Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTTATGTAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTATGTAACTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.222638
feces0.194256
infant0.169492
city0.152091
age0.146520
obsolete_juvenile stage0.144578
state of oklahoma0.129032
united states of america0.122010
finland0.114286
child0.103896
adult0.103627
LOWER IN adult0.092308
age > 1 year0.086957
LOWER IN age one month0.086957
age 130.086957
LOWER IN small village0.086957
nanning city prefecture0.086957
age 50-60 years0.086957
LOWER IN age 30-500.086957
LOWER IN age 60-790.086957
age >940.086957
heterosexual0.085106
msw0.085106
LOWER IN homosexual0.085106
LOWER IN msm0.085106
LOWER IN age < 1 year0.083333
LOWER IN rural community0.083333
switzerland0.080000
india0.080000
caecum0.077922
juvenile organism0.074074
kingdom of denmark0.071429
south korea0.058824
small waist circumference0.045455
LOWER IN waist circumference0.045455
LOWER IN large waist circumference0.045455
chronic fatigue syndrome0.045455
new york county0.045455
age 50-70 years0.045455
cheyenne0.045455
native american0.045455
arapaho0.045455
rana pipiens0.045455
northern leopard frog0.045455
denver0.045455
LOWER IN india0.045455
age<17 years0.045455
LOWER IN peru0.045455
LOWER IN tunapuco0.045455
glasgow0.045455
lima0.045455
shantytown0.045455
LOWER IN el salado0.045455
bogota0.045455
LOWER IN municipality of santiago de cali0.045455
LOWER IN bucaramanga0.045455
LOWER IN barranquilla0.045455
nephrolithiasis0.045455
age 1-20.045455
LOWER IN age 0-10.045455
age 3-60.045455
age 8-120.045455
LOWER IN venezuela0.045455
LOWER IN amerindian0.045455
LOWER IN hunter gatherer0.045455
children0.045455
age one year0.045455
age 60-790.045455
LOWER IN age 19-240.045455
LOWER IN soldiers0.045455
overweight body mass index status0.044444
LOWER IN poland0.044444
low altitude0.044444
LOWER IN high altitude0.044444
south america0.044444
atlanta0.044444
LOWER IN age 2 months0.044444
medellin metropolitan area0.044444
LOWER IN neomycin0.044444
LOWER IN thailand0.044444
sigmoid colon0.044444
european0.044444
LOWER IN asian0.044444
LOWER IN age &lt;1 year0.044444
age 30-500.044444
state of alabama0.043478
caloric restriction diet0.043478
obese body mass index status0.043478
neomycin0.043478
amsterdam0.043478
state of wisconsin0.043478
LOWER IN gay0.043478
LOWER IN biopsy site0.043478
LOWER IN biopsy0.043478
age 1 week0.043478
state of texas0.043478
LOWER IN vancomycin0.043478
terminal ileum0.043478
caucasian0.043478
parkinson's disease0.042553
Fraction of dbbact annotations with this term covered by the query
TermScore
state of oklahoma0.666667
small waist circumference0.500000
LOWER IN waist circumference0.500000
LOWER IN large waist circumference0.500000
chronic fatigue syndrome0.500000
new york county0.500000
age > 1 year0.500000
age 50-70 years0.500000
cheyenne0.500000
native american0.500000
arapaho0.500000
rana pipiens0.500000
northern leopard frog0.500000
denver0.500000
LOWER IN age one month0.500000
age 130.500000
LOWER IN india0.500000
age<17 years0.500000
LOWER IN peru0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
glasgow0.500000
lima0.500000
shantytown0.500000
LOWER IN el salado0.500000
bogota0.500000
LOWER IN municipality of santiago de cali0.500000
LOWER IN bucaramanga0.500000
LOWER IN barranquilla0.500000
nanning city prefecture0.500000
age 50-60 years0.500000
nephrolithiasis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
age 3-60.500000
age 8-120.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN venezuela0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
children0.500000
age >940.500000
age one year0.500000
age 60-790.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
heterosexual0.400000
msw0.400000
LOWER IN homosexual0.400000
LOWER IN msm0.400000
LOWER IN age &lt; 1 year0.333333
overweight body mass index status0.333333
LOWER IN poland0.333333
low altitude0.333333
LOWER IN high altitude0.333333
south america0.333333
atlanta0.333333
LOWER IN rural community0.333333
LOWER IN age 2 months0.333333
medellin metropolitan area0.333333
LOWER IN neomycin0.333333
LOWER IN thailand0.333333
sigmoid colon0.333333
european0.333333
LOWER IN asian0.333333
LOWER IN age &lt;1 year0.333333
age 30-500.333333
obsolete_juvenile stage0.300000
finland0.285714
state of alabama0.250000
caloric restriction diet0.250000
obese body mass index status0.250000
switzerland0.250000
neomycin0.250000
amsterdam0.250000
state of wisconsin0.250000
LOWER IN gay0.250000
LOWER IN biopsy site0.250000
LOWER IN biopsy0.250000
age 1 week0.250000
state of texas0.250000
india0.250000
LOWER IN vancomycin0.250000
terminal ileum0.250000
caucasian0.250000
city0.210526
infant0.208333
parkinson's disease0.200000
ampicillin0.200000
age0.190476
kingdom of the netherlands0.166667
tadpole0.166667
juvenile organism0.166667
colombia0.166667
digesta0.142857
LOWER IN rectum0.142857
kingdom of denmark0.142857
LOWER IN metronidazole0.142857
biopsy0.142857
Fraction of annotations for the query sequences containing the term
TermScore
feces0.928571
homo sapiens0.928571
united states of america0.428571
adult0.285714
infant0.142857
age0.119048
city0.119048
china0.119048
LOWER IN control0.095238
child0.095238
obsolete_juvenile stage0.095238
state of oklahoma0.071429
caecum0.071429
LOWER IN adult0.071429
finland0.071429
control0.071429
south korea0.047619
age > 1 year0.047619
LOWER IN age &lt; 1 year0.047619
female0.047619
switzerland0.047619
research facility0.047619
heterosexual0.047619
msw0.047619
LOWER IN homosexual0.047619
LOWER IN msm0.047619
LOWER IN age one month0.047619
kingdom of denmark0.047619
juvenile organism0.047619
age 130.047619
LOWER IN small village0.047619
LOWER IN rural community0.047619
nanning city prefecture0.047619
age 50-60 years0.047619
india0.047619
LOWER IN age 30-500.047619
LOWER IN age 60-790.047619
age >940.047619
small waist circumference0.023810
LOWER IN waist circumference0.023810
LOWER IN large waist circumference0.023810
chronic fatigue syndrome0.023810
new york county0.023810
parkinson's disease0.023810
state of alabama0.023810
LOWER IN male0.023810
caloric restriction diet0.023810
LOWER IN control diet0.023810
obesity0.023810
obese body mass index status0.023810
germany0.023810
high bmi0.023810
overweight body mass index status0.023810
age 50-70 years0.023810
cheyenne0.023810
native american0.023810
arapaho0.023810
LOWER IN poland0.023810
antibiotic0.023810
ampicillin0.023810
neomycin0.023810
rattus norvegicus0.023810
sprague dawley0.023810
rat0.023810
male0.023810
kingdom of the netherlands0.023810
amsterdam0.023810
tadpole0.023810
intestine0.023810
state of wisconsin0.023810
digesta0.023810
rana pipiens0.023810
northern leopard frog0.023810
LOWER IN gay0.023810
state of colorado0.023810
denver0.023810
low altitude0.023810
LOWER IN high altitude0.023810
mus musculus0.023810
south america0.023810
mouse0.023810
wild0.023810
LOWER IN rectum0.023810
LOWER IN biopsy site0.023810
LOWER IN biopsy0.023810
ulcerative colitis0.023810
age 1 week0.023810
LOWER IN india0.023810
atlanta0.023810
age<17 years0.023810
LOWER IN peru0.023810
LOWER IN tunapuco0.023810
state of texas0.023810
crohn's disease0.023810
glasgow0.023810
age 1 year0.023810
LOWER IN age 2 months0.023810
sweden0.023810
lima0.023810
shantytown0.023810
Exp. ID User ID Description Date Region Flag Sequences
131amnonnegatively correlated with waist circumference ( high in small waist circumference compared to waist circumference large waist circumference in feces homo sapiens south korea )2017-04-16v4No1 / 15
12amnon high in chronic fatigue syndrome compared to control in feces homo sapiens new york county 2016-11-02v4No1 / 18
233amnon high in age age > 1 year compared to age < 1 year in feces homo sapiens united states of america infant 2017-11-05v4No1 / 37
651amnon high in parkinson's disease compared to control in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 37
131amnon high in female compared to male in feces homo sapiens south korea 2017-04-16v4No1 / 55
814amnonhigher after 2 months of caloric restriction diet ( high in caloric restriction diet compared to control diet in feces homo sapiens female obesity adult obese body mass index status germany high bmi overweight body mass index status age 50-70 years )2021-06-30v4No1 / 58
242amnoncommon in native-americans (common feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 65
663amnon high in switzerland compared to poland in feces homo sapiens adult 2020-09-22v4No1 / 76
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic ampicillin neomycin compared to control in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 80
629amnon high in heterosexual msw compared to homosexual msm in feces homo sapiens adult male kingdom of the netherlands amsterdam 2020-05-31v4No1 / 85
114amnon high in tadpole compared to adult in united states of america research facility intestine state of wisconsin digesta rana pipiens northern leopard frog 2017-04-10v4No1 / 90
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 106
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
386amnonnegatively correlated with altitude (0-4km) in house mouse caecum ( high in low altitude compared to high altitude in caecum mus musculus south america mouse wild )2018-10-28v4No1 / 122
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to rectum biopsy site biopsy in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 126
273amnon high in age age 1 week compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 127
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 132017-09-12v4No1 / 136
197amnon high in finland compared to india in feces homo sapiens juvenile organism obsolete_juvenile stage age 13 2017-09-12v4No1 / 138
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
669amnon high in age 1 year compared to age 2 months in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
404amnon high in bogota medellin metropolitan area compared to municipality of santiago de cali bucaramanga barranquilla in feces homo sapiens city adult colombia 2018-11-20v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, age 50-60 years, nephrolithiasis, china)2018-01-27v4No1 / 239
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in feces homo sapiens infant india )2016-12-19v4No1 / 253
438amnon high in child age 3-6 age 8-12 compared to adult age 30-50 age 60-79 in feces homo sapiens china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, age 50-60 years, china)2018-01-27v4No1 / 281
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
339amnon high in adult compared to infant age < 1 year in feces homo sapiens india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in feces homo sapiens china )2018-12-30v4No1 / 474
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in feces homo sapiens china )2018-12-30v4No1 / 617

Problems / suggestions? Please email info AT dbbact DOT org