Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCCATGCAAGTCAGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTTGAAACTGTAAGGCTAGATTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
sus scrofa0.270833
pig0.270833
farm0.205714
bos taurus0.203390
feces0.191446
masai mara national park0.186047
united states of america0.176136
kenya0.156863
cow0.146341
homo sapiens0.137480
female organism0.102564
state of georgia0.095238
LOWER IN male0.087912
caecum0.087912
adult0.085511
syncerus caffer caffer0.080537
cape buffalo0.080537
zoological garden0.080000
LOWER IN rural community0.078947
state of mississippi0.078947
female0.076336
hispanic or latin american0.075949
LOWER IN crohn's disease0.074074
commonwealth of pennsylvania0.071856
pregnancy0.068182
united kingdom0.067797
diet0.063830
wild0.061069
animal product diet0.054795
jinhua city prefecture0.054054
jinhua pig0.054054
giraffa camelopardalis0.054054
LOWER IN age 30-500.054054
LOWER IN age 60-790.054054
angus steer0.054054
giraffe0.054054
antidorcas marsupialis0.054054
springbok0.054054
damaliscus lunatus0.054054
tsessebe0.054054
tonsil0.053333
juvenile organism0.052632
post-weaning0.052632
tibet autonomous region0.052632
finland0.051948
south africa0.051948
china0.051348
LOWER IN ulcerative colitis0.051282
low bmi0.050633
state of michigan0.050633
LOWER IN high bmi0.050000
obsolete_juvenile stage0.050000
rattus norvegicus0.050000
sprague dawley0.050000
jejunum0.050000
cecal content0.050000
adult organism0.047619
pair of nares0.047619
state of new york0.046512
rat0.046512
research facility0.044199
control0.043988
age0.043956
canada0.043956
duodenum0.043478
ileum0.040000
child0.038095
chronic fatigue syndrome0.027778
new york county0.027778
LOWER IN plant based diet0.027778
przewalski horse0.027778
LOWER IN hmong0.027778
LOWER IN hmong 2nd generation0.027778
LOWER IN egypt0.027778
denver0.027778
LOWER IN inflammatory bowel disease0.027778
LOWER IN india0.027778
age 130.027778
LOWER IN wildlife sactuary0.027778
LOWER IN plant diet0.027778
LOWER IN peru0.027778
LOWER IN tunapuco0.027778
farm 10.027778
LOWER IN farm 20.027778
age 1-3 weeks0.027778
atherosclerosis0.027778
sucram0.027778
age 12-19 weeks0.027778
LOWER IN age 6-10 weeks0.027778
age 3-60.027778
age 8-120.027778
LOWER IN nepal0.027778
LOWER IN himalayas0.027778
early pregnancy0.027778
LOWER IN days 14-280.027778
state of vermont0.027778
late pregnancy0.027778
LOWER IN cattle0.027778
tnbs0.027778
giraffa tippelskirchi0.027778
Fraction of dbbact annotations with this term covered by the query
TermScore
animal product diet0.666667
syncerus caffer caffer0.666667
cape buffalo0.666667
chronic fatigue syndrome0.500000
new york county0.500000
LOWER IN plant based diet0.500000
przewalski horse0.500000
LOWER IN hmong0.500000
LOWER IN hmong 2nd generation0.500000
LOWER IN egypt0.500000
denver0.500000
LOWER IN inflammatory bowel disease0.500000
LOWER IN india0.500000
age 130.500000
LOWER IN wildlife sactuary0.500000
LOWER IN plant diet0.500000
LOWER IN peru0.500000
LOWER IN tunapuco0.500000
LOWER IN rural community0.500000
farm 10.500000
LOWER IN farm 20.500000
sus scrofa0.500000
jinhua city prefecture0.500000
pig0.500000
jinhua pig0.500000
age 1-3 weeks0.500000
atherosclerosis0.500000
sucram0.500000
age 12-19 weeks0.500000
LOWER IN age 6-10 weeks0.500000
giraffa camelopardalis0.500000
age 3-60.500000
age 8-120.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
early pregnancy0.500000
LOWER IN days 14-280.500000
angus steer0.500000
state of vermont0.500000
late pregnancy0.500000
LOWER IN cattle0.500000
masai mara national park0.500000
tnbs0.500000
giraffe0.500000
giraffa tippelskirchi0.500000
LOWER IN typhlitis0.500000
LOWER IN intestinal disease0.500000
free range chicken0.500000
eudorcas thomsonii0.500000
thomson's gazelle0.500000
children0.500000
tibetan pig0.500000
tibetan swine0.500000
age >940.500000
antidorcas marsupialis0.500000
springbok0.500000
state of mississippi0.500000
jersey cow0.500000
damaliscus lunatus0.500000
tsessebe0.500000
LOWER IN aepyceros melampus0.500000
LOWER IN impala0.500000
cattle0.500000
calve0.500000
0-2 days0.500000
LOWER IN 30-60 days0.500000
bulgaria0.500000
detritivorous beetle0.500000
LOWER IN herbivorous beetle0.500000
LOWER IN ruminal fluid0.500000
tonsil0.400000
bos taurus0.352941
hispanic or latin american0.333333
juvenile organism0.333333
LOWER IN canis lupus0.333333
LOWER IN wolf0.333333
state of oklahoma0.333333
LOWER IN age 4 weeks0.333333
LOWER IN standard feed0.333333
LOWER IN neomycin0.333333
days 1-20.333333
post-weaning0.333333
LOWER IN thailand0.333333
tibet autonomous region0.333333
province of quebec0.333333
sigmoid colon0.333333
european0.333333
LOWER IN asian0.333333
LOWER IN age <1 year0.333333
holstein dairy cow0.333333
tragelaphus oryx0.333333
eland0.333333
LOWER IN poland0.333333
beetle0.333333
finland0.285714
state of georgia0.285714
south africa0.285714
LOWER IN crohn's disease0.272727
Fraction of annotations for the query sequences containing the term
TermScore
feces0.814286
united states of america0.557143
homo sapiens0.400000
sus scrofa0.185714
pig0.185714
adult0.171429
farm0.171429
bos taurus0.142857
china0.114286
kenya0.114286
wild0.114286
masai mara national park0.114286
research facility0.100000
cow0.100000
control0.085714
female0.071429
female organism0.071429
caecum0.071429
LOWER IN male0.057143
zoological garden0.057143
united kingdom0.057143
state of georgia0.057143
hispanic or latin american0.042857
diet0.042857
LOWER IN crohn's disease0.042857
commonwealth of pennsylvania0.042857
LOWER IN rural community0.042857
pregnancy0.042857
syncerus caffer caffer0.042857
cape buffalo0.042857
state of mississippi0.042857
age0.028571
LOWER IN control0.028571
animal product diet0.028571
low bmi0.028571
LOWER IN high bmi0.028571
state of new york0.028571
child0.028571
obsolete_juvenile stage0.028571
LOWER IN ulcerative colitis0.028571
finland0.028571
juvenile organism0.028571
jinhua city prefecture0.028571
jinhua pig0.028571
tonsil0.028571
state of michigan0.028571
canada0.028571
rattus norvegicus0.028571
sprague dawley0.028571
rat0.028571
giraffa camelopardalis0.028571
LOWER IN age 30-500.028571
LOWER IN age 60-790.028571
adult organism0.028571
post-weaning0.028571
angus steer0.028571
duodenum0.028571
jejunum0.028571
ileum0.028571
giraffe0.028571
tibet autonomous region0.028571
cecal content0.028571
antidorcas marsupialis0.028571
springbok0.028571
damaliscus lunatus0.028571
tsessebe0.028571
south africa0.028571
pair of nares0.028571
old age0.014286
LOWER IN young age0.014286
chronic fatigue syndrome0.014286
new york county0.014286
state of alabama0.014286
LOWER IN plant based diet0.014286
LOWER IN body mass index0.014286
equus przewalskii0.014286
przewalski horse0.014286
LOWER IN hmong0.014286
LOWER IN hmong 2nd generation0.014286
LOWER IN egypt0.014286
heterosexual0.014286
msw0.014286
LOWER IN gay0.014286
LOWER IN homosexual0.014286
LOWER IN msm0.014286
state of colorado0.014286
denver0.014286
LOWER IN child0.014286
LOWER IN inflammatory bowel disease0.014286
LOWER IN india0.014286
age 130.014286
canis lupus familiaris0.014286
dog0.014286
LOWER IN canis lupus0.014286
LOWER IN wolf0.014286
LOWER IN wildlife sactuary0.014286
state of minnesota0.014286
LOWER IN plant diet0.014286
city0.014286
state of oklahoma0.014286
Exp. ID User ID Description Date Region Flag Sequences
644amnonhigher in older adults (total age range 20-80) ( high in age old age compared to young age in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 11
12amnon high in chronic fatigue syndrome compared to control in feces homo sapiens new york county 2016-11-02v4No1 / 18
651amnon high in female compared to male in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 28
63amnon high in diet animal product diet compared to plant based diet in feces homo sapiens united states of america 2017-04-12v4No1 / 32
644amnonnegatively correalted with bmi ( high in low bmi compared to body mass index high bmi in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 42
406amnoncommon feces, united states of america, zoological garden, equus przewalskii, przewalski horse2018-11-21v4No1 / 50
400amnonlower in children of hmong migrands born in the usa compared to non-migrant usa people ( high in united states of america compared to hmong hmong 2nd generation in feces homo sapiens )2018-11-18v4No1 / 52
650amnon high in female compared to male in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 57
644amnon high in female compared to male in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v4No1 / 69
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in feces homo sapiens united states of america adult )2018-02-07v4No1 / 96
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 106
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
197amnon high in finland compared to india in feces homo sapiens juvenile organism obsolete_juvenile stage age 13 2017-09-12v4No1 / 138
759amnon high in canis lupus familiaris dog compared to canis lupus wolf wildlife sactuary in feces united states of america state of minnesota 2021-04-06v4No1 / 148
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in feces homo sapiens united states of america )2017-02-27v4No1 / 149
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in feces farm sus scrofa jinhua city prefecture pig jinhua pig china )2018-12-06v4No1 / 171
399amnon high in control compared to ulcerative colitis in feces homo sapiens united states of america 2018-11-16v4No1 / 180
389amnon high in age 1-3 weeks compared to age 4 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 189
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
256amnonlower in control diet compared to diet enriched with sucram in pig gut ( high in diet sucram compared to standard feed in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 227
388amnon high in age 12-19 weeks compared to age 6-10 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v4No1 / 231
419amnoncommon feces, research facility, rattus norvegicus, sprague dawley, rat, china2018-12-02v4No1 / 254
49amnoncommon feces, giraffa camelopardalis2017-01-19v4No1 / 264
438amnon high in child age 3-6 age 8-12 compared to adult age 30-50 age 60-79 in feces homo sapiens china 2018-12-30v4No1 / 279
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
816amnoncommon feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, early pregnancy2021-07-04v4No1 / 313
518amnonhigher in beginning of experiment ( high in days 1-2 compared to days 14-28 in feces united states of america bos taurus state of georgia cow post-weaning angus steer )2019-06-11v4No1 / 325
759amnoncommon feces, united states of america, farm, sus scrofa, pig, state of vermont2021-04-04v4No1 / 328
816amnoncommon feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, late pregnancy2021-07-04v4No1 / 340
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
781amnon high in syncerus caffer caffer cape buffalo compared to bos taurus cattle in feces kenya wild masai mara national park 2021-04-28v4No1 / 349
442amnoncommon in tnbs induced colitis in rat feces (common feces, research facility, rattus norvegicus, sprague dawley, male, rat, tnbs, colitis, china)2019-01-06v4No1 / 360
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v4No1 / 384
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
781amnoncommon feces, kenya, wild, giraffe, masai mara national park, giraffa tippelskirchi2021-04-28v4No1 / 400
314amnoncommon farm, caecum, sus scrofa, tibet autonomous region, pig, cecal content, china2018-04-10v4No1 / 402
495amnon high in control compared to typhlitis disease intestinal disease in farm caecum gallus gallus kingdom of spain chicken free range chicken 2019-03-03v4No1 / 412
781amnoncommon feces, kenya, wild, masai mara national park, eudorcas thomsonii, thomson's gazelle2021-04-28v4No1 / 425
399amnoncommon feces, united states of america, state of tennessee, zoological garden, ovis aries, sheep2018-11-16v4No1 / 451
424amnoncommon feces, farm, sus scrofa, jinhua city prefecture, pig, jinhua pig, china2018-12-06v4No1 / 452
470amnoncommon feces, female, pregnancy, farm, adult, sus scrofa, canada, province of quebec, pig2019-01-14v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
314amnoncommon farm, caecum, tibet autonomous region, cecal content, tibetan pig, tibetan swine, china2018-04-10v4No1 / 467
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in feces homo sapiens china )2018-12-30v4No1 / 474
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
406amnoncommon feces, zoological garden, french republic, antidorcas marsupialis, springbok2018-11-21v4No1 / 477
256amnoncommon caecum, left colon, right colon, sus scrofa, pig, united kingdom2017-11-26v4No1 / 490
518amnoncommon feces, united states of america, bos taurus, state of georgia, cow, post-weaning, angus steer2019-06-11v4No1 / 498
748amnoncommon feces, united states of america, research facility, bos taurus, cow, female organism, state of mississippi, jersey cow2021-03-10v4No1 / 516
781amnoncommon feces, kenya, syncerus caffer caffer, cape buffalo, wild, masai mara national park2021-04-28v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
748amnoncommon feces, united states of america, research facility, bos taurus, cow, female organism, state of mississippi, holstein dairy cow2021-03-10v4No1 / 577
406amnoncommon feces, united states of america, zoological garden, giraffa camelopardalis, giraffe2018-11-21v4No1 / 581
781amnon high in damaliscus lunatus tsessebe compared to aepyceros melampus impala in feces kenya wild masai mara national park 2021-04-28v4No1 / 599
781amnoncommon feces, kenya, wild, masai mara national park, damaliscus lunatus, tsessebe2021-04-28v4No1 / 622
781amnoncommon feces, bos taurus, kenya, wild, masai mara national park, cattle2021-04-28v4No1 / 662
781amnoncommon feces, kenya, wild, masai mara national park, tragelaphus oryx, eland2021-04-28v4No1 / 666
406amnoncommon feces, south africa, antidorcas marsupialis, springbok2018-11-21v4No1 / 678
157amnoncommon in naers of weened calves (common united states of america, nasal cavity, pair of nares, juvenile organism, bos taurus, calve)2017-07-04v4No1 / 766
466amnoncommon feces, united states of america, farm, bos taurus, state of georgia, cow2019-01-14v4No1 / 783
88amnoncommon feces, south africa, syncerus caffer caffer, cape buffalo2017-03-08v4No1 / 891
193amnonhigher in nares of people working in dairy farms ( high in farm bos taurus compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
466amnonlower in cow feces left in field for 30-60 days compared to initial feces ( high in early timepoints 0-2 days compared to late timepoints 30-60 days in feces united states of america farm bos taurus state of georgia cow )2019-01-14v4No1 / 1329
515amnon high in bulgaria detritivorous beetle compared to poland herbivorous beetle in whole body beetle 2019-04-19v4No1 / 1543
748amnon high in feces compared to rumen ruminal fluid in united states of america research facility bos taurus cow female organism state of mississippi 2021-03-10v4No1 / 2467

Problems / suggestions? Please email info AT dbbact DOT org