Search result for sequence:
TACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTCAAGTCAGGAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTCTTGAAACTGGGAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT
common ontology terms
term enrichment score
TermScore
infant0.234375
clostridium difficile intestinal infectious disease0.210526
feces0.182696
italy0.147651
hospital0.145897
germany0.137143
clostridium difficile infection0.131868
homo sapiens0.126928
diarrhea0.121212
formula fed0.118812
research facility0.103694
clostridium difficile colitis0.089888
canis lupus familiaris0.088496
maize field0.087912
united states of america0.082355
age0.076923
gallus gallus0.076677
chicken0.076677
dog0.072948
LOWER IN control0.071713
intestine0.069930
adult0.069070
tucson0.067416
omsk0.067416
peking duck0.067416
age 7 months0.067416
lower saxony0.067416
sandy soil0.067416
anas platyrhynchos0.065217
bulk soil0.064171
intestinal contents0.063158
age 1 year0.061224
ph 50.061224
zoological garden0.056872
russia0.056075
mus musculus0.053667
farm0.052288
child0.050847
clostridium difficile0.046512
LOWER IN non c. diff diarrhea0.046512
hexaprotodon liberiensis0.045977
pygmy hippopotamus0.045977
breast fed0.045977
valladolid0.045977
hippopotamus amphibius0.045977
adriatic sea coastal waters of italy0.045977
caretta caretta0.045977
loggerhead sea turtle0.045977
puppy0.045977
lake hulun0.045977
vulpes corsac0.045977
corsac fox0.045977
junco hyemalis0.045977
songbird0.045977
nephrolithiasis0.045977
nanning city prefecture0.045977
age 50-60 years0.045977
rana pipiens0.045977
northern leopard frog0.045977
LOWER IN tadpole0.045455
china0.045420
ursus arctos0.044944
brown bear0.044944
osteopilus septentrionalis0.044944
age < 1 year0.044444
caecum0.044280
age 8 weeks0.043956
india0.043956
state of wisconsin0.043956
new zealand0.043956
lamb0.043956
rectal swab0.043011
mongolia0.043011
commonwealth of virginia0.043011
LOWER IN jejunum0.043011
age 6 weeks0.043011
crohn's disease0.042105
mediterranean sea0.042105
pathogen0.041667
state of minnesota0.041237
antibiotic0.041237
age 3 months0.041237
digesta0.041237
australia0.041096
ileum0.040816
frog0.040404
sus scrofa0.040404
state of michigan0.039604
LOWER IN duodenum0.038835
sheep0.038835
french republic0.038095
LOWER IN adult0.037736
ovis aries0.037383
japan0.036697
mouse0.036254
state of florida0.035398
c57bl/60.034188
winter0.034188
kingdom of spain0.032520
rhizosphere0.031496
Fraction of dbbact annotations with this term covered by the query
TermScore
clostridium difficile intestinal infectious disease0.833333
clostridium difficile infection0.750000
clostridium difficile0.666667
clostridium difficile colitis0.666667
LOWER IN non c. diff diarrhea0.666667
tucson0.500000
omsk0.500000
peking duck0.500000
hexaprotodon liberiensis0.500000
pygmy hippopotamus0.500000
state of louisiana0.500000
breast fed0.500000
LOWER IN formula fed0.500000
after hcst0.500000
hematopoietic stem cell transplant0.500000
LOWER IN before hsct0.500000
LOWER IN age 7 months0.500000
valladolid0.500000
mammalian milk beverage0.500000
hippopotamus amphibius0.500000
adriatic sea coastal waters of italy0.500000
caretta caretta0.500000
loggerhead sea turtle0.500000
age 7 months0.500000
puppy0.500000
LOWER IN age 2-7 years0.500000
lake hulun0.500000
vulpes corsac0.500000
corsac fox0.500000
LOWER IN age &gt; 1 year0.500000
age 0-6 months0.500000
LOWER IN age 2-4 years0.500000
indonesia0.500000
municipality of yogyakarta0.500000
junco hyemalis0.500000
songbird0.500000
panthera tigris0.500000
tiger0.500000
cefoperazone0.500000
age 14-28 days0.500000
nephrolithiasis0.500000
nanning city prefecture0.500000
age 50-60 years0.500000
age 0-10.500000
LOWER IN age 1-20.500000
rana pipiens0.500000
northern leopard frog0.500000
age <1 year0.500000
southern united states0.500000
thamnophis sirtalis0.500000
common garter snake0.500000
cobb broiler chicken0.500000
glasgow0.500000
strain 129s0.500000
maize field0.500000
lower saxony0.500000
sandy soil0.500000
europe0.500000
pan troglodytes verus0.500000
LOWER IN cameroon0.500000
LOWER IN central chimpanzee0.500000
suckling0.500000
preweaned0.500000
age 2-4 weeks0.500000
LOWER IN weaned0.500000
LOWER IN corn and soybean diet0.500000
LOWER IN age 4-7 weeks0.500000
nih 31m chow0.500000
age one year0.500000
LOWER IN age one month0.500000
thyrow0.500000
albic luvisol0.500000
ph 6.40.500000
lettuce0.500000
organic fertilization0.500000
guizhou province0.500000
kaiyang county0.500000
after 6 years0.500000
LOWER IN tadpole0.400000
diarrhea0.375000
humanized mouse0.333333
anas platyrhynchos0.333333
infant0.333333
stress0.333333
ursus arctos0.333333
brown bear0.333333
LOWER IN breast milk0.333333
formula fed0.333333
LOWER IN breast fed0.333333
LOWER IN age 2 months0.333333
LOWER IN age 1 month0.333333
uropygial gland0.333333
LOWER IN age 2 years0.333333
iowa0.333333
osteopilus septentrionalis0.333333
LOWER IN age 1-7 years0.333333
snake0.333333
age 35 days0.333333
LOWER IN age 2 days0.333333
wild boar0.333333
Fraction of annotations for the query sequences containing the term
TermScore
feces0.698795
homo sapiens0.409639
united states of america0.228916
research facility0.192771
infant0.180723
adult0.156627
germany0.144578
italy0.132530
clostridium difficile intestinal infectious disease0.120482
LOWER IN control0.108434
hospital0.096386
clostridium difficile infection0.072289
diarrhea0.072289
china0.072289
formula fed0.072289
canis lupus familiaris0.060241
intestine0.060241
mus musculus0.060241
clostridium difficile colitis0.048193
dog0.048193
farm0.048193
age0.048193
gallus gallus0.048193
chicken0.048193
maize field0.048193
tucson0.036145
anas platyrhynchos0.036145
russia0.036145
intestinal contents0.036145
omsk0.036145
peking duck0.036145
australia0.036145
zoological garden0.036145
age 1 year0.036145
age 7 months0.036145
child0.036145
mouse0.036145
caecum0.036145
bulk soil0.036145
ph 50.036145
lower saxony0.036145
sandy soil0.036145
pathogen0.024096
clostridium difficile0.024096
LOWER IN non c. diff diarrhea0.024096
hexaprotodon liberiensis0.024096
pygmy hippopotamus0.024096
state of minnesota0.024096
antibiotic0.024096
breast fed0.024096
c57bl/60.024096
japan0.024096
crohn's disease0.024096
age 3 months0.024096
state of michigan0.024096
kingdom of spain0.024096
valladolid0.024096
ursus arctos0.024096
brown bear0.024096
hippopotamus amphibius0.024096
mediterranean sea0.024096
adriatic sea coastal waters of italy0.024096
caretta caretta0.024096
loggerhead sea turtle0.024096
age 8 weeks0.024096
puppy0.024096
french republic0.024096
rectal swab0.024096
mongolia0.024096
winter0.024096
wild0.024096
lake hulun0.024096
vulpes corsac0.024096
corsac fox0.024096
age < 1 year0.024096
commonwealth of virginia0.024096
junco hyemalis0.024096
songbird0.024096
LOWER IN adult0.024096
india0.024096
nephrolithiasis0.024096
nanning city prefecture0.024096
age 50-60 years0.024096
LOWER IN tadpole0.024096
state of wisconsin0.024096
digesta0.024096
rana pipiens0.024096
northern leopard frog0.024096
digestive system0.024096
state of florida0.024096
frog0.024096
osteopilus septentrionalis0.024096
ileum0.024096
LOWER IN duodenum0.024096
LOWER IN jejunum0.024096
ovis aries0.024096
new zealand0.024096
sheep0.024096
lamb0.024096
age 6 weeks0.024096
Exp. ID User ID Description Date Region Flag Sequences
325amnonclostridium difficile pathogen (other pathogen, clostridium difficile)2018-04-29v4No1 / 1
728amnonclostridium difficile pathogen (other pathogen, clostridium difficile)2021-01-05v3No1 / 1
689amnon high in clostridium difficile colitis clostridium difficile infection compared to non c. diff diarrhea in feces homo sapiens united states of america hospital diarrhea adult tucson 2028-03-11v4No1 / 3
325amnonhigher in c. diff infeceted humanized mice compared to non-infected controls ( high in clostridium difficile colitis clostridium difficile intestinal infectious disease compared to control in feces united states of america research facility humanized mouse )2018-04-29v4No1 / 4
702amnon high in clostridium difficile infection compared to control in feces united states of america canis lupus familiaris state of north carolina dog 2028-04-02v4No1 / 6
790amnonhigher in ducks supplemented with bacillus based probiotics compared to control diet ( high in probiotics compared to control in farm intestine anas platyrhynchos russia intestinal contents omsk peking duck )2021-06-07v3No1 / 11
666amnondominant feces, italy, hexaprotodon liberiensis, pygmy hippopotamus2020-09-25v3No1 / 13
185amnoncommon in patients with c. diff infection before treatment (common feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
648amnon high in antibiotic metronidazole compared to control in feces united states of america canis lupus familiaris dog state of louisiana 2020-09-06v4No1 / 14
790amnondominant farm, intestine, anas platyrhynchos, russia, intestinal contents, omsk, peking duck2021-06-07v3No1 / 14
797amnon high in breast fed compared to formula fed in feces homo sapiens infant germany age 1 month 2021-06-13v3No1 / 14
42amnonhigher on stressed mice compared to control in c57bl tcr-b deficient mice ( high in stress compared to control in feces research facility mus musculus c57bl/6 japan )2016-12-10v4No1 / 15
779amnon high in crohn's disease compared to control in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 15
655amnon high in after hcst hematopoietic stem cell transplant compared to before hsct in feces homo sapiens italy 2020-09-13v3No1 / 15
797amnon high in age 3 months compared to age 7 months in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 15
94amnoncommon feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 16
728amnoncommon feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 16
666amnondominant feces, italy, ursus arctos, brown bear2020-09-25v3No1 / 18
689amnoncommon feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 19
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in feces homo sapiens infant )2016-12-01v4No1 / 21
390amnondominant feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 21
666amnondominant feces, zoological garden, italy, hippopotamus amphibius2020-09-25v3No1 / 21
728amnondominant feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 21
810amnondominant in sea turtle feces from sea turtle rescue center (dominant feces, research facility, mediterranean sea, italy, adriatic sea coastal waters of italy, caretta caretta, loggerhead sea turtle)2021-06-22v3No1 / 21
94amnondominant feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (dominant feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
689amnondominant feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 22
797amnoncommon feces, homo sapiens, infant, germany, age 1 year, formula fed2021-06-13v3No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 23
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in feces homo sapiens hospital australia diarrhea )2018-11-04v4No1 / 24
766amnon high in age 8 weeks puppy compared to female organism adult organism age 2-7 years in feces canis lupus familiaris french republic dog rectal swab 2021-04-12v4No1 / 27
815amnondominant feces, mongolia, winter, wild, lake hulun, vulpes corsac, corsac fox2021-07-04v3No1 / 27
666amnoncommon feces, italy, ursus arctos, brown bear2020-09-25v3No1 / 29
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 31
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 31
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in age age < 1 year compared to age > 1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 35
284amnon high in age 1 year compared to age 2 months in feces homo sapiens female infant state of california 2018-01-27v4No1 / 35
723amnon high in infant age 0-6 months compared to age 2-4 years in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 37
797amnon high in age 3 months compared to age 1 month in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 39
89amnoncommon uropygial gland, commonwealth of virginia, junco hyemalis, songbird2017-03-08v4No1 / 43
666amnoncommon feces, italy, panthera tigris, tiger2020-09-25v3No1 / 43
797amnon high in age 7 months compared to age 1 year in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 44
89amnoncommon cloaca, commonwealth of virginia, junco hyemalis, songbird2017-03-08v4No1 / 48
339amnon high in infant age < 1 year compared to adult in feces homo sapiens india 2018-05-24v4No1 / 50
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 50
127amnoncommon united states of america, caecum, gallus gallus, chicken, age 14-28 days2017-04-14v4No1 / 51
797amnon high in infant age 1 year compared to child age 2 years in feces homo sapiens germany formula fed 2021-06-13v3No1 / 52
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in feces homo sapiens adult nanning city prefecture age 50-60 years china )2018-01-27v4No1 / 54
45amnonhigher in younf babies compared to 2 year olds in india ( high in age age 0-1 compared to age 1-2 in feces homo sapiens infant india )2016-12-19v4No1 / 56
790amnoncommon farm, intestine, anas platyrhynchos, russia, intestinal contents, omsk, peking duck2021-06-07v3No1 / 61
114amnon high in adult compared to tadpole in united states of america research facility intestine state of wisconsin digesta rana pipiens northern leopard frog 2017-04-10v4No1 / 67
72amnoncommon feces, united states of america, canis lupus familiaris, iowa2017-02-25v4No1 / 69
114amnoncommon united states of america, research facility, intestine, adult, state of wisconsin, digesta, rana pipiens, northern leopard frog2017-04-10v4No1 / 72
810amnoncommon in sea turtle feces from sea turtle rescue center (common feces, research facility, mediterranean sea, italy, adriatic sea coastal waters of italy, caretta caretta, loggerhead sea turtle)2021-06-22v3No1 / 72
322amnoncommon digestive system, united states of america, research facility, adult, state of florida, frog, osteopilus septentrionalis2018-04-23v4No1 / 76
666amnoncommon feces, italy, hexaprotodon liberiensis, pygmy hippopotamus2020-09-25v3No1 / 76
596amnon high in age <1 year compared to age 1-7 years in homo sapiens saliva child sweden 2020-03-18v3No1 / 78
663amnoncommon homo sapiens, lung, bronchoalveolar lavage, adult, poland2020-09-22v4No1 / 84
649amnon high in ileum compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 92
127amnonhigh in old (14-28 days) compared to young (0-3 day) chickens ( high in age old age compared to young age in united states of america caecum gallus gallus chicken )2017-04-14v4No1 / 98
536amnoncommon united states of america, skin, snake, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
744amnon high in ileum compared to caecum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 121
766amnon high in age 8 weeks compared to age 2 days in feces canis lupus familiaris french republic dog rectal swab puppy 2021-04-12v4No1 / 133
666amnoncommon feces, zoological garden, italy, hippopotamus amphibius2020-09-25v3No1 / 146
815amnoncommon feces, mongolia, winter, wild, lake hulun, vulpes corsac, corsac fox2021-07-04v3No1 / 146
322amnon high in adult compared to tadpole in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2018-04-23v4No1 / 163
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
604amnoncommon research facility, gallus gallus, chicken, cecal content, china, caecum2020-04-06v3No1 / 185
42amnoncommon in tcr-b deficient c57bl6 mice (common feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v4No1 / 201
214amnonlower in mice from jackson laboratories compared to taconic farms ( high in taconic farms compared to jackson laboratories in feces united states of america research facility mus musculus mouse strain 129s )2017-10-23v4No1 / 232
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, age 50-60 years, nephrolithiasis, china)2018-01-27v4No1 / 239
761sheryoHigher in bulk soil compared to maize rhizosphere in sandy soil maize field in Germany ( high in bulk soil compared to rhizosphere in germany ph 5 maize field lower saxony sandy soil )2021-04-06v3No1 / 294
666amnoncommon feces, sus scrofa, italy, wild boar2020-09-25v3No1 / 305
729amnon high in zoological garden captive europe pan troglodytes verus eastern chimpanzee compared to pan troglodytes troglodytes cameroon central chimpanzee in feces monkey 2021-01-05v3No1 / 337
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 347
214amnon high in diet mouse chow nih 31m chow compared to high fat diet in feces united states of america research facility mus musculus mouse 2017-10-23v4No1 / 495
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common soil, manured soil, bulk soil, germany, thyrow, pot expreiment, manure fertilization, albic luvisol, ph 6.4, lettuce, organic fertilization)2021-04-07v3No1 / 704
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common rhizosphere, zea mays, germany, ph 5, maize field, lower saxony, sandy soil)2021-04-06v3No1 / 742
761sheryoCommon in bulk sandy soil maize field in Germany (common bulk soil, germany, ph 5, maize field, lower saxony, sandy soil)2021-04-06v3No1 / 835
88amnoncommon feces, south africa, syncerus caffer caffer, cape buffalo2017-03-08v4No1 / 891
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261
631sheryocommon in maize field unamended rhizosphere soil (common soil, rhizosphere, maize field, china, guizhou province, kaiyang county, unamended soil, after 6 years, ph 7.6)2020-06-02v3No1 / 1637

Problems / suggestions? Please email info AT dbbact DOT org