Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGGCAAGTCTGATGTGAAAACTTGGGGCTCAACCCCAAGACTGCATTGGAAACTGTTAAGCTAGAGTGCAGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
canis lupus familiaris0.354430
dog0.350674
rectum0.158940
rattus norvegicus0.140351
feces0.131545
felis catus0.130435
state of new york0.122449
united states of america0.122245
rat0.115942
LOWER IN canis lupus0.100000
LOWER IN wolf0.100000
salt0.097561
salt rich diet0.097561
dahl salt-sensitive0.097561
LOWER IN exocrine pancreatic insufficiency0.097561
dog breeding center0.097561
LOWER IN rural community0.093023
cat0.090909
state of colorado0.088889
colon0.087591
homo sapiens0.077381
zoological garden0.076923
adult0.076128
city0.071429
LOWER IN male0.068966
israel0.057971
chronic fatigue syndrome0.051282
new york county0.051282
enzyme supplement0.051282
LOWER IN no enzyme supplement0.051282
exocrine pancreatic insufficiency0.051282
state of louisiana0.051282
usa born0.051282
LOWER IN non usa born0.051282
LOWER IN enzyme supplementation0.051282
city of melbourne0.051282
canis mesomelas0.051282
LOWER IN wildlife sactuary0.051282
LOWER IN peru0.051282
LOWER IN tunapuco0.051282
children0.051282
age >940.051282
LOWER IN age 30-500.051282
LOWER IN age 60-790.051282
hispanic or latin american0.050000
panthera leo0.050000
lion0.050000
namibia0.050000
state of oklahoma0.050000
city of boston0.050000
toronto0.050000
LOWER IN thailand0.050000
sigmoid colon0.050000
european0.050000
LOWER IN asian0.050000
state of alabama0.048780
LOWER IN diarrhea0.048780
canis lupus0.048780
LOWER IN gay0.048780
LOWER IN small village0.048780
inguinal region0.048780
terminal ileum0.048780
caucasian0.048780
state of tennessee0.047619
wolf0.047619
heterosexual0.047619
msw0.047619
LOWER IN homosexual0.047619
LOWER IN msm0.047619
LOWER IN metronidazole0.045455
new york city0.045455
LOWER IN zoological garden0.045455
LOWER IN captive0.045455
body mass index0.045455
state of minnesota0.045455
commonwealth of massachusetts0.045455
biopsy0.045455
LOWER IN low bmi0.043478
LOWER IN duodenum0.042553
LOWER IN crohn's disease0.041667
LOWER IN child0.040816
female0.040816
control0.040282
LOWER IN antibiotic0.040000
LOWER IN ileum0.040000
high bmi0.040000
LOWER IN control diet0.039216
farm0.037383
captive0.037037
research facility0.035556
australia0.034483
LOWER IN female0.033333
state of california0.032787
wild0.032787
skin0.028571
caecum0.027778
male0.025974
china0.023599
LOWER IN control0.009756
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN canis lupus0.666667
LOWER IN wolf0.666667
chronic fatigue syndrome0.500000
new york county0.500000
enzyme supplement0.500000
LOWER IN no enzyme supplement0.500000
exocrine pancreatic insufficiency0.500000
salt0.500000
salt rich diet0.500000
dahl salt-sensitive0.500000
state of louisiana0.500000
usa born0.500000
LOWER IN non usa born0.500000
LOWER IN enzyme supplementation0.500000
LOWER IN exocrine pancreatic insufficiency0.500000
city of melbourne0.500000
dog breeding center0.500000
canis mesomelas0.500000
LOWER IN wildlife sactuary0.500000
LOWER IN peru0.500000
LOWER IN tunapuco0.500000
children0.500000
age >940.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
dog0.350000
canis lupus familiaris0.333333
felis catus0.333333
hispanic or latin american0.333333
panthera leo0.333333
lion0.333333
namibia0.333333
state of oklahoma0.333333
LOWER IN rural community0.333333
city of boston0.333333
toronto0.333333
LOWER IN thailand0.333333
sigmoid colon0.333333
european0.333333
LOWER IN asian0.333333
rectum0.300000
cat0.285714
state of alabama0.250000
LOWER IN diarrhea0.250000
state of new york0.250000
canis lupus0.250000
LOWER IN gay0.250000
state of colorado0.250000
LOWER IN small village0.250000
inguinal region0.250000
terminal ileum0.250000
caucasian0.250000
rattus norvegicus0.200000
state of tennessee0.200000
wolf0.200000
heterosexual0.200000
msw0.200000
LOWER IN homosexual0.200000
LOWER IN msm0.200000
LOWER IN metronidazole0.142857
new york city0.142857
LOWER IN zoological garden0.142857
LOWER IN captive0.142857
body mass index0.142857
state of minnesota0.142857
commonwealth of massachusetts0.142857
biopsy0.142857
zoological garden0.133333
rat0.125000
LOWER IN low bmi0.111111
city0.105263
LOWER IN duodenum0.100000
LOWER IN male0.095238
colon0.095238
LOWER IN crohn's disease0.090909
LOWER IN child0.083333
LOWER IN antibiotic0.076923
LOWER IN ileum0.076923
high bmi0.076923
LOWER IN control diet0.071429
feces0.071186
united states of america0.066946
israel0.062500
captive0.058824
australia0.047619
adult0.044304
homo sapiens0.043478
LOWER IN female0.043478
state of california0.041667
wild0.041667
female0.032787
skin0.030303
farm0.028571
caecum0.028571
male0.025000
control0.023669
research facility0.021277
china0.013245
LOWER IN control0.005952
Fraction of annotations for the query sequences containing the term
TermScore
feces0.864865
united states of america0.702703
canis lupus familiaris0.378378
homo sapiens0.351351
dog0.351351
adult0.270270
control0.135135
research facility0.108108
rattus norvegicus0.108108
rat0.108108
rectum0.108108
china0.108108
felis catus0.081081
state of new york0.081081
colon0.081081
salt0.054054
salt rich diet0.054054
dahl salt-sensitive0.054054
israel0.054054
female0.054054
LOWER IN male0.054054
zoological garden0.054054
LOWER IN exocrine pancreatic insufficiency0.054054
cat0.054054
city0.054054
state of colorado0.054054
farm0.054054
dog breeding center0.054054
LOWER IN canis lupus0.054054
LOWER IN wolf0.054054
LOWER IN rural community0.054054
chronic fatigue syndrome0.027027
LOWER IN control0.027027
new york county0.027027
enzyme supplement0.027027
LOWER IN no enzyme supplement0.027027
exocrine pancreatic insufficiency0.027027
male0.027027
LOWER IN female0.027027
state of alabama0.027027
LOWER IN control diet0.027027
LOWER IN diarrhea0.027027
state of california0.027027
LOWER IN antibiotic0.027027
LOWER IN metronidazole0.027027
state of louisiana0.027027
usa born0.027027
LOWER IN non usa born0.027027
hispanic or latin american0.027027
LOWER IN duodenum0.027027
LOWER IN ileum0.027027
state of tennessee0.027027
panthera leo0.027027
lion0.027027
LOWER IN enzyme supplementation0.027027
australia0.027027
city of melbourne0.027027
new york city0.027027
wild0.027027
captive0.027027
canis lupus0.027027
wolf0.027027
heterosexual0.027027
msw0.027027
LOWER IN gay0.027027
LOWER IN homosexual0.027027
LOWER IN msm0.027027
LOWER IN zoological garden0.027027
LOWER IN captive0.027027
body mass index0.027027
high bmi0.027027
LOWER IN low bmi0.027027
namibia0.027027
canis mesomelas0.027027
LOWER IN wildlife sactuary0.027027
state of minnesota0.027027
state of oklahoma0.027027
LOWER IN peru0.027027
LOWER IN small village0.027027
LOWER IN tunapuco0.027027
commonwealth of massachusetts0.027027
city of boston0.027027
LOWER IN child0.027027
toronto0.027027
skin0.027027
inguinal region0.027027
LOWER IN thailand0.027027
LOWER IN crohn's disease0.027027
caecum0.027027
sigmoid colon0.027027
terminal ileum0.027027
biopsy0.027027
children0.027027
age >940.027027
LOWER IN age 30-500.027027
LOWER IN age 60-790.027027
caucasian0.027027
european0.027027
LOWER IN asian0.027027
Exp. ID User ID Description Date Region Flag Sequences
12amnon high in chronic fatigue syndrome compared to control in feces homo sapiens new york county 2016-11-02v4No1 / 18
150amnonhigh in EPI dogs with enzyme supplement compared to no supplement ( high in enzyme supplement compared to no enzyme supplement in feces united states of america canis lupus familiaris dog exocrine pancreatic insufficiency )2017-04-26v4No1 / 27
651amnon high in male compared to female in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 31
429amnonhigher in salt sensitive rates fed salt rich diet compared to control diet ( high in salt salt rich diet compared to control diet in feces research facility rattus norvegicus dahl salt-sensitive israel rat )2018-12-13v4No1 / 36
16amnon high in control compared to diarrhea in feces felis catus state of california 2016-11-08v4No1 / 51
648amnon high in control compared to antibiotic metronidazole in feces united states of america canis lupus familiaris dog state of louisiana 2020-09-06v4No1 / 56
650amnon high in female compared to male in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 57
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 77
301amnon high in rectum colon compared to duodenum ileum in united states of america canis lupus familiaris dog 2018-03-05v4No1 / 79
399amnoncommon feces, united states of america, state of tennessee, zoological garden, panthera leo, lion2018-11-16v4No1 / 79
231amnoncommon in dog rectum (common feces, united states of america, rectum, canis lupus familiaris, dog)2017-11-02v4No1 / 84
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to enzyme supplementation exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 85
340amnoncommon feces, felis catus, australia, city of melbourne, cat2018-05-27v4No1 / 87
759amnoncommon feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 94
753amnoncommon feces, zoological garden, adult, captive, canis lupus, china, wolf2021-03-12v4No1 / 98
301amnoncommon united states of america, colon, canis lupus familiaris, dog2018-03-05v4No1 / 105
393amnon high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 107
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
436amnoncommon feces, united states of america, felis catus, state of colorado, cat2018-12-25v4No1 / 108
301amnoncommon united states of america, rectum, canis lupus familiaris, dog2018-03-05v4No1 / 116
753amnoncommon feces, farm, adult, canis lupus familiaris, dog, china, dog breeding center2021-03-12v4No1 / 120
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 126
753amnon high in farm canis lupus familiaris dog dog breeding center compared to zoological garden captive canis lupus wolf in feces adult china 2021-03-12v4No1 / 127
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america )2017-04-11v4No1 / 139
15amnoncommon feces, namibia, canis mesomelas2016-11-08v4No1 / 147
759amnon high in canis lupus familiaris dog compared to canis lupus wolf wildlife sactuary in feces united states of america state of minnesota 2021-04-06v4No1 / 148
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
759amnoncommon feces, united states of america, research facility, rattus norvegicus, commonwealth of massachusetts, rat, city of boston2021-04-06v4No1 / 179
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
10amnonpositively correlated with age (6-35) ( high in adult compared to child in feces homo sapiens toronto )2016-10-27v4No1 / 228
429amnoncommon feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, salt, salt rich diet2018-12-13v4No1 / 249
61amnoncommon united states of america, research facility, skin, inguinal region, canis lupus familiaris2017-02-05v4No1 / 327
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v4No1 / 384
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in feces homo sapiens china )2018-12-30v4No1 / 474
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475

Problems / suggestions? Please email info AT dbbact DOT org