / 25
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 26
150amnonhigh in EPI dogs with enzyme supplement compared to no supplement ( high in enzyme supplement compared to no enzyme supplement in feces united states of america canis lupus familiaris dog exocrine pancreatic insufficiency )2017-04-26v4No1 / 27
540amnondominant feces, united states of america, canis lupus familiaris, state of arizona, flagstaff, dog2019-07-31v4No1 / 27
815amnondominant feces, mongolia, winter, wild, lake hulun, vulpes corsac, corsac fox2021-07-04v3No1 / 27
540amnoncommon feces, united states of america, canis lupus familiaris, state of arizona, flagstaff, dog2019-07-31v4No1 / 28
668amnondominant feces, research facility, felis catus, new zealand, cat2020-09-26v3No1 / 29
573amnoncommon feces, united states of america, juvenile stage, canis lupus familiaris, commonwealth of pennsylvania, dog2019-12-22v4No1 / 30
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in feces homo sapiens adult guangzhou city prefecture china )2018-05-15v4No1 / 30
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in feces homo sapiens united states of america adult )2018-11-18v4No1 / 31
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 31
666amnoncommon feces, italy, wild, canis lupus, wolf2020-09-25v3No1 / 32
745amnon high in age 25-50 years compared to age 50-80 years in feces homo sapiens united states of america adult midwest region 2021-02-25v3No1 / 32
284amnon high in age 1 year compared to age 2 months in feces homo sapiens female infant state of california 2018-01-27v4No1 / 35
706amnoncommon feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-10v4No1 / 37
681amnoncommon feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 37
744amnoncommon research facility, ileum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 38
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, age 2-4 years2019-11-18v3No1 / 42
406amnoncommon feces, acinonyx jubatus, south africa, cheetah2018-11-21v4No1 / 43
666amnoncommon feces, italy, panthera tigris, tiger2020-09-25v3No1 / 43
406amnoncommon feces, united states of america, zoological garden, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 44
570amnoncommon feces, homo sapiens, india, bihar state2019-12-16v3No1 / 46
597amnoncommon feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 46
666amnoncommon feces, canis lupus familiaris, italy, dog2020-09-25v3No1 / 46
797amnoncommon feces, homo sapiens, child, germany, formula fed, age 2 years2021-06-13v3No1 / 46
597amnoncommon feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 47
406amnoncommon feces, united states of america, zoological garden, equus przewalskii, przewalski horse2018-11-21v4No1 / 50
564amnoncommon feces, homo sapiens, control, child, italy, age 2-4 years2019-11-18v3No1 / 50
797amnoncommon feces, homo sapiens, child, germany, breast fed, age 2 years2021-06-13v3No1 / 50
702amnoncommon feces, united states of america, felis catus, state of north carolina, cat2028-04-02v4No1 / 51
694amnoncommon feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 52
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in feces homo sapiens adult nanning city prefecture age 50-60 years china )2018-01-27v4No1 / 54
15amnoncommon feces, acinonyx jubatus, namibia2016-11-08v4No1 / 55
766amnoncommon in feces of dog females within 24h after parturition (common feces, canis lupus familiaris, french republic, dog, female organism, adult organism, rectal swab, age 2-7 years)2021-04-12v4No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, systemic lupus erythematosus, china2028-04-11v3No1 / 55
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
488amnonlower in feces of dogs with lymphoma compared to healthy controls ( high in control compared to lymphoma in feces canis lupus familiaris italy dog )2019-02-25v4No1 / 56
488amnoncommon feces, canis lupus familiaris, italy, dog, lymphoma2019-02-25v4No1 / 56
648amnon high in control compared to antibiotic metronidazole in feces united states of america canis lupus familiaris dog state of louisiana 2020-09-06v4No1 / 56
753amnon high in zoological garden captive canis lupus wolf compared to farm canis lupus familiaris dog dog breeding center in feces adult china 2021-03-12v4No1 / 57
651amnoncommon feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 58
759amnoncommon feces, united states of america, state of minnesota, canis lupus, wolf, wildlife sactuary2021-04-04v4No1 / 58
814amnonhigher after 2 months of caloric restriction diet ( high in caloric restriction diet compared to control diet in feces homo sapiens female obesity adult obese body mass index status germany high bmi overweight body mass index status age 50-70 years )2021-06-30v4No1 / 58
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 59
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 60
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in diet american diet compared to cron diet caloric restriction diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 61
619amnoncommon feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 61
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
695amnon high in sesame allergy compared to milk allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 64
619amnoncommon feces, united states of america, research facility, cystic fibrosis, mus musculus, mouse, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 64
242amnoncommon in native-americans (common feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 65
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
574amnoncommon feces, homo sapiens, adult, russia2020-01-05v3No1 / 68
593amnoncommon feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 68
72amnoncommon feces, united states of america, canis lupus familiaris, iowa2017-02-25v4No1 / 69
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
656amnoncommon feces, homo sapiens, sri lanka, age 1-18 years2020-09-13v3No1 / 71
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 74
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 3 months 2021-06-13v3No1 / 75
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in feces homo sapiens china )2018-12-30v4No1 / 76
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 77
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 77
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
759amnon high in canis lupus wolf wildlife sactuary compared to canis lupus familiaris dog in feces united states of america state of minnesota 2021-04-06v4No1 / 78
596amnon high in age <1 year compared to age 1-7 years in homo sapiens saliva child sweden 2020-03-18v3No1 / 78
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
301amnon high in rectum colon compared to duodenum ileum in united states of america canis lupus familiaris dog 2018-03-05v4No1 / 79
399amnoncommon feces, united states of america, state of tennessee, zoological garden, panthera leo, lion2018-11-16v4No1 / 79
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic ampicillin neomycin compared to control in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 80
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, china2028-04-11v3No1 / 82
648amnoncommon feces, united states of america, canis lupus familiaris, dog, state of louisiana2020-09-06v4No1 / 83
231amnoncommon in dog rectum (common feces, united states of america, rectum, canis lupus familiaris, dog)2017-11-02v4No1 / 84
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to enzyme supplementation exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 85
668amnoncommon feces, research facility, felis catus, new zealand, cat2020-09-26v3No1 / 85
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
340amnoncommon feces, felis catus, australia, city of melbourne, cat2018-05-27v4No1 / 87
666amnoncommon feces, italy, felis silvestris, wild cat2020-09-25v3No1 / 91
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
363amnoncommon dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 94
488amnoncommon feces, control, canis lupus familiaris, italy, dog2019-02-25v4No1 / 94
753amnoncommon feces, zoological garden, adult, captive, canis lupus, china, wolf2021-03-12v4No1 / 98
363amnon high in rectum caecum colon compared to ruminant reticulum omasum rumen in dairy ovis aries italy obsolete_juvenile stage age 30 days 2018-08-29v4No1 / 101
301amnoncommon united states of america, colon, canis lupus familiaris, dog2018-03-05v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 106
797amnon high in age 1 year compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 107
406amnoncommon feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 107
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
436amnoncommon feces, united states of america, felis catus, state of colorado, cat2018-12-25v4No1 / 108
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in feces homo sapiens united states of america child )2018-11-22v4No1 / 110
565amnoncommon zoological garden, skin, captive, canada, canis lupus arctos, toronto zoo, arctic wolf2019-11-21v3No1 / 114
744amnoncommon research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 114
301amnoncommon united states of america, rectum, canis lupus familiaris, dog2018-03-05v4No1 / 116
565amnoncommon zoological garden, skin, acinonyx jubatus, cheetah, captive, canada, african lion safari2019-11-21v3No1 / 123
69amnoncommon feces, united states of america, research facility, canis lupus familiaris, beagle dog2017-02-21v4No1 / 125
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 126
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 132
766amnon high in age 8 weeks compared to age 2 days in feces canis lupus familiaris french republic dog rectal swab puppy 2021-04-12v4No1 / 133
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america )2017-04-11v4No1 / 139
797amnon high in child age 2 years compared to infant age 1 year in feces homo sapiens germany formula fed 2021-06-13v3No1 / 139
744amnoncommon research facility, gallus gallus, male, chicken, caecum, cobb broiler chicken, age 35 days2021-02-21v3No1 / 141
815amnoncommon feces, mongolia, winter, wild, lake hulun, vulpes corsac, corsac fox2021-07-04v3No1 / 146
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in feces homo sapiens united states of america )2017-02-27v4No1 / 149
565amnoncommon zoological garden, skin, panthera leo, lion, captive, canada, toronto zoo2019-11-21v3No1 / 150
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, bile, gallbladder, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
815amnoncommon feces, mongolia, winter, wild, vulpes vulpes, lake hulun, red fox2021-07-04v3No1 / 160
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
669amnon high in age 1 year compared to age 2 months in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
780amnon high in caecum compared to small intestine duodenum jejunum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 212
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
584amnoncommon feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 221
10amnonpositively correlated with age (6-35) ( high in adult compared to child in feces homo sapiens toronto )2016-10-27v4No1 / 228
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, age 50-60 years, nephrolithiasis, china)2018-01-27v4No1 / 239
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in feces homo sapiens infant india )2016-12-19v4No1 / 253
744amnon high in cloaca compared to ileum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 265
568amnoncommon feces, gallus gallus, chicken, broiler chicken, viet nam2019-12-08v3No1 / 272
752sheryoHigher in treatments without biochar compared to treatments with biochar in soil planted with Panax notoginseng amended with 2% biochar ( high in without biochar compared to biochar in soil yunnan province ph 6 china panax notoginseng pot expreiment xundian county sanqi plants )2021-03-11v3No1 / 273
438amnon high in child age 3-6 age 8-12 compared to adult age 30-50 age 60-79 in feces homo sapiens china 2018-12-30v4No1 / 279
744amnon high in caecum compared to ileum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 286
780amnoncommon research facility, gallus gallus, chicken, china, jinzhou city prefecture, caecum2021-04-28v3No1 / 294
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
723amnon high in age 2-4 years compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
208amnoncommon feces, united states of america, mus musculus, balb/c, state of texas, mouse2017-10-06v4No1 / 316
568amnoncommon feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 320
61amnoncommon united states of america, research facility, skin, inguinal region, canis lupus familiaris2017-02-05v4No1 / 327
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
776amnoncommon research facility, gallus gallus, hawaii, chicken, captive, broiler chicken, caecum, age 5 weeks2021-04-25v3No1 / 343
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 347
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v4No1 / 384
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
738amnon high in age 30 days compared to age 1 week in gallus gallus chicken united kingdom caecum 2021-01-30v3No1 / 474
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in feces homo sapiens china )2018-12-30v4No1 / 617
752sheryoCommon in soil planted with Panax notoginseng (common soil, yunnan province, ph 6, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 730
816amnonlower in sows in first pregnancy compared to later pregnancies ( high in multiple pregnancies compared to first pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 780
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261

Problems / suggestions? Please email info AT dbbact DOT org