Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGGCAAGCCAGATGTGAAAACCCAGGGCTCAACCTTGGGATTGCATTTGGAACTGCCAGGCTGGAGTGCAGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
feces0.325732
homo sapiens0.297767
adult0.216347
gallus gallus0.172716
chicken0.172716
china0.168582
italy0.124464
canada0.119318
research facility0.113125
captive0.111628
zoological garden0.107143
germany0.103935
caecum0.102564
male0.096096
female0.093832
wild0.086643
rumen0.081633
sheep0.076596
ovis aries0.074689
infant0.072522
cobb broiler chicken0.072398
pot expreiment0.072398
united states of america0.070273
age 35 days0.069869
farm0.068376
child0.065306
control0.064241
soil0.063966
african lion safari0.063927
kingdom of spain0.058333
taiwan0.056338
capra hircus0.055300
goat0.055300
ruminal fluid0.055300
lettuce0.055300
obesity0.054695
age 1 year0.051064
city0.049383
age 3-5 weeks0.047059
organic fertilization0.046512
age 6 weeks0.045977
broiler chicken0.045455
manure fertilization0.045455
monkey0.045283
pregnancy0.044444
skin0.043656
triticum aestivum0.043478
manured soil0.042553
sweden0.042105
bulk soil0.041667
colon0.038835
republic of china0.037915
algonquin provincial park0.037559
peromyscus maniculatus0.037559
deer mice0.037559
toronto zoo0.037559
hefei city prefecture0.037559
baijiu0.037559
lake hulun0.037559
thyrow0.037559
bernburg0.037559
crop rotation0.037559
province of ontario0.036866
mud0.036866
fermentation pit mud0.036866
formula fed0.036866
haplic luvisol0.036866
obsolete_juvenile stage0.036641
cow0.036419
new zealand0.036199
lamb0.036199
mongolia0.035556
LOWER IN male0.035398
sus scrofa0.035346
pig0.035346
bos taurus0.035139
LOWER IN adult0.035088
ph 7.60.034934
united kingdom0.031621
winter0.029304
equus asinus africanus0.028640
heterosexual0.028571
msw0.028571
europe0.028436
days 180-2700.028436
dairy goat0.028436
milk0.028436
cow milk (fluid)0.028436
cow milk (raw)0.028436
albic luvisol0.028436
jinzhou city prefecture0.028436
bio-dynamic fertilizer0.028436
guangzhou city prefecture0.028235
cameroon0.028037
shanxi province0.028037
nanjing city prefecture0.028037
age 1 week0.027650
gay0.027650
south korea0.027523
hawaii0.027273
Fraction of dbbact annotations with this term covered by the query
TermScore
taiwan0.750000
age 3-5 weeks0.666667
republic of china0.666667
overweight body mass index status0.666667
equus asinus africanus0.666667
donkey0.666667
heterosexual0.600000
msw0.600000
vicugna pacos0.500000
alpaca0.500000
ovis aries musimon0.500000
mouflon0.500000
african lion safari0.500000
macropus rufus0.500000
red kangaroo0.500000
capra hircus0.500000
goat0.500000
algonquin provincial park0.500000
peromyscus maniculatus0.500000
deer mice0.500000
toronto zoo0.500000
equus ferus0.500000
schizophrenia0.500000
LOWER IN small village0.500000
central chimpanzee0.500000
chronic fatigue syndrome0.500000
new york county0.500000
lama guanicoe0.500000
cobb broiler chicken0.500000
breast fed0.500000
europe0.500000
pan troglodytes verus0.500000
western chimpanzee0.500000
hefei city prefecture0.500000
baijiu0.500000
days 180-2700.500000
active disease0.500000
vulpes vulpes0.500000
lake hulun0.500000
red fox0.500000
mild0.500000
LOWER IN severe0.500000
age 15-20 weeks0.500000
feral0.500000
vulpes corsac0.500000
corsac fox0.500000
centererians0.500000
stroke0.500000
low fiber0.500000
bihar state0.500000
short beaked common dolphin0.500000
autoimmune hepatitis0.500000
zhengzhou city prefecture0.500000
taoyuan city0.500000
age 50-70 years0.500000
little physical activity0.500000
LOWER IN physical activity0.500000
vegetarian diet0.500000
chengdu city prefecture0.500000
gestational age 8-12 weeks0.500000
athlete0.500000
sesame allergy0.500000
LOWER IN milk allergy0.500000
age 4-10 years0.500000
coronary heart disease0.500000
santa catarina state0.500000
omnivore diet0.500000
LOWER IN age 30 days0.500000
sri lanka0.500000
age 1-18 years0.500000
common bottlenose dolphin0.500000
taipei city0.500000
municipality of reus0.500000
hainan autonomous prefecture0.500000
trachemys scripta elegans0.500000
red-eared slider turtle0.500000
turtle farm0.500000
weight loss0.500000
weight loss diet0.500000
high protein diet0.500000
gaz:000521000.500000
eidolon helvum0.500000
fruit bat0.500000
novosibirsk0.500000
LOWER IN egypt0.500000
felis silvestris0.500000
wild cat0.500000
pemba island0.500000
5-6 hours0.500000
LOWER IN 1-2 hours0.500000
ruminal fluid0.500000
dairy goat0.500000
sciurus carolinensis0.500000
eastern gray squirrel0.500000
denver0.500000
LOWER IN age 7 months0.500000
pteropus giganteus0.500000
indian flying fox0.500000
LOWER IN restricted feed0.500000
milk0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.624390
homo sapiens0.400000
adult0.224390
china0.200000
research facility0.146341
italy0.141463
gallus gallus0.112195
chicken0.112195
canada0.102439
united states of america0.087805
skin0.078049
male0.078049
zoological garden0.073171
captive0.073171
caecum0.073171
soil0.073171
germany0.068293
control0.063415
female0.063415
wild0.058537
farm0.048780
rumen0.048780
ovis aries0.043902
sheep0.043902
infant0.043902
cobb broiler chicken0.039024
age 35 days0.039024
child0.039024
pot expreiment0.039024
african lion safari0.034146
kingdom of spain0.034146
capra hircus0.029268
goat0.029268
city0.029268
monkey0.029268
age 1 year0.029268
taiwan0.029268
obesity0.029268
ruminal fluid0.029268
lettuce0.029268
age 3-5 weeks0.024390
LOWER IN control0.024390
age 6 weeks0.024390
colon0.024390
broiler chicken0.024390
sweden0.024390
pregnancy0.024390
manured soil0.024390
manure fertilization0.024390
organic fertilization0.024390
bulk soil0.024390
triticum aestivum0.024390
province of ontario0.019512
algonquin provincial park0.019512
peromyscus maniculatus0.019512
deer mice0.019512
toronto zoo0.019512
bos taurus0.019512
cow0.019512
new zealand0.019512
lamb0.019512
mud0.019512
fermentation pit mud0.019512
hefei city prefecture0.019512
baijiu0.019512
united kingdom0.019512
formula fed0.019512
mongolia0.019512
winter0.019512
lake hulun0.019512
LOWER IN adult0.019512
republic of china0.019512
LOWER IN male0.019512
obsolete_juvenile stage0.019512
sus scrofa0.019512
pig0.019512
thyrow0.019512
haplic luvisol0.019512
ph 7.60.019512
bernburg0.019512
crop rotation0.019512
cameroon0.014634
cloaca0.014634
europe0.014634
days 180-2700.014634
age 1 week0.014634
hawaii0.014634
guangzhou city prefecture0.014634
colombia0.014634
south korea0.014634
hiv infection0.014634
heterosexual0.014634
msw0.014634
high bmi0.014634
gay0.014634
homosexual0.014634
msm0.014634
shanxi province0.014634
dairy goat0.014634
nanjing city prefecture0.014634
Exp. ID User ID Description Date Region Flag Sequences
666amnondominant feces, ovis aries, italy, sheep2020-09-25v3No1 / 7
666amnondominant feces, italy, vicugna pacos, alpaca2020-09-25v3No1 / 7
666amnondominant feces, italy, ovis aries musimon, mouflon2020-09-25v3No1 / 8
565amnondominant zoological garden, skin, captive, canada, african lion safari, macropus rufus, red kangaroo2019-11-21v3No1 / 9
666amnondominant feces, italy, capra hircus, goat2020-09-25v3No1 / 9
537amnonhigh freq. in feces of wild caught deer mice feces (dominant feces, canada, province of ontario, algonquin provincial park, wild, peromyscus maniculatus, deer mice, age 3-5 weeks)2019-07-28v3No1 / 10
565amnondominant zoological garden, skin, captive, canada, tragelaphus oryx, toronto zoo, eland2019-11-21v3No1 / 10
565amnondominant farm, skin, bos taurus, cow, canada2019-11-21v3No1 / 12
666amnondominant feces, italy, equus ferus, wild horse2020-09-25v3No1 / 12
502amnon high in schizophrenia compared to control in feces homo sapiens united states of america adult 2019-03-12v4No1 / 13
649amnondominant research facility, ovis aries, new zealand, sheep, lamb, age 6 weeks, colon2020-09-07v3No1 / 13
290amnon high in city compared to small village rural community in feces homo sapiens adult china 2018-02-01v4No1 / 14
568amnondominant feces, gallus gallus, chicken, broiler chicken, viet nam2019-12-08v3No1 / 15
729amnondominant feces, monkey, wild, pan troglodytes troglodytes, cameroon, central chimpanzee2021-01-05v3No1 / 17
12amnon high in chronic fatigue syndrome compared to control in feces homo sapiens new york county 2016-11-02v4No1 / 18
565amnondominant zoological garden, skin, giraffa camelopardalis, giraffe, captive, canada, african lion safari2019-11-21v3No1 / 18
666amnondominant feces, italy, lama guanicoe2020-09-25v3No1 / 18
744amnondominant research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 18
797amnondominant feces, homo sapiens, infant, germany, age 1 year, breast fed2021-06-13v3No1 / 18
729amnondominant feces, zoological garden, monkey, captive, europe, pan troglodytes verus, western chimpanzee2021-01-05v3No1 / 19
744amnondominant research facility, gallus gallus, male, chicken, caecum, cobb broiler chicken, age 35 days2021-02-21v3No1 / 21
568amnondominant feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 23
603amnondominant in baijiu fermentation pit mud in later batches (dominant mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 180-270)2020-04-05v3No1 / 23
738amnondominant gallus gallus, age 1 week, chicken, united kingdom, caecum2021-01-30v3No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, age 1 year, formula fed2021-06-13v3No1 / 23
713amnoncommon feces, homo sapiens, crohn's disease, active disease2028-05-21v3No1 / 24
815amnondominant feces, mongolia, winter, wild, vulpes vulpes, lake hulun, red fox2021-07-04v3No1 / 24
797amnondominant feces, homo sapiens, infant, germany, age 1 year, formula fed2021-06-13v3No1 / 25
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens united states of america rectum biopsy site child biopsy )2018-11-22v4No1 / 26
776amnondominant gallus gallus, hawaii, chicken, wild, caecum, age 15-20 weeks, feral2021-04-25v3No1 / 26
815amnondominant feces, mongolia, winter, wild, lake hulun, vulpes corsac, corsac fox2021-07-04v3No1 / 27
36amnonhigher in centernarians ( high in centererians compared to adult in feces homo sapiens sichuan province )2016-12-06v4No1 / 30
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in feces homo sapiens adult guangzhou city prefecture china )2018-05-15v4No1 / 30
404amnonnegatively correlated with fiber intake ( high in low fiber compared to high fiber plant fiber cell in feces homo sapiens city adult colombia )2018-11-20v4No1 / 32
651amnon high in parkinson's disease compared to control in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 37
681amnoncommon feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 37
744amnoncommon research facility, ileum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 38
570amnoncommon feces, homo sapiens, india, bihar state2019-12-16v3No1 / 46
597amnoncommon feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 46
597amnoncommon feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 47
666amnoncommon feces, italy, delphinus delphis, rectal swab, short beaked common dolphin2020-09-25v3No1 / 48
720amnoncommon feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 48
796amnoncommon feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 51
694amnoncommon feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 52
797amnon high in infant age 1 year compared to child age 2 years in feces homo sapiens germany formula fed 2021-06-13v3No1 / 52
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
131amnon high in female compared to male in feces homo sapiens south korea 2017-04-16v4No1 / 55
720amnoncommon feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 56
650amnon high in female compared to male in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 57
814amnonhigher after 2 months of caloric restriction diet ( high in caloric restriction diet compared to control diet in feces homo sapiens female obesity adult obese body mass index status germany high bmi overweight body mass index status age 50-70 years )2021-06-30v4No1 / 58
565amnoncommon farm, skin, equus caballus, horse, canada2019-11-21v3No1 / 58
666amnoncommon feces, homo sapiens, italy2020-09-25v3No1 / 58
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 59
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 60
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
637amnoncommon feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 61
575amnoncommon in professional martial arts athletes (common feces, homo sapiens, adult, high physical activity, age 19-24, china, athlete)2020-01-05v3No1 / 63
695amnon high in sesame allergy compared to milk allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 64
738amnoncommon gallus gallus, age 1 week, chicken, united kingdom, caecum2021-01-30v3No1 / 64
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
757amnoncommon feces, homo sapiens, adult, brazil, santa catarina state2021-03-28v3No1 / 67
574amnoncommon feces, homo sapiens, adult, russia2020-01-05v3No1 / 68
593amnoncommon feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 68
738amnon high in age 1 week compared to age 30 days in gallus gallus chicken united kingdom caecum 2021-01-30v3No1 / 68
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
656amnoncommon feces, homo sapiens, sri lanka, age 1-18 years2020-09-13v3No1 / 71
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 74
666amnoncommon feces, tursiops truncatus, italy, rectal swab, common bottlenose dolphin2020-09-25v3No1 / 76
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
529amnoncommon feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 79
732amnoncommon feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 79
590amnoncommon farm, intestine, age 3-5 weeks, china, hainan autonomous prefecture, trachemys scripta elegans, red-eared slider turtle, turtle farm2020-02-10v4No1 / 83
721amnon high in weight loss weight loss diet high protein diet compared to high fiber fiber diet in feces homo sapiens obesity adult scotland overweight body mass index status gaz:00052100 2028-05-23v4No1 / 83
565amnoncommon zoological garden, skin, captive, canada, eidolon helvum, toronto zoo, fruit bat2019-11-21v3No1 / 83
629amnon high in heterosexual msw compared to homosexual msm in feces homo sapiens adult male kingdom of the netherlands amsterdam 2020-05-31v4No1 / 85
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
404amnon high in female compared to male in feces homo sapiens city adult colombia 2018-11-20v4No1 / 88
666amnoncommon feces, italy, felis silvestris, wild cat2020-09-25v3No1 / 91
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
736amnoncommon feces, homo sapiens, female, adult, tanzania, pemba island2021-01-25v3No1 / 95
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in feces homo sapiens united states of america adult )2018-02-07v4No1 / 96
787amnonlower in first 2 hours compared to 5-6 hours following eating ( high in 5-6 hours compared to 1-2 hours in research facility rumen ruminal fluid capra hircus china shanxi province goat dairy goat )2021-05-23v3No1 / 101
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 104
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 106
797amnon high in age 1 year compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
565amnoncommon zoological garden, skin, captive, canada, pteropus giganteus, african lion safari, indian flying fox2019-11-21v3No1 / 109
735amnon high in control compared to restricted feed in female pregnancy research facility rumen ovis aries nanjing city prefecture digesta sheep female organism china 2021-01-22v3No1 / 112
744amnoncommon research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 114
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
537amnoncommon in feces of captive grown deer mice feces (common feces, research facility, canada, province of ontario, algonquin provincial park, captive, peromyscus maniculatus, deer mice, age 3-5 weeks)2019-07-28v3No1 / 121
565amnoncommon zoological garden, skin, ceratotherium simum, white rhinoceros, captive, canada, african lion safari2019-11-21v3No1 / 122
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in feces homo sapiens toronto )2016-10-27v4No1 / 125
649amnoncommon research facility, ovis aries, new zealand, sheep, lamb, age 6 weeks, colon2020-09-07v3No1 / 128
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 132
617amnoncommon farm, milk, italy, cow milk (fluid), cow milk (raw), alpine, alpine pasture2020-05-03v3No1 / 137
744amnoncommon research facility, gallus gallus, male, chicken, caecum, cobb broiler chicken, age 35 days2021-02-21v3No1 / 141
666amnoncommon feces, zoological garden, italy, hippopotamus amphibius2020-09-25v3No1 / 146
815amnoncommon feces, mongolia, winter, wild, lake hulun, vulpes corsac, corsac fox2021-07-04v3No1 / 146
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, bile, gallbladder, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
815amnoncommon feces, mongolia, winter, wild, vulpes vulpes, lake hulun, red fox2021-07-04v3No1 / 160
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 162
537amnoncommon in feces of wild caught deer mice feces (common feces, canada, province of ontario, algonquin provincial park, wild, peromyscus maniculatus, deer mice, age 3-5 weeks)2019-07-28v3No1 / 163
700amnoncommon feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 164
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
666amnoncommon feces, italy, apodemus sylvaticus, wood mouse2020-09-25v3No1 / 171
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in feces homo sapiens infant )2017-11-13v4No1 / 173
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol compared to npk fertilized from Germany ( high in manured soil manure fertilization organic fertilization compared to npk fertilization mineral fertilization in soil bulk soil germany thyrow pot expreiment albic luvisol ph 6.4 lettuce )2021-04-07v3No1 / 176
399amnon high in control compared to ulcerative colitis in feces homo sapiens united states of america 2018-11-16v4No1 / 180
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
604amnoncommon research facility, gallus gallus, chicken, cecal content, china, caecum2020-04-06v3No1 / 185
744amnon high in caecum compared to cloaca in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 187
776amnoncommon gallus gallus, hawaii, chicken, wild, caecum, age 15-20 weeks, feral2021-04-25v3No1 / 191
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
584amnoncommon feces, research facility, rattus norvegicus, sprague dawley, type i diabetes mellitus, rat, china, male, induced type 1 diabetes2020-01-31v3No1 / 202
738amnoncommon gallus gallus, chicken, age 30 days, united kingdom, caecum2021-01-30v3No1 / 202
565amnoncommon zoological garden, skin, captive, canada, ammotragus lervia, african lion safari, barbary sheep2019-11-21v3No1 / 205
603amnonlower in inital batches of baijiu fermentation pit mud ( high in days 180-270 compared to days 0-90 in mud fermentation pit mud china hefei city prefecture baijiu )2020-04-05v3No1 / 205
669amnon high in age 1 year compared to age 2 months in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
780amnon high in caecum compared to small intestine duodenum jejunum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 212
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
584amnoncommon feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 221
666amnoncommon feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 223
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
404amnon high in bogota medellin metropolitan area compared to municipality of santiago de cali bucaramanga barranquilla in feces homo sapiens city adult colombia 2018-11-20v4No1 / 237
666amnoncommon feces, italy, tapirus terrestris, south american tapir2020-09-25v3No1 / 242
617amnoncommon farm, milk, italy, cow milk (fluid), cow milk (raw), lowland pasture, lowland farm2020-05-03v3No1 / 257
744amnon high in cloaca compared to ileum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 265
568amnoncommon feces, gallus gallus, chicken, broiler chicken, viet nam2019-12-08v3No1 / 272
438amnon high in child age 3-6 age 8-12 compared to adult age 30-50 age 60-79 in feces homo sapiens china 2018-12-30v4No1 / 279
744amnon high in caecum compared to ileum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 286
521amnonhigh freq. in weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 288
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in organic fertilized compared to npk fertilized haplic luvisol Switzerland ( high in manured soil manure fertilization organic fertilization bio-dynamic fertilizer compared to npk fertilization mineral fertilization in soil bulk soil switzerland pot expreiment lettuce haplic luvisol therwil )2021-04-07v3No1 / 294
780amnoncommon research facility, gallus gallus, chicken, china, jinzhou city prefecture, caecum2021-04-28v3No1 / 294
737amnoncommon research facility, rumen, age 2 months, ruminal fluid, capra hircus, china, hainan autonomous prefecture, goat, hainan black goat2021-01-27v3No1 / 295
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
666amnoncommon feces, sus scrofa, italy, wild boar2020-09-25v3No1 / 305
565amnoncommon zoological garden, skin, giraffa camelopardalis, giraffe, captive, canada, african lion safari2019-11-21v3No1 / 310
565amnoncommon farm, skin, bos taurus, cow, canada2019-11-21v3No1 / 318
568amnoncommon feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 320
729amnoncommon feces, gorilla gorilla, monkey, wild, cameroon2021-01-05v3No1 / 321
522amnon high in mouse chow age 6 weeks compared to high sugar diet age 18 weeks in feces female research facility mus musculus c57bl/6j germany mouse janvier labs 2019-07-03v3No1 / 325
565amnoncommon farm, skin, canada, equus asinus africanus, donkey2019-11-21v3No1 / 335
729amnoncommon feces, monkey, wild, pan troglodytes troglodytes, cameroon, central chimpanzee2021-01-05v3No1 / 336
666amnoncommon feces, equus caballus, italy, horse2020-09-25v3No1 / 341
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
729amnoncommon feces, zoological garden, monkey, europe, pan troglodytes verus, western chimpanzee2021-01-05v3No1 / 343
776amnoncommon research facility, gallus gallus, hawaii, chicken, captive, broiler chicken, caecum, age 5 weeks2021-04-25v3No1 / 343
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to research facility captive in feces canada province of ontario algonquin provincial park peromyscus maniculatus deer mice age 3-5 weeks )2019-07-28v3No1 / 358
565amnoncommon zoological garden, skin, captive, canada, african lion safari, macropus rufus, red kangaroo2019-11-21v3No1 / 360
565amnoncommon zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 368
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v4No1 / 384
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
561amnon high in green stage diet spring compared to summer grass growth diet in rumen tibetan plateau bos grunniens yak ruminal fluid china alpine meadow 2019-11-05v3No1 / 397
666amnoncommon feces, italy, rat, rattus rattus2020-09-25v3No1 / 406
666amnoncommon feces, italy, lama guanicoe2020-09-25v3No1 / 437
666amnoncommon feces, italy, equus asinus africanus, equus asinus, donkey2020-09-25v3No1 / 450
762sheryocommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common soil, manured soil, rhizosphere, switzerland, thyrow, pot expreiment, manure fertilization, lettuce, organic fertilization, haplic luvisol, bio-dynamic fertilizer)2021-04-08v3No1 / 455
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
787amnoncommon in high grain diet induced subacute acidosis (common research facility, rumen, ruminal fluid, acidosis, capra hircus, china, shanxi province, goat, dairy goat, subacute rumen acidosis)2021-05-23v3No1 / 463
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in feces homo sapiens china )2018-12-30v4No1 / 474
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
666amnoncommon feces, bos taurus, italy, cow2020-09-25v3No1 / 482
617amnonlower in cow milk of cows in alpine pasture compared to lowland farm ( high in lowland pasture lowland farm compared to alpine alpine pasture in farm milk italy cow milk (fluid) cow milk (raw) )2020-05-03v3No1 / 484
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay homosexual msm compared to heterosexual msw in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 519
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 0-90)2020-04-05v3No1 / 542
729amnoncommon feces, zoological garden, gorilla gorilla, monkey, captive, europe2021-01-05v3No1 / 542
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
666amnoncommon feces, italy, vicugna pacos, alpaca2020-09-25v3No1 / 546
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in soil germany thyrow pot expreiment albic luvisol lettuce haplic luvisol )2021-04-08v3No1 / 578
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common soil, manured soil, bulk soil, switzerland, pot expreiment, manure fertilization, lettuce, organic fertilization, haplic luvisol, therwil, bio-dynamic fertilizer, ph 6.6)2021-04-07v3No1 / 602
603amnoncommon in baijiu fermentation pit mud in later batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 180-270)2020-04-05v3No1 / 608
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in feces homo sapiens china )2018-12-30v4No1 / 617
666amnoncommon feces, italy, ovis aries musimon, mouflon2020-09-25v3No1 / 649
561amnoncommon rumen, tibetan plateau, bos grunniens, yak, ruminal fluid, china, alpine meadow2019-11-05v3No1 / 670
565amnoncommon zoological garden, skin, captive, canada, tragelaphus oryx, toronto zoo, eland2019-11-21v3No1 / 674
666amnoncommon feces, italy, capra hircus, goat2020-09-25v3No1 / 674
666amnoncommon feces, italy, equus asinus africanus, african wild ass2020-09-25v3No1 / 683
666amnoncommon feces, ovis aries, italy, sheep2020-09-25v3No1 / 688
787amnoncommon control, research facility, rumen, ruminal fluid, capra hircus, china, shanxi province, goat, dairy goat2021-05-23v3No1 / 700
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common soil, manured soil, bulk soil, germany, thyrow, pot expreiment, manure fertilization, albic luvisol, ph 6.4, lettuce, organic fertilization)2021-04-07v3No1 / 704
666amnoncommon feces, italy, equus ferus, wild horse2020-09-25v3No1 / 715
752sheryoCommon in soil planted with Panax notoginseng (common soil, yunnan province, ph 6, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 730
735amnoncommon female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, restricted feed, sheep, female organism, china2021-01-22v3No1 / 744
735amnoncommon control, female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, sheep, female organism, china2021-01-22v3No1 / 761
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common soil, yunnan province, ph 6, biochar, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 783
649amnon high in colon compared to ileum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 897
701amnoncommon research facility, rumen, bos taurus, male, cow, rumen liquid, male organism, china, municipality of beijing, age 2 years2028-04-01v3No1 / 953
610sheryoCommon in agricultural field soil amended with straw (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, straw)2020-04-21v3No1 / 998
764sheryocommon in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (common soil, triticum aestivum, brassica napus, germany, ph 7.6, bernburg, crop rotation, rapeseed pre-crop)2021-04-12v3No1 / 1129
764sheryoCommon in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, crop rotation, conservation tillage, cultivator tillage)2021-04-12v3No1 / 1140
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, loess chernozem, conventional tillage, mouldboard plough, crop rotation)2021-04-12v3No1 / 1213
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, crop rotation, maize pre-crop)2021-04-12v3No1 / 1225
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261
616amnoncommon in topsoil of non-fertilized sugarcane field (common soil, topsoil, guangzhou city prefecture, non-fertilized soil, depth 0-20cm, china, saccharum, sugarcane, ph 6.7)2020-04-27v3No1 / 1277
696amnon high in alycaeus jagori compared to opisthostoma concinnum plectostoma concinnum in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 1672
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common soil, fertilized soil, topsoil, guangzhou city prefecture, depth 0-20cm, china, saccharum, sugarcane, ph 5.5-6)2020-04-27v3No1 / 1710

Problems / suggestions? Please email info AT dbbact DOT org