Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGTGACTGCATTGGAAACTGTTTTGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
feces0.461285
homo sapiens0.457788
adult0.375000
united states of america0.144410
child0.142082
control0.140140
china0.129032
city0.114074
kingdom of spain0.090452
female0.089114
sus scrofa0.086799
obsolete_juvenile stage0.075134
male0.070485
LOWER IN crohn's disease0.068966
italy0.068085
obesity0.067644
pig0.065862
wild0.063927
age 30-500.058651
jiangsu province0.058537
amsterdam0.057803
research facility0.057207
rural community0.056980
kingdom of the netherlands0.056180
high bmi0.055788
captive0.052265
infant0.051813
germany0.049669
heterosexual0.047151
msw0.047151
lake hulun0.046784
monkey0.045369
state of new york0.044693
mongolia0.043716
sweden0.042328
israel0.041026
caecum0.040404
estonia0.035821
wild boar0.035821
nanning city prefecture0.035503
age 50-60 years0.035503
age 60-790.035503
LOWER IN infant0.034884
rectum0.034682
winter0.034632
biopsy0.034582
new zealand0.034286
belgium0.034286
india0.034286
south korea0.034091
cat0.032609
zoological garden0.032345
rat0.032086
felis catus0.031579
canada0.030848
farm0.027842
overweight body mass index status0.024096
metabolic syndrome0.024096
village0.024096
panthera tigris0.023952
tiger0.023952
vulpes vulpes0.023952
red fox0.023952
vulpes corsac0.023952
corsac fox0.023952
age 4-10 years0.023952
municipality of logrono0.023952
age >940.023952
glasgow0.023952
rhesus macaque0.023952
toronto zoo0.023952
small village0.023952
age 130.023952
weaned0.023952
corn and soybean diet0.023952
age 4-7 weeks0.023952
chuquisaca department0.023952
age 1 month0.023810
wastewater treatment plant0.023810
toronto0.023669
LOWER IN age 3 months0.023669
asian0.023669
food allergy0.023669
nanchang city prefecture0.023669
state of oklahoma0.023669
homosexual0.023669
msm0.023669
LOWER IN rural community0.023669
LOWER IN age < 1 year0.023669
south america0.023669
age 5-13 years0.023669
kingdom of denmark0.023529
biopsy site0.023392
LOWER IN ulcerative colitis0.023392
state of alabama0.023392
jiangxi province0.023392
bolivia0.023392
LOWER IN hiv infection0.023256
state of michigan0.023256
guangzhou city prefecture0.023121
Fraction of dbbact annotations with this term covered by the query
TermScore
age 30-500.666667
overweight body mass index status0.666667
estonia0.666667
metabolic syndrome0.666667
village0.666667
wild boar0.666667
heterosexual0.600000
msw0.600000
LOWER IN crohn's disease0.545455
panthera tigris0.500000
tiger0.500000
salmonella gastroenteritis0.500000
LOWER IN clostridium difficile intestinal infectious disease0.500000
vulpes vulpes0.500000
lake hulun0.500000
red fox0.500000
vulpes corsac0.500000
corsac fox0.500000
low human contact0.500000
zambia0.500000
papio kindae0.500000
kinda baboon0.500000
LOWER IN chronic fatigue syndrome0.500000
new york county0.500000
age 50-70 years0.500000
age 7 months0.500000
amsterdam0.500000
midwest region0.500000
jordan0.500000
santa catarina state0.500000
LOWER IN insomnia0.500000
sri lanka0.500000
age 1-18 years0.500000
age 17-290.500000
age 4-10 years0.500000
sesame allergy0.500000
LOWER IN nephrolithiasis0.500000
nanning city prefecture0.500000
age 50-60 years0.500000
novosibirsk0.500000
age 200.500000
LOWER IN egypt0.500000
metabolic syndrome x0.500000
caribbean latino0.500000
felis silvestris0.500000
wild cat0.500000
LOWER IN age 4 months0.500000
milk allergy0.500000
hmong0.500000
azerbaijan0.500000
third trimester0.500000
age 8-120.500000
cornell university0.500000
age 3-60.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
age 60-790.500000
LOWER IN human immunodeficiency virus infectious disease0.500000
LOWER IN antiretroviral therapy0.500000
municipality of logrono0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
irritable bowel syndrome0.500000
age >940.500000
glasgow0.500000
gaz:000521000.500000
myanmar0.500000
karen0.500000
upano valley0.500000
LOWER IN cross-cutucu0.500000
shuar population0.500000
age 13-140.500000
rem sleep behavior disorder0.500000
farm 20.500000
LOWER IN farm 10.500000
jinhua city prefecture0.500000
jinhua pig0.500000
LOWER IN cuba0.500000
LOWER IN state of california0.500000
rhesus macaque0.500000
age 30-400.500000
oslo0.500000
toronto zoo0.500000
yaounde0.500000
el salvador0.500000
small village0.500000
LOWER IN peru0.500000
LOWER IN tunapuco0.500000
LOWER IN russia0.500000
age 130.500000
LOWER IN sewer0.500000
low income0.500000
spondyloarthritis0.500000
spondylitis0.500000
republic of congo0.500000
nouabale-ndoki national park0.500000
induced type 1 diabetes0.500000
LOWER IN age >940.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.914110
homo sapiens0.779141
adult0.460123
united states of america0.214724
china0.184049
control0.171779
child0.098160
female0.067485
research facility0.067485
city0.067485
kingdom of spain0.055215
male0.049080
italy0.049080
sus scrofa0.049080
wild0.042945
obsolete_juvenile stage0.042945
obesity0.036810
LOWER IN crohn's disease0.036810
jiangsu province0.036810
pig0.036810
age 30-500.030675
high bmi0.030675
germany0.030675
infant0.030675
kingdom of the netherlands0.030675
amsterdam0.030675
rural community0.030675
captive0.030675
mongolia0.024540
winter0.024540
lake hulun0.024540
sweden0.024540
heterosexual0.024540
msw0.024540
monkey0.024540
state of new york0.024540
israel0.024540
caecum0.024540
felis catus0.018405
new zealand0.018405
cat0.018405
south korea0.018405
estonia0.018405
nanning city prefecture0.018405
age 50-60 years0.018405
biopsy0.018405
belgium0.018405
age 60-790.018405
farm0.018405
LOWER IN infant0.018405
zoological garden0.018405
canada0.018405
india0.018405
rat0.018405
rectum0.018405
wild boar0.018405
LOWER IN female0.012270
toronto0.012270
panthera tigris0.012270
tiger0.012270
guangzhou city prefecture0.012270
hospital0.012270
australia0.012270
diarrhea0.012270
vulpes vulpes0.012270
red fox0.012270
vulpes corsac0.012270
corsac fox0.012270
overweight body mass index status0.012270
LOWER IN age 3 months0.012270
asian0.012270
brazil0.012270
LOWER IN hiv infection0.012270
state of michigan0.012270
food allergy0.012270
age 4-10 years0.012270
metabolic syndrome0.012270
nanchang city prefecture0.012270
thailand0.012270
biopsy site0.012270
czech republic0.012270
pregnancy0.012270
state of california0.012270
state of oklahoma0.012270
LOWER IN ulcerative colitis0.012270
municipality of logrono0.012270
age >940.012270
glasgow0.012270
village0.012270
homosexual0.012270
msm0.012270
macaca mulatta0.012270
age 1 month0.012270
rhesus macaque0.012270
skin0.012270
toronto zoo0.012270
small village0.012270
united kingdom0.012270
LOWER IN rural community0.012270
juvenile organism0.012270
Exp. ID User ID Description Date Region Flag Sequences
10amnon high in male compared to female in feces homo sapiens toronto 2016-10-27v4No1 / 11
666amnondominant feces, italy, panthera tigris, tiger2020-09-25v3No1 / 13
707amnon high in control compared to systemic lupus erythematosus in feces homo sapiens female adult guangzhou city prefecture age 30-50 china 2028-04-11v3No1 / 19
390amnondominant feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 20
390amnonlower in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in non c. diff diarrhea compared to clostridium difficile intestinal infectious disease in feces homo sapiens hospital australia diarrhea )2018-11-04v4No1 / 23
815amnondominant feces, mongolia, winter, wild, vulpes vulpes, lake hulun, red fox2021-07-04v3No1 / 24
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 26
815amnondominant feces, mongolia, winter, wild, lake hulun, vulpes corsac, corsac fox2021-07-04v3No1 / 27
293amnonlower in lean participants in human feces ( high in high bmi compared to low bmi in feces homo sapiens united states of america adult )2018-02-07v4No1 / 29
668amnondominant feces, research facility, felis catus, new zealand, cat2020-09-26v3No1 / 29
411amnonlower in wild baboons feeding on discarded human foods ( high in low human contact compared to human contact in feces zambia monkey wild papio kindae kinda baboon )2018-11-23v4No1 / 33
12amnon high in control compared to chronic fatigue syndrome in feces homo sapiens new york county 2016-11-02v4No1 / 35
814amnonlower after 2 months of caloric restriction diet ( high in control diet compared to caloric restriction diet in feces homo sapiens female obesity adult obese body mass index status germany high bmi overweight body mass index status age 50-70 years )2021-06-30v4No1 / 37
681amnoncommon feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 37
666amnoncommon feces, italy, panthera tigris, tiger2020-09-25v3No1 / 43
797amnon high in age 7 months compared to age 3 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 44
730amnon high in control compared to crohn's disease in feces homo sapiens child kingdom of the netherlands amsterdam 2021-01-05v1No1 / 52
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
650amnoncommon feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 66
365amnoncommon feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 67
757amnoncommon feces, homo sapiens, adult, brazil, santa catarina state2021-03-28v3No1 / 67
22amnon high in control compared to hiv infection in feces homo sapiens united states of america 2016-11-28v4No1 / 70
566amnon high in control compared to insomnia in feces homo sapiens adult china 2019-11-24v4No1 / 71
656amnoncommon feces, homo sapiens, sri lanka, age 1-18 years2020-09-13v3No1 / 71
650amnonnegatively correlated with BMI ( high in low bmi compared to body mass index high bmi in feces homo sapiens united states of america adult state of new york )2020-09-09v4No1 / 75
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, age 17-292019-02-13v4No1 / 76
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 80
643amnoncommon feces, homo sapiens, adult, south korea2020-08-30v4No1 / 81
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, china2028-04-11v3No1 / 82
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in feces homo sapiens adult nanning city prefecture age 50-60 years china )2018-01-27v4No1 / 83
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
668amnoncommon feces, research facility, felis catus, new zealand, cat2020-09-26v3No1 / 85
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, age 202018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
487amnoncommon feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 88
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 89
803amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, age 50-80 years, caribbean latino2021-06-18v4No1 / 89
666amnoncommon feces, italy, felis silvestris, wild cat2020-09-25v3No1 / 91
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
668amnon high in age 5 years compared to age 4 months in feces research facility felis catus new zealand cat 2020-09-26v3No1 / 92
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
400amnoncommon in hmong (chinese) females from thailand (common feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 95
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 97
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 97
730amnoncommon feces, homo sapiens, control, child, kingdom of the netherlands, amsterdam2021-01-05v1No1 / 97
532amnoncommon feces, homo sapiens, control, adult, czech republic2019-07-21v1No1 / 98
477amnoncommon feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 103
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
693amnoncommon feces, homo sapiens, female, adult, austria, graz city district2028-03-16v1No1 / 104
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china2018-12-30v4No1 / 106
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
409amnoncommon feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 108
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in feces homo sapiens united states of america child )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 60-79, china2018-12-30v4No1 / 111
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
794amnon high in control compared to hiv infection human immunodeficiency virus infectious disease antiretroviral therapy in feces homo sapiens adult kingdom of spain municipality of logrono 2021-06-08v4No1 / 112
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 30-50, china2018-12-30v4No1 / 115
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china2018-12-30v4No1 / 121
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to child obsolete_juvenile stage crohn's disease in feces homo sapiens glasgow )2017-02-26v4No1 / 125
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 125
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
660amnonlower in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in upano valley compared to cross-cutucu in feces homo sapiens ecuador rural community village shuar population )2020-09-20v4No1 / 132
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 132
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 2 compared to farm 1 in feces farm sus scrofa jinhua city prefecture pig jinhua pig china )2018-12-06v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 136
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 140
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 141
330amnon high in adult age 30-40 compared to infant age 1 year in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 145
815amnoncommon feces, mongolia, winter, wild, lake hulun, vulpes corsac, corsac fox2021-07-04v3No1 / 146
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
565amnoncommon zoological garden, skin, panthera leo, lion, captive, canada, toronto zoo2019-11-21v3No1 / 150
594amnoncommon feces, homo sapiens, city, adult, cameroon, yaounde2020-03-12v4No1 / 154
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
815amnoncommon feces, mongolia, winter, wild, vulpes vulpes, lake hulun, red fox2021-07-04v3No1 / 160
292amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens adult china 2018-02-05v4No1 / 161
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
700amnoncommon feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 164
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, age 13, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in feces homo sapiens infant )2017-11-13v4No1 / 173
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to wastewater treatment plant sewer in city south america low income )2017-01-21v4No1 / 187
197amnon high in india compared to finland in feces homo sapiens juvenile organism obsolete_juvenile stage age 13 2017-09-12v4No1 / 189
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
620amnoncommon feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 197
584amnoncommon feces, research facility, rattus norvegicus, sprague dawley, type i diabetes mellitus, rat, china, male, induced type 1 diabetes2020-01-31v3No1 / 202
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in feces homo sapiens china )2018-12-30v4No1 / 203
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
669amnon high in age 1 year compared to age 2 months in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
584amnoncommon feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 221
666amnoncommon feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 223
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, age 50-60 years, nephrolithiasis, china)2018-01-27v4No1 / 239
666amnoncommon feces, italy, tapirus terrestris, south american tapir2020-09-25v3No1 / 242
398amnon high in control compared to crohn's disease in feces homo sapiens belgium 2018-11-15v4No1 / 248
776amnon high in research facility captive broiler chicken age 5 weeks compared to wild age 15-20 weeks feral in gallus gallus hawaii chicken caecum 2021-04-25v3No1 / 252
63amnon high in male compared to female in feces homo sapiens united states of america 2017-12-04v4No1 / 262
759amnon high in state of alabama wild wild boar compared to farm pig state of vermont in feces united states of america sus scrofa 2021-04-04v4No1 / 268
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, age 50-60 years, china)2018-01-27v4No1 / 281
744amnon high in caecum compared to ileum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 286
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
666amnoncommon feces, sus scrofa, italy, wild boar2020-09-25v3No1 / 305
723amnon high in age 2-4 years compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in feces homo sapiens adult czech republic 2019-07-21v1No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
729amnoncommon feces, zoological garden, monkey, europe, pan troglodytes verus, western chimpanzee2021-01-05v3No1 / 343
759amnoncommon feces, united states of america, sus scrofa, state of alabama, wild, wild boar2021-04-04v4No1 / 362
565amnoncommon zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 368
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
666amnoncommon feces, italy, rat, rattus rattus2020-09-25v3No1 / 406
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
339amnon high in adult compared to infant age < 1 year in feces homo sapiens india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
111amnon high in rectum caecum colon ileum compared to ruminant reticulum omasum rumen in ovis aries mongolian sheep china 2017-04-09v4No1 / 464
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in feces homo sapiens china )2018-12-30v4No1 / 617
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned corn and soybean diet age 4-7 weeks compared to suckling preweaned age 2-4 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 681
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
671amnon high in age 8 months compared to age 3 months age 6 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 955

Problems / suggestions? Please email info AT dbbact DOT org