Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTATGGCAAGTCTGATGTGAAAGGCCAGGGCTCAACCCTGGGACTGCATTGGAAACTGTCGAACTAGAGTGTCGGAGAGGCAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
feces0.406526
homo sapiens0.398397
adult0.278069
united states of america0.164980
child0.140969
zoological garden0.140704
obsolete_juvenile stage0.119241
city0.114683
infant0.097561
germany0.093240
control0.088739
italy0.082902
rural community0.081871
india0.081871
gallus gallus0.075676
chicken0.075676
china0.075215
caecum0.075117
research facility0.067336
female0.062844
state of california0.062176
LOWER IN child0.059172
formula fed0.058140
captive0.057692
monkey0.054945
rhesus macaque0.048485
homosexual0.048485
msm0.048485
como zoo0.048485
gorilla gorilla0.048485
LOWER IN crohn's disease0.047619
juvenile organism0.047337
state of colorado0.046243
age0.044944
macaca mulatta0.044199
canada0.043243
state of minnesota0.043243
israel0.042328
small village0.037267
age 5-13 years0.037152
age 7 months0.036810
new delhi0.036810
age 8 months0.036810
gay0.036810
age 130.036810
cobb broiler chicken0.036810
pan troglodytes0.036810
chimpanzee0.036810
age 30-500.036145
age 35 days0.036145
biopsy0.035821
finland0.035821
amsterdam0.035503
kingdom of norway0.035503
rectum0.034884
duodenum0.034582
kingdom of the netherlands0.034286
LOWER IN wild0.033994
male0.033755
jiangsu province0.033708
kingdom of spain0.032086
colon0.031830
papio anubis0.025000
sudan0.024845
kebbi state0.024845
bangladesh0.024845
LOWER IN state of oregon0.024845
age 4-10 years0.024845
denver0.024845
dairy0.024845
lima0.024845
shantytown0.024845
toronto zoo0.024845
age >940.024845
glasgow0.024845
oslo0.024845
age 30-400.024845
age 13-140.024845
LOWER IN age 3-60.024845
hadza0.024845
lincoln park zoo0.024845
age 60-790.024845
hefei city prefecture0.024845
baijiu0.024845
chuquisaca department0.024845
LOWER IN republic of congo0.024845
LOWER IN nouabale-ndoki national park0.024845
heterosexual0.024691
msw0.024691
nigeria0.024540
LOWER IN age 3 months0.024540
food allergy0.024540
age 30 days0.024540
colombia0.024540
viet nam0.024540
toronto0.024540
LOWER IN age < 1 year0.024540
chicago0.024540
mud0.024540
fermentation pit mud0.024540
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
age 5-13 years0.666667
papio anubis0.666667
LOWER IN no fructose diet0.500000
janvier labs0.500000
high sugar diet0.500000
age 18 weeks0.500000
sudan0.500000
age 7 months0.500000
normal stool0.500000
LOWER IN hard stool0.500000
columbia0.500000
juvenile0.500000
endospore enriched fraction0.500000
lysis0.500000
LOWER IN schistosomiasis0.500000
LOWER IN urinary schistosomiasis0.500000
kebbi state0.500000
rural community0.500000
new delhi0.500000
india0.500000
panthera tigris0.500000
tiger0.500000
bangladesh0.500000
LOWER IN state of oregon0.500000
rhesus macaque0.500000
age 8 months0.500000
caribbean latino0.500000
adriatic sea coastal waters of italy0.500000
caretta caretta0.500000
loggerhead sea turtle0.500000
age 4-10 years0.500000
sesame allergy0.500000
quito0.500000
denver0.500000
gay0.500000
homosexual0.500000
msm0.500000
LOWER IN egypt0.500000
dairy0.500000
milk allergy0.500000
hmong0.500000
azerbaijan0.500000
third trimester0.500000
LOWER IN inflammatory bowel disease0.500000
cornell university0.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
canis lupus arctos0.500000
toronto zoo0.500000
arctic wolf0.500000
irritable bowel syndrome0.500000
age >940.500000
glasgow0.500000
oslo0.500000
age 30-400.500000
gaz:000521000.500000
myanmar0.500000
karen0.500000
saguinus imperator0.500000
como zoo0.500000
emperor tamarin0.500000
municipality of logrono0.500000
cron diet0.500000
age 13-140.500000
rem sleep behavior disorder0.500000
age 130.500000
LOWER IN india0.500000
cobb broiler chicken0.500000
yaounde0.500000
el salvador0.500000
age 8-120.500000
LOWER IN age 3-60.500000
hadza0.500000
apodemus sylvaticus0.500000
wood mouse0.500000
spondyloarthritis0.500000
spondylitis0.500000
republic of congo0.500000
nouabale-ndoki national park0.500000
atherosclerosis0.500000
LOWER IN el salado0.500000
bogota0.500000
LOWER IN municipality of santiago de cali0.500000
LOWER IN bucaramanga0.500000
LOWER IN barranquilla0.500000
age 1-20.500000
LOWER IN age 0-10.500000
ateles geoffroyi0.500000
black-handed spider monkey0.500000
tunapuco0.500000
gorilla gorilla0.500000
jinzhou city prefecture0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
pan troglodytes0.500000
chimpanzee0.500000
lincoln park zoo0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.878981
homo sapiens0.738854
adult0.356688
united states of america0.305732
child0.101911
china0.101911
control0.095541
zoological garden0.089172
research facility0.082803
obsolete_juvenile stage0.070064
city0.070064
germany0.063694
infant0.063694
female0.050955
italy0.050955
caecum0.050955
rural community0.044586
india0.044586
gallus gallus0.044586
chicken0.044586
state of california0.038217
captive0.038217
formula fed0.031847
LOWER IN child0.031847
monkey0.031847
juvenile organism0.025478
macaca mulatta0.025478
rhesus macaque0.025478
israel0.025478
state of colorado0.025478
homosexual0.025478
msm0.025478
LOWER IN crohn's disease0.025478
canada0.025478
state of minnesota0.025478
como zoo0.025478
male0.025478
age0.025478
gorilla gorilla0.025478
age 7 months0.019108
new delhi0.019108
age 8 months0.019108
age 5-13 years0.019108
gay0.019108
kingdom of the netherlands0.019108
amsterdam0.019108
rectum0.019108
colon0.019108
biopsy0.019108
jiangsu province0.019108
age 30-500.019108
kingdom of spain0.019108
duodenum0.019108
kingdom of norway0.019108
finland0.019108
age 130.019108
cobb broiler chicken0.019108
age 35 days0.019108
small village0.019108
pan troglodytes0.019108
chimpanzee0.019108
LOWER IN wild0.019108
sudan0.012739
LOWER IN control0.012739
wild0.012739
nigeria0.012739
kebbi state0.012739
age 10-15 years0.012739
LOWER IN age 3 months0.012739
bangladesh0.012739
ulcerative colitis0.012739
LOWER IN state of oregon0.012739
food allergy0.012739
age 4-10 years0.012739
south korea0.012739
heterosexual0.012739
msw0.012739
high bmi0.012739
obesity0.012739
denver0.012739
dairy0.012739
ovis aries0.012739
age 30 days0.012739
thailand0.012739
colombia0.012739
biopsy site0.012739
pregnancy0.012739
LOWER IN ulcerative colitis0.012739
state of new york0.012739
lima0.012739
shantytown0.012739
skin0.012739
toronto zoo0.012739
viet nam0.012739
broiler chicken0.012739
small intestine0.012739
age >940.012739
glasgow0.012739
oslo0.012739
age 30-400.012739
Exp. ID User ID Description Date Region Flag Sequences
522amnonhigher in fructose supplemented diets ( high in fructose diet fructose compared to no fructose diet in feces female research facility mus musculus c57bl/6j germany mouse janvier labs high sugar diet age 18 weeks )2019-07-03v3No1 / 13
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child sudan obsolete_juvenile stage 2018-08-30v4No1 / 14
797amnondominant feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 20
404amnon high in normal stool compared to hard stool in feces homo sapiens city adult columbia 2018-11-20v4No1 / 21
641amnoncommon feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in feces homo sapiens united states of america adult )2018-11-18v4No1 / 31
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 31
666amnoncommon feces, italy, wild, canis lupus, wolf2020-09-25v3No1 / 32
509amnon high in control compared to schistosomiasis urinary schistosomiasis in feces homo sapiens child nigeria kebbi state rural community age 10-15 years 2019-03-18v4No1 / 35
797amnon high in age 3 months compared to age 1 month in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 39
352amnoncommon feces, homo sapiens, new delhi, india2018-07-30v4No1 / 41
666amnoncommon feces, italy, panthera tigris, tiger2020-09-25v3No1 / 43
365amnoncommon feces, homo sapiens, child, sudan, obsolete_juvenile stage2018-08-30v4No1 / 44
797amnon high in age 7 months compared to age 3 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 44
666amnoncommon feces, canis lupus familiaris, italy, dog2020-09-25v3No1 / 46
121amnoncommon feces, homo sapiens, adult, bangladesh2017-04-13v4No1 / 50
797amnon high in infant age 1 year compared to child age 2 years in feces homo sapiens germany formula fed 2021-06-13v3No1 / 52
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta monkey captive rhesus macaque age 8 months 2020-09-27v4No1 / 66
803amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, age 50-80 years, type 2 diabetes mellitus, caribbean latino2021-06-18v4No1 / 70
810amnoncommon in sea turtle feces from sea turtle rescue center (common feces, research facility, mediterranean sea, italy, adriatic sea coastal waters of italy, caretta caretta, loggerhead sea turtle)2021-06-22v3No1 / 72
401amnoncommon feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 79
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 80
339amnoncommon feces, homo sapiens, adult, india2018-05-24v4No1 / 81
643amnoncommon feces, homo sapiens, adult, south korea2020-08-30v4No1 / 81
562amnoncommon feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 82
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 83
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 86
344amnoncommon in feces of homosexual males (common feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 87
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
293amnoncommon feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 89
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 89
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
363amnoncommon dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 94
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 94
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 95
238amnoncommon feces, homo sapiens, colombia2017-11-07v4No1 / 96
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 97
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 97
363amnon high in rectum caecum colon compared to ruminant reticulum omasum rumen in dairy ovis aries italy obsolete_juvenile stage age 30 days 2018-08-29v4No1 / 101
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
409amnoncommon feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 108
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
53amnoncommon feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in feces homo sapiens united states of america child )2018-11-22v4No1 / 110
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
565amnoncommon zoological garden, skin, captive, canada, canis lupus arctos, toronto zoo, arctic wolf2019-11-21v3No1 / 114
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 30-50, china2018-12-30v4No1 / 115
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
568amnon high in viet nam compared to thailand in feces gallus gallus chicken broiler chicken 2019-12-08v3No1 / 119
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china2018-12-30v4No1 / 121
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay homosexual msm compared to heterosexual msw in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to child obsolete_juvenile stage crohn's disease in feces homo sapiens glasgow )2017-02-26v4No1 / 125
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to rectum biopsy site biopsy in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 126
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, age 30-402018-05-13v4No1 / 130
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
625amnoncommon feces, united states of america, zoological garden, state of minnesota, saguinus imperator, como zoo, emperor tamarin2020-05-16v4No1 / 132
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 132017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens juvenile organism obsolete_juvenile stage age 13 2017-09-12v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america )2017-04-11v4No1 / 139
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 141
744amnoncommon research facility, gallus gallus, male, chicken, caecum, cobb broiler chicken, age 35 days2021-02-21v3No1 / 141
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
509amnoncommon feces, homo sapiens, control, child, nigeria, kebbi state, rural community, age 10-15 years2019-03-18v4No1 / 147
594amnoncommon feces, homo sapiens, city, adult, cameroon, yaounde2020-03-12v4No1 / 154
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in feces homo sapiens china )2018-12-30v4No1 / 168
190amnoncommon feces, homo sapiens, tanzania, hunter gatherer, hadza2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, age 13, india2017-09-12v4No1 / 170
666amnoncommon feces, italy, apodemus sylvaticus, wood mouse2020-09-25v3No1 / 171
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in feces homo sapiens infant )2017-11-13v4No1 / 173
671amnon high in age 8 months compared to female adult in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 182
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
604amnoncommon research facility, gallus gallus, chicken, cecal content, china, caecum2020-04-06v3No1 / 185
744amnon high in caecum compared to cloaca in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 187
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
620amnoncommon feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 197
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 217
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
584amnoncommon feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 221
10amnonpositively correlated with age (6-35) ( high in adult compared to child in feces homo sapiens toronto )2016-10-27v4No1 / 228
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
404amnon high in bogota medellin metropolitan area compared to municipality of santiago de cali bucaramanga barranquilla in feces homo sapiens city adult colombia 2018-11-20v4No1 / 237
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in feces homo sapiens infant india )2016-12-19v4No1 / 253
625amnoncommon feces, united states of america, zoological garden, state of minnesota, ateles geoffroyi, como zoo, black-handed spider monkey2020-05-16v4No1 / 256
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 263
568amnoncommon feces, gallus gallus, chicken, broiler chicken, viet nam2019-12-08v3No1 / 272
744amnon high in caecum compared to ileum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 286
625amnoncommon feces, united states of america, zoological garden, gorilla gorilla, state of minnesota, como zoo2020-05-16v4No1 / 293
780amnoncommon research facility, gallus gallus, chicken, china, jinzhou city prefecture, caecum2021-04-28v3No1 / 294
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 306
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
190amnon high in wet season compared to dry season in feces homo sapiens tanzania hunter gatherer hadza 2017-09-04v4No1 / 341
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chicago, chimpanzee, lincoln park zoo2020-05-06v4No1 / 358
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to research facility captive in feces canada province of ontario algonquin provincial park peromyscus maniculatus deer mice age 3-5 weeks )2019-07-28v3No1 / 358
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in feces papio zambia monkey baboon 2018-11-23v4No1 / 364
565amnoncommon zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 368
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
620amnoncommon feces, united states of america, zoological garden, gorilla gorilla, chicago, lincoln park zoo2020-05-06v4No1 / 384
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, state of tennessee, zoological garden, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon feces, united states of america, state of tennessee, zoological garden, pan troglodytes, chimpanzee2018-11-16v4No1 / 407
625amnoncommon feces, united states of america, zoological garden, state of minnesota, pongo abelii, sumatran orangutan, como zoo2020-05-16v4No1 / 414
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
339amnon high in adult compared to infant age < 1 year in feces homo sapiens india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
438amnon high in adult age 30-50 age 60-79 compared to child age 3-6 age 8-12 in feces homo sapiens china 2018-12-30v4No1 / 486
620amnoncommon feces, united states of america, zoological garden, gorilla gorilla, saint louis, saint louis zoo2020-05-06v4No1 / 530
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 0-90)2020-04-05v3No1 / 542
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
517amnon high in feces compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 606
603amnoncommon in baijiu fermentation pit mud in later batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 180-270)2020-04-05v3No1 / 608
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in feces homo sapiens china )2018-12-30v4No1 / 617
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
671amnon high in age 8 months compared to age 3 months age 6 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 955
620amnon high in united states of america zoological garden pan troglodytes compared to wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park in feces chimpanzee 2020-05-06v4No1 / 964
620amnon high in united states of america zoological garden compared to wild republic of congo nouabale-ndoki national park in feces gorilla gorilla gorilla 2020-05-06v4No1 / 1019

Problems / suggestions? Please email info AT dbbact DOT org