Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
feces0.441230
homo sapiens0.438114
adult0.268428
united states of america0.240000
infant0.192771
crohn's disease0.137480
china0.135840
LOWER IN control0.127552
research facility0.126748
mouse0.120396
mus musculus0.114372
child0.094370
ulcerative colitis0.090680
guangzhou city prefecture0.086747
clostridium difficile intestinal infectious disease0.081218
age 1 year0.078049
formula fed0.076555
hospital0.075591
germany0.074303
biopsy0.071869
control0.070636
c57bl/60.068834
canada0.066390
terminal ileum0.062176
rectum0.060000
obsolete_juvenile stage0.060000
australia0.059829
farm0.059829
city0.057748
taconic farms0.057416
age 8 weeks0.057416
age < 3 years0.051948
wild0.051502
finland0.049383
state of georgia0.049383
diarrhea0.048780
state of california0.046512
italy0.046512
kingdom of spain0.045802
sigmoid colon0.041885
clostridium difficile infection0.041451
seattle0.041451
colonized germ free0.041451
female0.040650
antibiotic0.040201
rat0.038772
sus scrofa0.038772
pig0.038772
colon0.035242
caecum0.034532
biopsy site0.031746
state of oklahoma0.031662
tucson0.031414
phascolarctos cinereus0.031414
koala0.031414
cape otway0.031414
nanning city prefecture0.031414
age 50-60 years0.031414
LOWER IN rural community0.031414
age 1 month0.031169
juvenile organism0.030928
LOWER IN breast fed0.030928
hispanic or latin american0.030928
LOWER IN jackson laboratories0.030457
state of michigan0.030227
rattus norvegicus0.030000
c57bl/6j0.030000
monkey0.030000
jackson laboratories0.029557
age 3 months0.029126
age0.029126
LOWER IN male0.029126
jiangsu province0.029126
state of new york0.028708
captive0.028504
LOWER IN age 2 months0.021277
age 3-5 weeks0.021277
irritable bowel syndrome0.021164
after hcst0.021164
hematopoietic stem cell transplant0.021164
schizophrenia0.021164
breast fed0.021164
inflammatory bowel disease0.021164
LOWER IN vancomycin0.021164
valladolid0.021164
oslo0.021164
cftr s489x0.021164
age 7 months0.021164
eucalyptus viminalis diet0.021164
juvenile0.021164
acute pancreatitis0.021164
pancreatitis0.021164
stroke0.021164
children0.021164
age > 1 year0.021164
age one year0.021164
nephrolithiasis0.021164
rhesus macaque0.021164
equine grass sickness0.021164
age 3-60.021164
Fraction of dbbact annotations with this term covered by the query
TermScore
biopsy site0.750000
crohn's disease0.750000
terminal ileum0.750000
biopsy0.714286
ulcerative colitis0.666667
clostridium difficile intestinal infectious disease0.666667
age < 3 years0.666667
sigmoid colon0.666667
LOWER IN age 2 months0.666667
state of oklahoma0.666667
age 3-5 weeks0.666667
irritable bowel syndrome0.500000
acquired immunodeficiency syndrome0.500000
after hcst0.500000
hematopoietic stem cell transplant0.500000
tucson0.500000
schizophrenia0.500000
LOWER IN age 7 months0.500000
breast fed0.500000
inflammatory bowel disease0.500000
before antibiotics0.500000
LOWER IN vancomycin0.500000
LOWER IN amoxicillin0.500000
LOWER IN doxycycline0.500000
acute severe colitis0.500000
clostridium difficile infection0.500000
valladolid0.500000
chronic fatigue syndrome0.500000
new york county0.500000
LOWER IN age 30-400.500000
oslo0.500000
seattle0.500000
cftr s489x0.500000
colonized germ free0.500000
age 7 months0.500000
mammalian milk beverage0.500000
eucalyptus viminalis0.500000
eucalyptus viminalis diet0.500000
LOWER IN eucalyptus obliqua diet0.500000
LOWER IN eucalyptus obliqua0.500000
phascolarctos cinereus0.500000
koala0.500000
cape otway0.500000
juvenile0.500000
acute pancreatitis0.500000
pancreatitis0.500000
stroke0.500000
before hsct0.500000
low fiber0.500000
children0.500000
age > 1 year0.500000
LOWER IN estonia0.500000
age one year0.500000
cefoperazone0.500000
nephrolithiasis0.500000
nanning city prefecture0.500000
age 50-60 years0.500000
little physical activity0.500000
LOWER IN physical activity0.500000
rhesus macaque0.500000
cheyenne0.500000
native american0.500000
arapaho0.500000
equine grass sickness0.500000
non-steroidal anti-inflammatory drug0.500000
indomethacin0.500000
adriatic sea coastal waters of italy0.500000
caretta caretta0.500000
loggerhead sea turtle0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
eucalyptus obliqua diet0.500000
usa born0.500000
LOWER IN non usa born0.500000
high fat diet + inulin0.500000
denver0.500000
trachemys scripta elegans0.500000
red-eared slider turtle0.500000
turtle farm0.500000
LOWER IN egypt0.500000
perianal skin0.500000
urocyon littoralis0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
LOWER IN bacterial vaginosis0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age >940.500000
age 13-140.500000
LOWER IN mexico0.500000
hmong0.500000
LOWER IN myanmar0.500000
LOWER IN karen0.500000
LOWER IN russia0.500000
LOWER IN plant diet0.500000
age<17 years0.500000
LOWER IN peru0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.875676
homo sapiens0.756757
united states of america0.378378
adult0.340541
china0.189189
research facility0.156757
infant0.129730
LOWER IN control0.124324
mus musculus0.102703
mouse0.102703
crohn's disease0.075676
control0.070270
germany0.064865
child0.059459
ulcerative colitis0.048649
guangzhou city prefecture0.048649
c57bl/60.048649
hospital0.043243
clostridium difficile intestinal infectious disease0.043243
age 1 year0.043243
formula fed0.043243
canada0.043243
biopsy0.037838
australia0.037838
farm0.037838
wild0.032432
terminal ileum0.032432
city0.032432
rectum0.032432
obsolete_juvenile stage0.032432
taconic farms0.032432
age 8 weeks0.032432
state of california0.027027
kingdom of spain0.027027
italy0.027027
diarrhea0.027027
finland0.027027
age < 3 years0.027027
state of georgia0.027027
female0.027027
antibiotic0.021622
clostridium difficile infection0.021622
seattle0.021622
colonized germ free0.021622
sigmoid colon0.021622
rat0.021622
caecum0.021622
colon0.021622
sus scrofa0.021622
pig0.021622
tucson0.016216
biopsy site0.016216
state of michigan0.016216
age 3 months0.016216
phascolarctos cinereus0.016216
koala0.016216
cape otway0.016216
juvenile organism0.016216
rattus norvegicus0.016216
LOWER IN breast fed0.016216
age0.016216
c57bl/6j0.016216
state of new york0.016216
nanning city prefecture0.016216
age 50-60 years0.016216
LOWER IN male0.016216
age 1 month0.016216
monkey0.016216
captive0.016216
state of oklahoma0.016216
hispanic or latin american0.016216
jackson laboratories0.016216
LOWER IN jackson laboratories0.016216
jiangsu province0.016216
LOWER IN rural community0.016216
irritable bowel syndrome0.010811
after hcst0.010811
hematopoietic stem cell transplant0.010811
schizophrenia0.010811
LOWER IN feces0.010811
state of minnesota0.010811
breast fed0.010811
inflammatory bowel disease0.010811
commonwealth of pennsylvania0.010811
LOWER IN antibiotic0.010811
LOWER IN vancomycin0.010811
LOWER IN metronidazole0.010811
valladolid0.010811
systemic lupus erythematosus0.010811
commonwealth of virginia0.010811
remission0.010811
LOWER IN adult0.010811
kingdom of norway0.010811
oslo0.010811
clostridium difficile colitis0.010811
cystic fibrosis0.010811
cftr s489x0.010811
age 7 months0.010811
eucalyptus viminalis diet0.010811
green turtle0.010811
Exp. ID User ID Description Date Region Flag Sequences
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in feces research facility antibiotic mus musculus israel mouse )2018-10-23v4No1 / 3
394amnon high in ulcerative colitis compared to control in feces homo sapiens united states of america adult state of california 2018-11-06v4No1 / 8
294amnon high in irritable bowel syndrome compared to control in feces homo sapiens adult kingdom of spain 2018-02-09v4No1 / 9
629amnon high in hiv infection acquired immunodeficiency syndrome compared to control in feces homo sapiens adult kingdom of the netherlands amsterdam 2020-05-31v4No1 / 10
655amnoncommon in patients after hematopoietic stem cell transplant (common feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No1 / 10
689amnoncommon feces, homo sapiens, united states of america, hospital, adult, non c. diff diarrhea, tucson2028-03-11v4No1 / 12
502amnon high in schizophrenia compared to control in feces homo sapiens united states of america adult 2019-03-12v4No1 / 13
51amnonlower in stool compared to biopsies ( high in biopsy site biopsy compared to feces in homo sapiens united states of america )2017-01-19v4No1 / 14
185amnoncommon in patients with c. diff infection before treatment (common feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
779amnon high in crohn's disease compared to control in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 15
797amnon high in age 1 year compared to age 7 months in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 15
94amnoncommon feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child inflammatory bowel disease crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
659amnon high in before antibiotics compared to antibiotic vancomycin metronidazole amoxicillin doxycycline in feces homo sapiens ulcerative colitis child acute severe colitis 2020-09-19v4No1 / 16
728amnoncommon feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 16
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v4No1 / 17
12amnon high in chronic fatigue syndrome compared to control in feces homo sapiens new york county 2016-11-02v4No1 / 18
713amnondominant feces, homo sapiens, remission, crohn's disease2028-05-21v3No1 / 18
330amnon high in infant age 1 year compared to adult age 30-40 in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 19
689amnoncommon feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 19
292amnondominant feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 20
619amnondominant feces, united states of america, research facility, mus musculus, mouse, cystic fibrosis, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 20
797amnondominant feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 20
797amnondominant feces, homo sapiens, infant, germany, age 3 months, formula fed2021-06-13v3No1 / 20
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in feces homo sapiens infant )2016-12-01v4No1 / 21
779amnondominant feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 21
728amnondominant feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 21
94amnondominant feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (dominant feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
689amnondominant feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 22
779amnoncommon feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 22
619amnondominant feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 22
655amnondominant in patients after hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No1 / 22
713amnoncommon feces, homo sapiens, remission, crohn's disease2028-05-21v3No1 / 22
241amnoncommon in babies age < 3 years in finland (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 23
779amnondominant feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, age 1 year, formula fed2021-06-13v3No1 / 23
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in feces homo sapiens hospital australia diarrhea )2018-11-04v4No1 / 24
541amnonlower in koalas eating Eucalyptus obliqua leaves comapred to Eucalyptus viminalis ( high in eucalyptus viminalis eucalyptus viminalis diet compared to eucalyptus obliqua diet eucalyptus obliqua in feces australia wild phascolarctos cinereus koala cape otway )2019-08-01v4No1 / 24
641amnoncommon feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
641amnondominant feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
395amnoncommon feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 25
428amnoncommon feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 25
779amnoncommon feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 25
714amnondominant homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 25
399amnondominant feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v4No1 / 27
399amnon high in crohn's disease compared to control in feces homo sapiens united states of america 2018-11-16v4No1 / 27
320amnoncommon feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 30
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in feces homo sapiens adult guangzhou city prefecture china )2018-05-15v4No1 / 30
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 31
655amnoncommon in patients before hematopoietic stem cell transplant (common feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 31
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 31
404amnonnegatively correlated with fiber intake ( high in low fiber compared to high fiber plant fiber cell in feces homo sapiens city adult colombia )2018-11-20v4No1 / 32
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 34
284amnon high in age 1 year compared to age 2 months in feces homo sapiens female infant state of california 2018-01-27v4No1 / 35
669amnoncommon feces, homo sapiens, infant, sweden, age 1 year2020-09-26v4No1 / 35
240amnoncommon in infants age <3 years (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 36
233amnon high in age age > 1 year compared to age < 1 year in feces homo sapiens united states of america infant 2017-11-05v4No1 / 37
390amnoncommon feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 38
330amnoncommon feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 39
797amnon high in age 3 months compared to age 1 month in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 39
19amnoncommon in biopsies of children (IBD study) (common homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 40
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
36amnoncommon feces, homo sapiens, sichuan province2016-12-06v4No1 / 44
241amnonhigher in babies from finland compared to estonia ( high in finland compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 45
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one year2018-01-14v4No1 / 46
428amnon high in acute pancreatitis pancreatitis compared to control in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 46
591amnoncommon feces, homo sapiens, united states of america, adult, age 50-80 years, parkinson's disease2020-02-17v4No1 / 47
779amnoncommon feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 47
651amnoncommon feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 49
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 50
797amnoncommon feces, homo sapiens, child, germany, breast fed, age 2 years2021-06-13v3No1 / 50
650amnoncommon feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 52
797amnon high in infant age 1 year compared to child age 2 years in feces homo sapiens germany formula fed 2021-06-13v3No1 / 52
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in feces homo sapiens adult nanning city prefecture age 50-60 years china )2018-01-27v4No1 / 54
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
368amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
591amnoncommon feces, homo sapiens, control, united states of america, adult, age 50-80 years2020-02-17v4No1 / 56
650amnon high in female compared to male in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 57
651amnoncommon feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 58
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 59
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
619amnoncommon feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 61
502amnoncommon feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 63
671amnon high in age 1 month compared to age 3 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 64
619amnoncommon feces, united states of america, research facility, cystic fibrosis, mus musculus, mouse, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 64
242amnoncommon in native-americans (common feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 65
448amnoncommon feces, farm, equus caballus, horse, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 65
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
644amnon high in female compared to male in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v4No1 / 69
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 1 month 2021-06-13v3No1 / 69
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in non-steroidal anti-inflammatory drug indomethacin compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 72
448amnon high in equine grass sickness disease compared to control in feces farm equus caballus horse united kingdom 2019-01-08v4No1 / 72
541amnoncommon feces, australia, wild, phascolarctos cinereus, koala, cape otway, eucalyptus viminalis diet2019-08-01v4No1 / 72
810amnoncommon in sea turtle feces from sea turtle rescue center (common feces, research facility, mediterranean sea, italy, adriatic sea coastal waters of italy, caretta caretta, loggerhead sea turtle)2021-06-22v3No1 / 72
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 3 months 2021-06-13v3No1 / 75
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in feces homo sapiens china )2018-12-30v4No1 / 76
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 77
541amnoncommon feces, australia, wild, phascolarctos cinereus, koala, cape otway, eucalyptus obliqua diet2019-08-01v4No1 / 77
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 77
589amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, state of georgia, mouse, jackson laboratories, high fat diet + inulin2020-02-10v4No1 / 78
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic ampicillin neomycin compared to control in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 80
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
590amnoncommon farm, intestine, age 3-5 weeks, china, hainan autonomous prefecture, trachemys scripta elegans, red-eared slider turtle, turtle farm2020-02-10v4No1 / 83
249amnoncommon feces, homo sapiens, united states of america2017-11-22v4No1 / 86
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
582amnoncommon united states of america, rectum, wild, perianal skin, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 88
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
538amnon high in taconic farms compared to jackson laboratories in research facility ileum mus musculus c57bl/6 terminal ileum canada mouse age 8 weeks 2019-07-29v4No1 / 104
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
538amnon high in taconic farms compared to jackson laboratories in research facility colon right colon mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 108
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china2018-12-30v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy site biopsy compared to feces in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 118
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
538amnoncommon feces, research facility, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 120
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china2018-12-30v4No1 / 121
538amnoncommon research facility, colon, right colon, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 130
538amnoncommon research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 132
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
644amnonlower in individuals born in mexico compared to cuba ( high in cuba compared to mexico in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
538amnon high in taconic farms compared to jackson laboratories in feces research facility mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 135
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 148
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in feces homo sapiens united states of america )2017-02-27v4No1 / 149
589amnoncommon feces, united states of america, research facility, mus musculus, low fat diet, c57bl/6, state of georgia, mouse, mouse chow, jackson laboratories2020-02-10v4No1 / 151
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
123amnon high in diet high fat diet compared to normal diet mouse chow in feces united states of america research facility mus musculus c57bl/6j mouse 2017-04-13v4No1 / 170
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in feces farm sus scrofa jinhua city prefecture pig jinhua pig china )2018-12-06v4No1 / 171
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common feces, united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of georgia, mouse, jackson laboratories)2020-02-10v4No1 / 172
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
179amnoncommon united states of america, research facility, oral cavity, mus musculus, balb/c, mouse, mouth2017-08-13v4No1 / 183
399amnoncommon feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v4No1 / 184
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
197amnon high in india compared to finland in feces homo sapiens juvenile organism obsolete_juvenile stage age 13 2017-09-12v4No1 / 189
389amnon high in age 1-3 weeks compared to age 4 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 189
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
669amnon high in age 1 year compared to age 2 months in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v3No1 / 214
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 217
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
25amnon high in antibiotic compared to control in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v4No1 / 231
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, age 50-60 years, nephrolithiasis, china)2018-01-27v4No1 / 239
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, age 50-60 years, china)2018-01-27v4No1 / 281
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 347
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to research facility captive in feces canada province of ontario algonquin provincial park peromyscus maniculatus deer mice age 3-5 weeks )2019-07-28v3No1 / 358
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v4No1 / 384
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 400
666amnoncommon feces, italy, rat, rattus rattus2020-09-25v3No1 / 406
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in feces homo sapiens china )2018-12-30v4No1 / 474
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
657amnoncommon research facility, rumen, ovis aries, qinghai province, rumen liquid, age < 1 year, sheep, lamb, china2020-09-13v4No1 / 517
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
372amnon high in mouse chow compared to high fat diet in feces united states of america research facility mus musculus mouse 2018-09-07v4No1 / 579
729amnon high in zoological garden captive europe compared to wild cameroon in feces gorilla gorilla monkey 2021-01-05v3No1 / 656
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic)2017-11-22v4No1 / 1081

Problems / suggestions? Please email info AT dbbact DOT org