Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTAAAGCAAGTCTGAAGTGAAAGCCCGCGGCTCAACTGCGGGACTGCTTTGGAAACTGTTTAACTGGAGTGTCGGAGAGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
feces0.331105
homo sapiens0.317135
infant0.236686
adult0.196607
united states of america0.170644
germany0.147757
formula fed0.120301
crohn's disease0.113821
china0.112525
mouse0.091324
farm0.089385
research facility0.088971
terminal ileum0.086455
mus musculus0.085837
clostridium difficile intestinal infectious disease0.085837
child0.083333
biopsy0.082873
female0.082353
age 1 year0.079576
LOWER IN control0.079422
LOWER IN male0.076923
italy0.071942
LOWER IN rural community0.069565
sigmoid colon0.069565
seattle0.068376
colonized germ free0.068376
adula0.068376
snake farm0.068376
taconic farms0.068376
LOWER IN jackson laboratories0.068376
obsolete_juvenile stage0.067227
snake0.066116
hospital0.065395
rectum0.065395
age0.061538
city0.059553
hunan province0.058394
LOWER IN small village0.053097
canada0.052980
remission0.052863
clostridium difficile infection0.052174
age 1 month0.051502
LOWER IN breast fed0.050847
age < 3 years0.050847
state of georgia0.050209
finland0.050209
age 8 weeks0.049587
monkey0.048387
age 3 months0.046154
LOWER IN adult0.045455
state of california0.045113
captive0.044610
colon0.042705
c57bl/60.037500
caecum0.037152
LOWER IN age 2 months0.035714
age 3-5 weeks0.035714
after hcst0.035398
hematopoietic stem cell transplant0.035398
breast fed0.035398
valladolid0.035398
cftr s489x0.035398
age 7 months0.035398
juvenile0.035398
children0.035398
age > 1 year0.035398
age one year0.035398
rhesus macaque0.035398
LOWER IN russia0.035398
suckling0.035398
preweaned0.035398
age 2-4 weeks0.035398
nanning city prefecture0.035398
age 50-60 years0.035398
parkinson's disease0.035088
guangzhou city prefecture0.035088
green turtle0.034783
chelonia mydas0.034783
LOWER IN age &lt; 1 year0.034783
diarrhea0.034188
systemic lupus erythematosus0.034188
state of alabama0.034188
jiangxi province0.034188
ulcerative colitis0.033898
commonwealth of virginia0.033613
cystic fibrosis0.033613
rural community0.033613
juvenile organism0.033058
macaca mulatta0.033058
LOWER IN control diet0.032520
kingdom of denmark0.032520
state of new york0.032000
rat0.032000
control0.031226
LOWER IN feces0.030769
diet0.030075
wild0.030075
sus scrofa0.028369
pig0.028369
kingdom of spain0.026846
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN small village0.750000
terminal ileum0.750000
clostridium difficile intestinal infectious disease0.666667
LOWER IN rural community0.666667
remission0.666667
sigmoid colon0.666667
LOWER IN age 2 months0.666667
age 3-5 weeks0.666667
rem sleep behavior disorder0.500000
after hcst0.500000
hematopoietic stem cell transplant0.500000
schizophrenia0.500000
LOWER IN age 7 months0.500000
breast fed0.500000
clostridium difficile infection0.500000
valladolid0.500000
icr/cd-1 mice0.500000
crohn's disease0.500000
tucson0.500000
seattle0.500000
cftr s489x0.500000
colonized germ free0.500000
age 7 months0.500000
juvenile0.500000
stroke0.500000
before hsct0.500000
children0.500000
age > 1 year0.500000
LOWER IN estonia0.500000
age one year0.500000
acute pancreatitis0.500000
pancreatitis0.500000
age 50-70 years0.500000
little physical activity0.500000
LOWER IN physical activity0.500000
LOWER IN cron diet0.500000
adula0.500000
snake farm0.500000
elaphe carinata0.500000
king ratsnake0.500000
rhesus macaque0.500000
equine grass sickness0.500000
adriatic sea coastal waters of italy0.500000
caretta caretta0.500000
loggerhead sea turtle0.500000
trachemys scripta elegans0.500000
red-eared slider turtle0.500000
turtle farm0.500000
ptyas mucosa0.500000
oriental ratsnake0.500000
LOWER IN egypt0.500000
naja atra0.500000
chinese cobra0.500000
taconic farms0.500000
LOWER IN jackson laboratories0.500000
hmong0.500000
LOWER IN myanmar0.500000
LOWER IN karen0.500000
LOWER IN russia0.500000
age<17 years0.500000
LOWER IN peru0.500000
LOWER IN tunapuco0.500000
suckling0.500000
preweaned0.500000
age 2-4 weeks0.500000
taipei city0.500000
low anterior resection0.500000
deinagkistrodon acutus0.500000
pit viper0.500000
glasgow0.500000
spondyloarthritis0.500000
spondylitis0.500000
LOWER IN state of oregon0.500000
strain 129s0.500000
lima0.500000
shantytown0.500000
LOWER IN el salado0.500000
nanning city prefecture0.500000
age 50-60 years0.500000
nephrolithiasis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN weaned0.500000
LOWER IN corn and soybean diet0.500000
LOWER IN age 4-7 weeks0.500000
algonquin provincial park0.500000
peromyscus maniculatus0.500000
deer mice0.500000
perianal skin0.500000
LOWER IN external acoustic meatus0.500000
LOWER IN ear canal0.500000
urocyon littoralis0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
rattus rattus0.500000
age >940.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
new delhi0.500000
LOWER IN age one month0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.889908
homo sapiens0.743119
united states of america0.348624
adult0.302752
china0.192661
infant0.183486
research facility0.146789
germany0.128440
LOWER IN control0.100917
mus musculus0.091743
mouse0.091743
formula fed0.073394
farm0.073394
crohn's disease0.064220
female0.064220
child0.055046
italy0.045872
clostridium difficile intestinal infectious disease0.045872
age 1 year0.045872
control0.045872
terminal ileum0.045872
biopsy0.045872
LOWER IN male0.045872
city0.036697
LOWER IN rural community0.036697
obsolete_juvenile stage0.036697
hospital0.036697
seattle0.036697
colonized germ free0.036697
sigmoid colon0.036697
rectum0.036697
age0.036697
hunan province0.036697
adula0.036697
snake0.036697
snake farm0.036697
taconic farms0.036697
LOWER IN jackson laboratories0.036697
canada0.036697
LOWER IN small village0.027523
LOWER IN adult0.027523
clostridium difficile infection0.027523
state of georgia0.027523
remission0.027523
age 3 months0.027523
LOWER IN breast fed0.027523
caecum0.027523
colon0.027523
state of california0.027523
finland0.027523
age < 3 years0.027523
age 1 month0.027523
monkey0.027523
captive0.027523
c57bl/60.027523
age 8 weeks0.027523
parkinson's disease0.018349
after hcst0.018349
hematopoietic stem cell transplant0.018349
breast fed0.018349
diarrhea0.018349
kingdom of spain0.018349
valladolid0.018349
systemic lupus erythematosus0.018349
commonwealth of virginia0.018349
LOWER IN control diet0.018349
cystic fibrosis0.018349
cftr s489x0.018349
age 7 months0.018349
guangzhou city prefecture0.018349
juvenile organism0.018349
green turtle0.018349
chelonia mydas0.018349
juvenile0.018349
state of alabama0.018349
diet0.018349
children0.018349
LOWER IN age 2 months0.018349
age > 1 year0.018349
LOWER IN age &lt; 1 year0.018349
kingdom of denmark0.018349
age one year0.018349
ulcerative colitis0.018349
state of new york0.018349
macaca mulatta0.018349
rhesus macaque0.018349
rat0.018349
age 3-5 weeks0.018349
LOWER IN feces0.018349
rural community0.018349
LOWER IN russia0.018349
sus scrofa0.018349
jiangxi province0.018349
pig0.018349
suckling0.018349
preweaned0.018349
age 2-4 weeks0.018349
nanning city prefecture0.018349
age 50-60 years0.018349
wild0.018349
Exp. ID User ID Description Date Region Flag Sequences
607amnon high in rem sleep behavior disorder parkinson's disease compared to control in feces homo sapiens germany 2020-04-19v4No1 / 3
655amnoncommon in patients after hematopoietic stem cell transplant (common feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No1 / 10
502amnon high in schizophrenia compared to control in feces homo sapiens united states of america adult 2019-03-12v4No1 / 13
185amnoncommon in patients with c. diff infection before treatment (common feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
290amnon high in city compared to small village rural community in feces homo sapiens adult china 2018-02-01v4No1 / 14
371amnonNEGATIVELY correlated with age in amerindians ( high in infant obsolete_juvenile stage compared to adult in feces homo sapiens venezuela amerindian hunter gatherer )2018-09-06v4No1 / 15
797amnon high in age 1 year compared to age 7 months in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 15
94amnoncommon feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 16
728amnoncommon feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 16
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v4No1 / 17
719amnonhigher in diet containing fiber compared to non fiber containing diet ( high in fiber diet compared to control diet in united states of america research facility dentition mus musculus state of georgia mouse charles river laboratories icr/cd-1 mice )2028-05-23v4No1 / 17
713amnondominant feces, homo sapiens, remission, crohn's disease2028-05-21v3No1 / 18
689amnoncommon feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 19
619amnondominant feces, united states of america, research facility, mus musculus, mouse, cystic fibrosis, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 20
797amnondominant feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 20
797amnondominant feces, homo sapiens, infant, germany, age 3 months, formula fed2021-06-13v3No1 / 20
728amnondominant feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 21
779amnoncommon feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 22
619amnondominant feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 22
655amnondominant in patients after hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No1 / 22
713amnoncommon feces, homo sapiens, remission, crohn's disease2028-05-21v3No1 / 22
797amnoncommon feces, homo sapiens, infant, germany, age 1 year, formula fed2021-06-13v3No1 / 23
641amnoncommon feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
641amnondominant feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
714amnondominant homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 25
651amnon high in female compared to male in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 28
211amnon high in female compared to male in feces united states of america research facility mus musculus diet high fat diet mouse 2017-10-22v4No1 / 30
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in feces homo sapiens adult guangzhou city prefecture china )2018-05-15v4No1 / 30
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 31
655amnoncommon in patients before hematopoietic stem cell transplant (common feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 31
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 31
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 34
284amnon high in age 1 year compared to age 2 months in feces homo sapiens female infant state of california 2018-01-27v4No1 / 35
233amnon high in age age > 1 year compared to age < 1 year in feces homo sapiens united states of america infant 2017-11-05v4No1 / 37
320amnonhigher in CD patients with remission ( high in remission compared to crohn's disease in feces homo sapiens adult )2018-04-19v4No1 / 38
797amnon high in age 3 months compared to age 1 month in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 39
19amnoncommon in biopsies of children (IBD study) (common homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 40
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
241amnonhigher in babies from finland compared to estonia ( high in finland compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 45
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one year2018-01-14v4No1 / 46
428amnon high in acute pancreatitis pancreatitis compared to control in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 46
651amnoncommon feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 49
797amnoncommon feces, homo sapiens, child, germany, breast fed, age 2 years2021-06-13v3No1 / 50
797amnon high in infant age 1 year compared to child age 2 years in feces homo sapiens germany formula fed 2021-06-13v3No1 / 52
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
368amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 56
650amnon high in female compared to male in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 57
814amnonhigher after 2 months of caloric restriction diet ( high in caloric restriction diet compared to control diet in feces homo sapiens female obesity adult obese body mass index status germany high bmi overweight body mass index status age 50-70 years )2021-06-30v4No1 / 58
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 59
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in diet american diet compared to cron diet caloric restriction diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 61
619amnoncommon feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 61
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 63
671amnon high in age 1 month compared to age 3 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 64
619amnoncommon feces, united states of america, research facility, cystic fibrosis, mus musculus, mouse, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 64
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
644amnon high in female compared to male in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v4No1 / 69
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 1 month 2021-06-13v3No1 / 69
448amnon high in equine grass sickness disease compared to control in feces farm equus caballus horse united kingdom 2019-01-08v4No1 / 72
810amnoncommon in sea turtle feces from sea turtle rescue center (common feces, research facility, mediterranean sea, italy, adriatic sea coastal waters of italy, caretta caretta, loggerhead sea turtle)2021-06-22v3No1 / 72
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 3 months 2021-06-13v3No1 / 75
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 77
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic ampicillin neomycin compared to control in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 80
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
590amnoncommon farm, intestine, age 3-5 weeks, china, hainan autonomous prefecture, trachemys scripta elegans, red-eared slider turtle, turtle farm2020-02-10v4No1 / 83
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, naja atra, chinese cobra, china2019-07-21v4No1 / 90
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in feces homo sapiens united states of america adult )2018-02-07v4No1 / 96
538amnon high in taconic farms compared to jackson laboratories in research facility ileum mus musculus c57bl/6 terminal ileum canada mouse age 8 weeks 2019-07-29v4No1 / 104
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
538amnon high in taconic farms compared to jackson laboratories in research facility colon right colon mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 108
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy site biopsy compared to feces in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 118
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in feces homo sapiens toronto )2016-10-27v4No1 / 125
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
538amnon high in taconic farms compared to jackson laboratories in feces research facility mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 135
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 148
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in feces homo sapiens infant )2017-11-13v4No1 / 173
530amnoncommon feces, farm, hunan province, adula, snake, deinagkistrodon acutus, pit viper, snake farm, china2019-07-21v4No1 / 178
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
669amnon high in age 1 year compared to age 2 months in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 217
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
214amnonlower in mice from jackson laboratories compared to taconic farms ( high in taconic farms compared to jackson laboratories in feces united states of america research facility mus musculus mouse strain 129s )2017-10-23v4No1 / 232
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, age 50-60 years, nephrolithiasis, china)2018-01-27v4No1 / 239
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, age 50-60 years, china)2018-01-27v4No1 / 281
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 347
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to research facility captive in feces canada province of ontario algonquin provincial park peromyscus maniculatus deer mice age 3-5 weeks )2019-07-28v3No1 / 358
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v4No1 / 384
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 400
666amnoncommon feces, italy, rat, rattus rattus2020-09-25v3No1 / 406
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in feces homo sapiens china )2018-12-30v4No1 / 474
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
729amnon high in zoological garden captive europe compared to wild cameroon in feces gorilla gorilla monkey 2021-01-05v3No1 / 656

Problems / suggestions? Please email info AT dbbact DOT org