Search result for sequence:
TACGTAGGGGGCGAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCTGCTAAGTCTGGAGTGAAAGTCCTGCTTTCAAGGTGGGAATTGCTTTGGATACTGGTGGGCTGGAGTGCAGGAGAGGAAAGCGGAATTACCGG
common ontology terms
term enrichment score
TermScore
feces0.587716
homo sapiens0.507395
adult0.380747
united states of america0.205870
child0.153392
control0.148061
monkey0.143948
china0.142476
zoological garden0.133758
research facility0.117897
female0.114274
rat0.109487
macaca mulatta0.100334
rural community0.097731
male0.091691
rattus norvegicus0.083874
captive0.080383
obsolete_juvenile stage0.080268
kingdom of spain0.071974
homosexual0.071174
msm0.071174
city0.070785
sprague dawley0.070012
italy0.063660
rhesus macaque0.056140
pregnancy0.055517
ovis aries0.054608
israel0.053156
infant0.053156
rumen0.051780
wild0.050473
gorilla gorilla0.050469
gay0.050299
LOWER IN crohn's disease0.050000
sheep0.047891
india0.043073
cayo santiago0.042705
indian rhesus macaque0.042705
obesity0.042343
state of colorado0.040956
puerto rico0.040956
sweden0.038961
heterosexual0.036331
msw0.036331
age 5-13 years0.036166
LOWER IN ulcerative colitis0.036101
LOWER IN infant0.035971
capra hircus0.035842
goat0.035842
ethiopia0.035842
rectal swab0.035524
sus scrofa0.034602
pig0.034602
female organism0.033727
state of california0.033445
colon0.032895
germany0.032538
hunter gatherer0.029162
small village0.029162
estonia0.029091
colombia0.028881
tanzania0.028881
age > 1 year0.028881
chuquisaca department0.028881
age 10-15 years0.028881
europe0.028881
state of new york0.028605
LOWER IN child0.028470
ruminal fluid0.028470
bolivia0.028070
LOWER IN wild0.027939
hiv infection0.027682
age0.027586
caecum0.026316
canada0.025723
skin0.023881
farm0.023599
nigeria0.021938
age 30-500.021938
village0.021938
papio anubis0.021938
lake hulun0.021818
indonesia0.021818
municipality of yogyakarta0.021818
age 4-10 years0.021818
denver0.021818
como zoo0.021818
age 130.021818
LOWER IN age < 1 year0.021818
zambia0.021818
dairy goat0.021818
rattus0.021818
hispanic or latin american0.021583
food allergy0.021583
ecuador0.021583
nanjing city prefecture0.021583
shanxi province0.021583
LOWER IN duodenum0.021505
rectum0.021505
biopsy0.021467
Fraction of dbbact annotations with this term covered by the query
TermScore
homosexual0.833333
msm0.833333
gorilla gorilla0.833333
heterosexual0.800000
msw0.800000
rural community0.800000
gay0.750000
hunter gatherer0.750000
small village0.750000
rattus norvegicus0.700000
rat0.687500
nigeria0.666667
estonia0.666667
age 5-13 years0.666667
age 30-500.666667
metabolic syndrome0.666667
venezuela0.666667
amerindian0.666667
village0.666667
papio anubis0.666667
olive baboon0.666667
LOWER IN pan troglodytes troglodytes0.666667
LOWER IN crohn's disease0.636364
LOWER IN ulcerative colitis0.625000
india0.625000
sprague dawley0.600000
monkey0.600000
LOWER IN infant0.555556
LOWER IN schizophrenia0.500000
jordan0.500000
normal stool0.500000
LOWER IN hard stool0.500000
columbia0.500000
lake hulun0.500000
vulpes corsac0.500000
corsac fox0.500000
centererians0.500000
LOWER IN chronic fatigue syndrome0.500000
new york county0.500000
LOWER IN premature birth0.500000
age<17 years0.500000
high capacity running strain0.500000
LOWER IN low capacity running strain0.500000
age 38 weeks0.500000
bihar state0.500000
midwest region0.500000
zhengzhou city prefecture0.500000
chengdu city prefecture0.500000
gestational age 8-12 weeks0.500000
athlete0.500000
santa catarina state0.500000
indonesia0.500000
municipality of yogyakarta0.500000
LOWER IN constipation0.500000
sri lanka0.500000
age 1-18 years0.500000
age 17-290.500000
colombia0.500000
municipality of reus0.500000
tanzania0.500000
pemba island0.500000
age 4-10 years0.500000
sesame allergy0.500000
denver0.500000
quito0.500000
novosibirsk0.500000
age 200.500000
LOWER IN age 2-4 years0.500000
LOWER IN egypt0.500000
metabolic syndrome x0.500000
milk allergy0.500000
hmong0.500000
LOWER IN commonwealth of massachusetts0.500000
LOWER IN city of boston0.500000
azerbaijan0.500000
third trimester0.500000
age 8-120.500000
LOWER IN inflammatory bowel disease0.500000
non usa born0.500000
LOWER IN usa born0.500000
LOWER IN sesame allergy0.500000
cornell university0.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
macaca mulatta0.500000
age > 1 year0.500000
cayo santiago0.500000
indian rhesus macaque0.500000
LOWER IN human immunodeficiency virus infectious disease0.500000
LOWER IN antiretroviral therapy0.500000
municipality of logrono0.500000
LOWER IN restricted feed0.500000
chuquisaca department0.500000
irritable bowel syndrome0.500000
dog breeding center0.500000
shuar population0.500000
glasgow0.500000
oslo0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.895911
homo sapiens0.643123
adult0.364312
united states of america0.278810
control0.133829
china0.133829
research facility0.122677
child0.096654
monkey0.081784
female0.078067
zoological garden0.078067
male0.059480
rat0.059480
macaca mulatta0.055762
rural community0.052045
captive0.052045
obsolete_juvenile stage0.044610
rattus norvegicus0.044610
italy0.044610
city0.040892
kingdom of spain0.040892
homosexual0.037175
msm0.037175
sprague dawley0.037175
wild0.029740
pregnancy0.029740
israel0.029740
rumen0.029740
ovis aries0.029740
infant0.029740
rhesus macaque0.029740
LOWER IN crohn&#39;s disease0.026022
gay0.026022
sheep0.026022
gorilla gorilla0.026022
india0.022305
sweden0.022305
obesity0.022305
state of colorado0.022305
cayo santiago0.022305
puerto rico0.022305
indian rhesus macaque0.022305
LOWER IN ulcerative colitis0.018587
heterosexual0.018587
msw0.018587
age 5-13 years0.018587
state of california0.018587
germany0.018587
rectal swab0.018587
female organism0.018587
colon0.018587
LOWER IN infant0.018587
sus scrofa0.018587
pig0.018587
capra hircus0.018587
goat0.018587
ethiopia0.018587
caecum0.014870
hiv infection0.014870
state of new york0.014870
estonia0.014870
colombia0.014870
LOWER IN child0.014870
tanzania0.014870
age > 1 year0.014870
bolivia0.014870
chuquisaca department0.014870
farm0.014870
hunter gatherer0.014870
age 10-15 years0.014870
small village0.014870
age0.014870
ruminal fluid0.014870
canada0.014870
europe0.014870
skin0.014870
LOWER IN wild0.014870
mongolia0.011152
winter0.011152
lake hulun0.011152
LOWER IN adult0.011152
vagina0.011152
south korea0.011152
nigeria0.011152
indonesia0.011152
municipality of yogyakarta0.011152
hispanic or latin american0.011152
high bmi0.011152
food allergy0.011152
age 4-10 years0.011152
denver0.011152
ecuador0.011152
age 30-500.011152
thailand0.011152
biopsy0.011152
jiangsu province0.011152
belgium0.011152
nanjing city prefecture0.011152
digesta0.011152
village0.011152
Exp. ID User ID Description Date Region Flag Sequences
502amnon high in control compared to schizophrenia in feces homo sapiens united states of america adult 2019-03-12v4No1 / 14
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child jordan obsolete_juvenile stage 2018-08-30v4No1 / 21
404amnon high in normal stool compared to hard stool in feces homo sapiens city adult columbia 2018-11-20v4No1 / 21
815amnondominant feces, mongolia, winter, wild, lake hulun, vulpes corsac, corsac fox2021-07-04v3No1 / 27
36amnonhigher in centernarians ( high in centererians compared to adult in feces homo sapiens sichuan province )2016-12-06v4No1 / 30
651amnon high in male compared to female in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 31
12amnon high in control compared to chronic fatigue syndrome in feces homo sapiens new york county 2016-11-02v4No1 / 35
191amnonlower in preterm birth vaginal samples ( high in control compared to premature birth in homo sapiens united states of america female pregnancy vagina )2017-09-05v4No1 / 37
297amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years 2018-02-12v4No1 / 38
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v4No1 / 39
300amnon high in high capacity running strain compared to low capacity running strain in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks 2018-02-27v4No1 / 45
570amnoncommon feces, homo sapiens, india, bihar state2019-12-16v3No1 / 46
597amnoncommon feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 46
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
578amnon high in sweden compared to kingdom of spain in feces homo sapiens hiv infection adult gay homosexual msm male 2020-01-14v3No1 / 55
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
720amnoncommon feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 56
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
637amnoncommon feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 61
593amnoncommon feces, homo sapiens, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
380amnoncommon feces, homo sapiens, adult, tibetan plateau, tibet autonomous region2018-10-03v4No1 / 63
575amnoncommon in professional martial arts athletes (common feces, homo sapiens, adult, high physical activity, age 19-24, china, athlete)2020-01-05v3No1 / 63
365amnoncommon feces, homo sapiens, child, nigeria, obsolete_juvenile stage2018-08-30v4No1 / 66
650amnoncommon feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 66
365amnoncommon feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 67
757amnoncommon feces, homo sapiens, adult, brazil, santa catarina state2021-03-28v3No1 / 67
574amnoncommon feces, homo sapiens, adult, russia2020-01-05v3No1 / 68
593amnoncommon feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
419amnon high in control compared to constipation in feces research facility rattus norvegicus sprague dawley rat china 2018-12-02v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
644amnoncommon feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 71
656amnoncommon feces, homo sapiens, sri lanka, age 1-18 years2020-09-13v3No1 / 71
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 74
395amnoncommon feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 75
74amnoncommon feces, homo sapiens, united states of america2017-02-27v4No1 / 76
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, age 17-292019-02-13v4No1 / 76
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
404amnoncommon feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 79
732amnoncommon feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 79
736amnon high in female adult compared to child age 1-3 years in feces homo sapiens tanzania pemba island 2021-01-25v3No1 / 79
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 80
339amnoncommon feces, homo sapiens, adult, india2018-05-24v4No1 / 81
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 82
562amnoncommon feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 82
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, china2028-04-11v3No1 / 82
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 83
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
249amnoncommon feces, homo sapiens, united states of america2017-11-22v4No1 / 86
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 86
344amnoncommon in feces of homosexual males (common feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 87
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, age 202018-12-15v4No1 / 87
723amnonlower in children age 2-4 years compared to mothers ( high in adult compared to child age 2-4 years in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 87
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
487amnoncommon feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 88
293amnoncommon feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 89
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 94
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
759amnoncommon feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 94
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 95
736amnoncommon feces, homo sapiens, female, adult, tanzania, pemba island2021-01-25v3No1 / 95
238amnoncommon feces, homo sapiens, colombia2017-11-07v4No1 / 96
759amnon high in state of new york new york city wild compared to research facility commonwealth of massachusetts city of boston in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 96
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 97
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 97
477amnoncommon feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 103
563amnoncommon feces, homo sapiens, control, united states of america, homosexual, msm, male, rectal swab2019-11-18v4No1 / 103
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china2018-12-30v4No1 / 106
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
644amnonhigher in individuals born in latin america compared to indivuals born in usa ( high in non usa born compared to usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 107
695amnon high in milk allergy compared to sesame allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 107
409amnoncommon feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 108
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
53amnoncommon feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in feces homo sapiens united states of america child )2018-11-22v4No1 / 110
770amnoncommon macaca mulatta, age > 1 year, penis, male organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 110
563amnoncommon feces, homo sapiens, united states of america, hiv infection, homosexual, msm, male, rectal swab2019-11-18v4No1 / 111
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
794amnon high in control compared to hiv infection human immunodeficiency virus infectious disease antiretroviral therapy in feces homo sapiens adult kingdom of spain municipality of logrono 2021-06-08v4No1 / 112
735amnon high in control compared to restricted feed in female pregnancy research facility rumen ovis aries nanjing city prefecture digesta sheep female organism china 2021-01-22v3No1 / 112
517amnoncommon feces, homo sapiens, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 113
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 30-50, china2018-12-30v4No1 / 115
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
753amnoncommon feces, farm, adult, canis lupus familiaris, dog, china, dog breeding center2021-03-12v4No1 / 120
371amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 121
393amnon high in gay homosexual msm compared to heterosexual msw in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 121
660amnoncommon feces, homo sapiens, ecuador, rural community, village, shuar population2020-09-20v4No1 / 123
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay homosexual msm compared to heterosexual msw in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 124
449amnoncommon feces, homo sapiens, colombia2019-01-09v4No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in feces homo sapiens toronto )2016-10-27v4No1 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to child obsolete_juvenile stage crohn's disease in feces homo sapiens glasgow )2017-02-26v4No1 / 125
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 125
753amnon high in farm canis lupus familiaris dog dog breeding center compared to zoological garden captive canis lupus wolf in feces adult china 2021-03-12v4No1 / 127
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
649amnoncommon research facility, ovis aries, new zealand, sheep, lamb, age 6 weeks, colon2020-09-07v3No1 / 128
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, age 30-402018-05-13v4No1 / 130
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
625amnoncommon feces, united states of america, zoological garden, state of minnesota, saguinus imperator, como zoo, emperor tamarin2020-05-16v4No1 / 132
660amnonlower in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in upano valley compared to cross-cutucu in feces homo sapiens ecuador rural community village shuar population )2020-09-20v4No1 / 132
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 132
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 132017-09-12v4No1 / 136
594amnoncommon feces, homo sapiens, adult, rural community, cameroon, ngoantet2020-03-12v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 136
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens juvenile organism obsolete_juvenile stage age 13 2017-09-12v4No1 / 138
770amnon high in vagina female organism compared to penis male organism in macaca mulatta age > 1 year cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 138
797amnon high in child age 2 years compared to infant age 1 year in feces homo sapiens germany formula fed 2021-06-13v3No1 / 139
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 140
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 141
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 145
509amnoncommon feces, homo sapiens, child, nigeria, kebbi state, rural community, age 10-15 years, schistosomiasis, urinary schistosomiasis2019-03-18v4No1 / 146
815amnoncommon feces, mongolia, winter, wild, lake hulun, vulpes corsac, corsac fox2021-07-04v3No1 / 146
15amnoncommon feces, namibia, canis mesomelas2016-11-08v4No1 / 147
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
406amnoncommon feces, south africa, lycaon pictus, african wild dog2018-11-21v4No1 / 147
509amnoncommon feces, homo sapiens, control, child, nigeria, kebbi state, rural community, age 10-15 years2019-03-18v4No1 / 147
594amnoncommon feces, homo sapiens, city, adult, cameroon, yaounde2020-03-12v4No1 / 154
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 157
815amnoncommon feces, mongolia, winter, wild, vulpes vulpes, lake hulun, red fox2021-07-04v3No1 / 160
292amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens adult china 2018-02-05v4No1 / 161
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 162
700amnoncommon feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 164
190amnoncommon feces, homo sapiens, tanzania, hunter gatherer, hadza2017-09-04v4No1 / 169
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
770amnoncommon vagina, macaca mulatta, age > 1 year, female organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 169
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, age 13, india2017-09-12v4No1 / 170
671amnoncommon feces, united states of america, research facility, macaca mulatta, age 3 months, monkey, captive, rhesus macaque2020-09-27v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in feces homo sapiens infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces homo sapiens united states of america 2018-11-16v4No1 / 180
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
620amnoncommon feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 197
411amnoncommon feces, zambia, monkey, wild, papio kindae, kinda baboon2018-11-23v4No1 / 200
584amnoncommon feces, research facility, rattus norvegicus, sprague dawley, type i diabetes mellitus, rat, china, male, induced type 1 diabetes2020-01-31v3No1 / 202
787amnonhigher in excess grain induced rumen acidosis compared to healthy controls ( high in acidosis subacute rumen acidosis compared to control in research facility rumen ruminal fluid capra hircus china shanxi province goat dairy goat )2021-05-23v3No1 / 207
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
669amnon high in age 1 year compared to age 2 months in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 217
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
584amnoncommon feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 221
666amnoncommon feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 223
411amnoncommon feces, zambia, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
404amnon high in bogota medellin metropolitan area compared to municipality of santiago de cali bucaramanga barranquilla in feces homo sapiens city adult colombia 2018-11-20v4No1 / 237
406amnoncommon feces, zoological garden, gorilla gorilla, french republic, monkey, gorilla2018-11-21v4No1 / 239
586amnoncommon feces, research facility, rattus norvegicus, sprague dawley, israel, rat, control diet, male2020-02-09v4No1 / 241
666amnoncommon feces, italy, tapirus terrestris, south american tapir2020-09-25v3No1 / 242
398amnon high in control compared to crohn's disease in feces homo sapiens belgium 2018-11-15v4No1 / 248
429amnoncommon feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, salt, salt rich diet2018-12-13v4No1 / 249
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, age 8 months2020-09-27v4No1 / 252
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in feces homo sapiens infant india )2016-12-19v4No1 / 253
63amnon high in male compared to female in feces homo sapiens united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 263
438amnon high in child age 3-6 age 8-12 compared to adult age 30-50 age 60-79 in feces homo sapiens china 2018-12-30v4No1 / 279
770amnoncommon feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 280
586amnoncommon feces, research facility, rattus norvegicus, sprague dawley, israel, rat, fructose diet, fructose, male2020-02-09v4No1 / 287
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 288
411amnoncommon feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 292
625amnoncommon feces, united states of america, zoological garden, gorilla gorilla, state of minnesota, como zoo2020-05-16v4No1 / 293
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
737amnoncommon research facility, rumen, age 2 months, ruminal fluid, capra hircus, china, hainan autonomous prefecture, goat, hainan black goat2021-01-27v3No1 / 295
331amnoncommon feces, ethiopia, monkey, theropithecus gelada2018-05-13v4No1 / 298
419amnoncommon in rats with induced constipation (common feces, research facility, rattus norvegicus, sprague dawley, rat, constipation, china)2018-12-02v4No1 / 300
770amnon high in age 10-15 years adult organism compared to infant age < 1 year in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 304
666amnoncommon feces, sus scrofa, italy, wild boar2020-09-25v3No1 / 305
723amnon high in age 2-4 years compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
358amnoncommon feces, research facility, rattus, czech republic, rat, wistar rat2018-08-19v4No1 / 309
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in myanmar karen compared to hmong china in feces homo sapiens thailand rural community )2018-11-18v4No1 / 329
729amnon high in zoological garden captive europe pan troglodytes verus eastern chimpanzee compared to pan troglodytes troglodytes cameroon central chimpanzee in feces monkey 2021-01-05v3No1 / 337
190amnon high in wet season compared to dry season in feces homo sapiens tanzania hunter gatherer hadza 2017-09-04v4No1 / 341
666amnoncommon feces, equus caballus, italy, horse2020-09-25v3No1 / 341
729amnoncommon feces, zoological garden, monkey, europe, pan troglodytes verus, western chimpanzee2021-01-05v3No1 / 343
671amnon high in state of california compared to state of oregon in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 355
671amnoncommon feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 356
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chicago, chimpanzee, lincoln park zoo2020-05-06v4No1 / 358
442amnoncommon in tnbs induced colitis in rat feces (common feces, research facility, rattus norvegicus, sprague dawley, male, rat, tnbs, colitis, china)2019-01-06v4No1 / 360
565amnoncommon zoological garden, skin, captive, canada, african lion safari, macropus rufus, red kangaroo2019-11-21v3No1 / 360
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in feces papio zambia monkey baboon 2018-11-23v4No1 / 364
565amnoncommon zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 368
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
442amnoncommon feces, research facility, rattus norvegicus, sprague dawley, male, rat, china2019-01-06v4No1 / 378
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in diet cron diet caloric restriction diet compared to american diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 381
620amnoncommon feces, united states of america, zoological garden, gorilla gorilla, chicago, lincoln park zoo2020-05-06v4No1 / 384
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, state of tennessee, zoological garden, gorilla gorilla2018-11-16v4No1 / 395
770amnoncommon feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 396
399amnoncommon feces, united states of america, state of tennessee, zoological garden, macaca mulatta, macaque2018-11-16v4No1 / 404
666amnoncommon feces, italy, rat, rattus rattus2020-09-25v3No1 / 406
186amnoncommon united states of america, research facility, caecum, sprague dawley, rattus, rat2017-08-23v4No1 / 407
625amnoncommon feces, united states of america, zoological garden, state of minnesota, pongo abelii, sumatran orangutan, como zoo2020-05-16v4No1 / 414
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chimpanzee, saint louis, saint louis zoo2020-05-06v4No1 / 433
666amnoncommon feces, italy, lama guanicoe2020-09-25v3No1 / 437
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, grivet monkey2018-01-16v4No1 / 440
75amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to infant age < 1 year in feces homo sapiens india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
787amnoncommon in high grain diet induced subacute acidosis (common research facility, rumen, ruminal fluid, acidosis, capra hircus, china, shanxi province, goat, dairy goat, subacute rumen acidosis)2021-05-23v3No1 / 463
111amnon high in rectum caecum colon ileum compared to ruminant reticulum omasum rumen in ovis aries mongolian sheep china 2017-04-09v4No1 / 464
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
221amnoncommon feces, research facility, sprague dawley, rattus, rat, china2017-10-25v4No1 / 470
639amnon high in oryctolagus cuniculus european rabbit compared to lepus europaeus european brown hare in feces nature reserve adult australia wild 2020-08-21v3No1 / 480
274amnoncommon feces, ethiopia, monkey, chlorocebus djamdjamensis, bale monkey2018-01-16v4No1 / 489
620amnoncommon feces, united states of america, zoological garden, gorilla gorilla, saint louis, saint louis zoo2020-05-06v4No1 / 530
729amnoncommon feces, zoological garden, gorilla gorilla, monkey, captive, europe2021-01-05v3No1 / 542
666amnoncommon feces, italy, vicugna pacos, alpaca2020-09-25v3No1 / 546
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in feces homo sapiens china )2018-12-30v4No1 / 617
666amnoncommon feces, italy, ovis aries musimon, mouflon2020-09-25v3No1 / 649
729amnon high in zoological garden captive europe compared to wild cameroon in feces gorilla gorilla monkey 2021-01-05v3No1 / 656
565amnoncommon zoological garden, skin, captive, canada, tragelaphus oryx, toronto zoo, eland2019-11-21v3No1 / 674
666amnoncommon feces, italy, capra hircus, goat2020-09-25v3No1 / 674
666amnoncommon feces, italy, equus asinus africanus, african wild ass2020-09-25v3No1 / 683
666amnoncommon feces, ovis aries, italy, sheep2020-09-25v3No1 / 688
787amnoncommon control, research facility, rumen, ruminal fluid, capra hircus, china, shanxi province, goat, dairy goat2021-05-23v3No1 / 700
671amnon high in age 3 months compared to age 1 month in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 714
735amnoncommon female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, restricted feed, sheep, female organism, china2021-01-22v3No1 / 744
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
735amnoncommon control, female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, sheep, female organism, china2021-01-22v3No1 / 761
331amnon high in wet season compared to dry season in feces ethiopia monkey theropithecus gelada 2018-05-13v4No1 / 818
649amnon high in colon compared to ileum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 897
671amnon high in female adult compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 947
701amnoncommon research facility, rumen, bos taurus, male, cow, rumen liquid, male organism, china, municipality of beijing, age 2 years2028-04-01v3No1 / 953
671amnon high in age 8 months compared to age 3 months age 6 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 955
620amnon high in united states of america zoological garden pan troglodytes compared to wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park in feces chimpanzee 2020-05-06v4No1 / 964
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
620amnon high in united states of america zoological garden compared to wild republic of congo nouabale-ndoki national park in feces gorilla gorilla gorilla 2020-05-06v4No1 / 1019
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261

Problems / suggestions? Please email info AT dbbact DOT org