Search result for sequence:
TACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGGAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTCTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAAAGTGGAATTCCTAGT
common ontology terms
term enrichment score
TermScore
feces0.456936
homo sapiens0.341416
china0.254800
adult0.233598
sus scrofa0.166647
pig0.166647
zoological garden0.157756
italy0.146179
farm0.145386
united states of america0.143803
child0.136123
soil0.135962
research facility0.122075
canada0.116977
germany0.113269
control0.090242
skin0.085592
male0.085349
captive0.084760
infant0.084656
gallus gallus0.072898
chicken0.072898
rhizosphere0.071550
ileum0.069028
female0.067802
age 6 weeks0.067542
rural community0.061185
caecum0.060444
kingdom of spain0.054959
kingdom of denmark0.049149
agricultural field0.048750
obsolete_juvenile stage0.045541
bulk soil0.045198
formula fed0.044527
sweden0.043243
african lion safari0.041905
pot expreiment0.041905
pregnancy0.041556
ovis aries0.041045
monkey0.040766
triticum aestivum0.040491
leaf0.039427
canis lupus familiaris0.037348
male organism0.036832
fresh water0.036697
state of michigan0.036496
wild0.036298
maize field0.034951
taiwan0.034951
ph 70.034749
cobb broiler chicken0.034549
province of alberta0.034549
lettuce0.034549
age 35 days0.033962
dog0.033880
sheep0.033771
1-year-old human stage0.031241
2-5 year-old child stage0.030988
toronto zoo0.030829
cow0.030734
tonsil0.030593
united kingdom0.030361
city0.030284
bos taurus0.030177
female organism0.029907
jiangsu province0.029907
intestine0.029553
water0.027762
republic of china0.027264
french republic0.027141
fourth decade human stage0.027079
manured soil0.027079
12-month-old human stage0.026958
river0.026718
new zealand0.026365
lamb0.026365
colon0.026296
israel0.025799
winter0.025799
summer0.025256
small village0.023483
nigeria0.023483
anser cygnoides0.023437
heavy metal0.023437
2-year-old human stage0.023437
rectal swab0.023392
fifth decade human stage0.023301
thyrow0.023301
lund0.023301
clayey till0.023301
late weichselian glaciation0.023301
mongolia0.023166
guangzhou city prefecture0.023166
belgium0.023121
obesity0.023033
haplic luvisol0.023033
loam soil0.023033
autumn0.022684
fish0.022599
bird0.022514
Fraction of dbbact annotations with this term covered by the query
TermScore
sus scrofa0.937500
pig0.937500
1-year-old human stage0.875000
rural community0.800000
maize field0.750000
taiwan0.750000
small village0.750000
nigeria0.750000
age 1-3 years0.750000
LOWER IN under-1-year-old human stage0.714286
zoological garden0.666667
papio anubis0.666667
olive baboon0.666667
anser cygnoides0.666667
pongo abelii0.666667
sumatran orangutan0.666667
heavy metal0.666667
republic of china0.666667
2-year-old human stage0.666667
sigmoid colon0.666667
rheumatoid arthritis0.666667
adolescent stage0.666667
age 5-13 years0.666667
snake0.666667
age 30 days0.666667
toronto0.666667
nanchang city prefecture0.666667
wild boar0.666667
fusarium oxysporum0.666667
LOWER IN pan troglodytes troglodytes0.666667
cambisol0.666667
fertilized soil0.666667
municipality of beijing0.666667
paddy field soil0.666667
yunnan province0.666667
age 6 weeks0.600000
rectal swab0.600000
2-5 year-old child stage0.600000
jejunum0.600000
ph 70.600000
french republic0.545455
denver0.500000
gay0.500000
swan goose0.500000
lower saxony0.500000
sandy soil0.500000
ailurus fulgens0.500000
red panda0.500000
pygoscelis papua0.500000
gentoo penguin0.500000
cobb broiler chicken0.500000
toronto zoo0.500000
trachemys scripta elegans0.500000
red-eared slider turtle0.500000
turtle farm0.500000
milk0.500000
cow milk (fluid)0.500000
cow milk (raw)0.500000
lowland pasture0.500000
lowland farm0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
breast fed0.500000
age 7 months0.500000
salmonella enterica subsp. enterica serovar typhimurium0.500000
salmonellosis0.500000
province of alberta0.500000
short beaked common dolphin0.500000
hexaprotodon liberiensis0.500000
pygmy hippopotamus0.500000
panthera tigris0.500000
tiger0.500000
common bottlenose dolphin0.500000
age 12-19 weeks0.500000
state of louisiana0.500000
rangifer tarandus0.500000
african lion safari0.500000
reindeer0.500000
russia0.500000
intestinal contents0.500000
omsk0.500000
peking duck0.500000
pygoscelis antarcticus0.500000
chinstrap penguin0.500000
anser0.500000
goose0.500000
greylag goose0.500000
como zoo0.500000
reservoir0.500000
xiannv lake0.500000
sediment depth 0-10cm0.500000
late pregnancy0.500000
sus scrofa domesticus0.500000
early pregnancy0.500000
nature reserve0.500000
LOWER IN stunted growth0.500000
janvier labs0.500000
taoyuan city0.500000
mustela putorius furo0.500000
ferret0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.566600
homo sapiens0.349901
china0.208748
adult0.182903
united states of america0.139165
research facility0.119284
soil0.099404
sus scrofa0.091451
pig0.091451
zoological garden0.089463
italy0.087475
farm0.085487
child0.079523
canada0.077535
control0.071571
germany0.069583
male0.059642
skin0.059642
captive0.051690
infant0.047714
female0.041750
rhizosphere0.041750
gallus gallus0.039761
chicken0.039761
ileum0.037773
age 6 weeks0.035785
caecum0.033797
rural community0.031809
kingdom of spain0.029821
kingdom of denmark0.025845
agricultural field0.025845
bulk soil0.023857
formula fed0.023857
sweden0.023857
obsolete_juvenile stage0.023857
monkey0.021869
ovis aries0.021869
african lion safari0.021869
pregnancy0.021869
leaf0.021869
pot expreiment0.021869
triticum aestivum0.021869
male organism0.019881
state of michigan0.019881
canis lupus familiaris0.019881
fresh water0.019881
wild0.019881
maize field0.017893
sheep0.017893
cobb broiler chicken0.017893
age 35 days0.017893
province of alberta0.017893
dog0.017893
taiwan0.017893
lettuce0.017893
ph 70.017893
toronto zoo0.015905
intestine0.015905
bos taurus0.015905
cow0.015905
tonsil0.015905
female organism0.015905
2-5 year-old child stage0.015905
water0.015905
1-year-old human stage0.015905
jiangsu province0.015905
city0.015905
united kingdom0.015905
israel0.013917
winter0.013917
new zealand0.013917
lamb0.013917
summer0.013917
12-month-old human stage0.013917
republic of china0.013917
river0.013917
fourth decade human stage0.013917
colon0.013917
french republic0.013917
manured soil0.013917
anser cygnoides0.011928
bird0.011928
mongolia0.011928
rectal swab0.011928
autumn0.011928
heavy metal0.011928
obesity0.011928
small village0.011928
nigeria0.011928
guangzhou city prefecture0.011928
fifth decade human stage0.011928
2-year-old human stage0.011928
belgium0.011928
fish0.011928
thyrow0.011928
haplic luvisol0.011928
lund0.011928
loam soil0.011928
clayey till0.011928
late weichselian glaciation0.011928
Exp. ID User ID Description Date Region Flag Sequences
831amnon high in control compared to pancreatic cancer in feces homo sapiens adult israel 2021-09-11v3No1 / 5
344amnon high in hiv infection compared to control in feces homo sapiens united states of america state of colorado denver gay homosexual msm 2018-05-31v4No1 / 6
411amnondominant feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 8
417amnondominant feces, anser cygnoides, winter, bird, swan goose, china2018-12-01v4No1 / 8
761sheryoDominant in bulk sandy soil maize field in Germany (dominant bulk soil, germany, ph 5, maize field, lower saxony, sandy soil)2021-04-06v3No1 / 8
399amnondominant feces, united states of america, state of tennessee, zoological garden, ailurus fulgens, red panda2018-11-16v4No1 / 9
649amnondominant research facility, ileum, ovis aries, new zealand, sheep, lamb, age 6 weeks2020-09-07v3No1 / 9
742amnondominant feces, zoological garden, bird, captive, china, dalian city prefecture, pygoscelis papua, gentoo penguin2021-02-18v3No1 / 9
744amnondominant research facility, ileum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 9
417amnondominant feces, mongolia, anser cygnoides, summer, bird, swan goose2018-12-01v4No1 / 10
565amnondominant zoological garden, skin, captive, canada, tragelaphus oryx, toronto zoo, eland2019-11-21v3No1 / 10
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 12-month-old human stage 2021-06-13v3No1 / 10
590amnondominant farm, intestine, age 3-5 weeks, china, hainan autonomous prefecture, trachemys scripta elegans, red-eared slider turtle, turtle farm2020-02-10v4No1 / 11
617amnondominant farm, milk, italy, cow milk (fluid), cow milk (raw), lowland pasture, lowland farm2020-05-03v3No1 / 11
424amnondominant feces, farm, sus scrofa, jinhua city prefecture, pig, jinhua pig, china2018-12-06v4No1 / 12
565amnondominant farm, skin, bos taurus, cow, canada2019-11-21v3No1 / 12
797amnoncommon feces, homo sapiens, infant, germany, breast fed, age 7 months2021-06-13v3No1 / 12
673amnondominant research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 13
785amnondominant research facility, ileum, sus scrofa, state of iowa, pig, age 9 weeks2021-05-16v4No1 / 13
604amnondominant research facility, caecum, gallus gallus, chicken, cecal content, china2020-04-06v3No1 / 13
666amnondominant feces, italy, delphinus delphis, rectal swab, short beaked common dolphin2020-09-25v3No1 / 13
666amnondominant feces, italy, hexaprotodon liberiensis, pygmy hippopotamus2020-09-25v3No1 / 13
666amnondominant feces, italy, panthera tigris, tiger2020-09-25v3No1 / 13
666amnondominant feces, tursiops truncatus, italy, rectal swab, common bottlenose dolphin2020-09-25v3No1 / 13
388amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 12-19 weeks2018-11-03v4No1 / 14
648amnon high in antibiotic metronidazole compared to control in feces united states of america canis lupus familiaris dog state of louisiana 2020-09-06v4No1 / 14
673amnondominant control, research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, province of alberta2020-09-28v4No1 / 14
565amnondominant zoological garden, skin, captive, canada, rangifer tarandus, african lion safari, reindeer2019-11-21v3No1 / 14
790amnondominant farm, intestine, anas platyrhynchos, russia, intestinal contents, omsk, peking duck2021-06-07v3No1 / 14
812amnondominant feces, zoological garden, captive, china, pygoscelis antarcticus, chinstrap penguin2021-06-22v3No1 / 14
336amnondominant feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 15
470amnondominant feces, female, pregnancy, farm, adult, sus scrofa, canada, province of quebec, pig2019-01-14v4No1 / 15
673amnoncommon research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 15
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 1-month-old human stage2021-06-13v3No1 / 15
625amnondominant feces, united states of america, zoological garden, state of minnesota, pongo abelii, sumatran orangutan, como zoo2020-05-16v4No1 / 16
800amnondominant 100-250 days following heavy metal contamination (dominant lake, sediment, fresh water, summer, autumn, heavy metal, reservoir, china, xiannv lake, sediment depth 0-10cm)2021-06-15v4No1 / 16
816amnondominant feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, late pregnancy2021-07-04v4No1 / 16
565amnondominant zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 16
584amnondominant feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 16
666amnondominant feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 16
816amnondominant feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, early pregnancy2021-07-04v4No1 / 17
630amnondominant feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 17
639amnondominant feces, nature reserve, adult, oryctolagus cuniculus, australia, wild, european rabbit2020-08-21v3No1 / 17
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 3-month-old human stage2021-06-13v3No1 / 17
425amnonlower in kids with stunted growth compared to non-stunted ( high in control compared to stunted growth in feces homo sapiens child africa )2018-12-08v4No1 / 18
564amnondominant feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 18
565amnondominant zoological garden, skin, giraffa camelopardalis, giraffe, captive, canada, african lion safari2019-11-21v3No1 / 18
666amnondominant feces, italy, ursus arctos, brown bear2020-09-25v3No1 / 18
744amnondominant research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 18
799amnonhigher before ketogenic diet compared to after ketogenic diet in obese participants ( high in control diet compared to ketogenic diet in feces homo sapiens obesity adult estonia high bmi )2021-06-13v3No1 / 18
60amnondominant feces, anser cygnoides, china2017-02-03v4No1 / 19
522amnondominant feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, mouse chow, age 6 weeks, janvier labs2019-07-03v3No1 / 19
796amnondominant feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 19
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 20
564amnondominant feces, homo sapiens, autistic disorder, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 20
565amnondominant zoological garden, skin, captive, canada, camelus bactrianus, african lion safari, bactrian camel2019-11-21v3No1 / 20
578amnondominant feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 20
666amnondominant feces, canis lupus familiaris, italy, dog2020-09-25v3No1 / 20
797amnoncommon feces, homo sapiens, infant, germany, breast fed, 12-month-old human stage2021-06-13v3No1 / 20
818amnondominant research facility, ileum, gallus gallus, digesta, chicken, intestinal contents, female organism, china, hen, age 60 weeks2021-07-10v3No1 / 20
254amnondominant river, water, fresh water, fujian province, depth 0.5m, jiulong river, china2017-11-23v4No1 / 21
290amnon high in small village rural community compared to city in feces homo sapiens adult china 2018-02-01v4No1 / 21
759amnondominant feces, united states of america, farm, sus scrofa, pig, state of vermont2021-04-04v4No1 / 21
522amnondominant feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, janvier labs, high sugar diet, age 18 weeks2019-07-03v3No1 / 21
666amnondominant feces, zoological garden, italy, hippopotamus amphibius2020-09-25v3No1 / 21
744amnondominant research facility, caecum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 21
810amnondominant in sea turtle feces from sea turtle rescue center (dominant feces, research facility, mediterranean sea, italy, adriatic sea coastal waters of italy, caretta caretta, loggerhead sea turtle)2021-06-22v3No1 / 21
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 8 hours2018-11-04v4No1 / 22
399amnoncommon feces, united states of america, state of tennessee, zoological garden, ailurus fulgens, red panda2018-11-16v4No1 / 22
509amnondominant feces, homo sapiens, control, child, nigeria, kebbi state, rural community, 10-15-years-old human2019-03-18v4No1 / 22
673amnondominant control, research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, province of alberta2020-09-28v4No1 / 22
552amnondominant feces, homo sapiens, czech republic2019-09-05v3No1 / 22
655amnondominant in patients before hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 22
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 22
713amnoncommon feces, homo sapiens, remission, crohn's disease2028-05-21v3No1 / 22
797amnondominant feces, homo sapiens, child, germany, formula fed, 2-year-old human stage2021-06-13v3No1 / 22
568amnondominant feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 12-month-old human stage2021-06-13v3No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 23
365amnondominant feces, homo sapiens, child, sudan, obsolete_juvenile stage2018-08-30v4No1 / 24
641amnoncommon feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
666amnondominant feces, italy, felis silvestris, wild cat2020-09-25v3No1 / 24
713amnoncommon feces, homo sapiens, crohn's disease, active disease2028-05-21v3No1 / 24
745amnondominant feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 24
815amnondominant feces, mongolia, winter, wild, vulpes vulpes, lake hulun, red fox2021-07-04v3No1 / 24
673amnoncommon control, research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, province of alberta2020-09-28v4No1 / 25
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 25
796amnondominant feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 25
797amnondominant feces, homo sapiens, infant, germany, formula fed, 12-month-old human stage2021-06-13v3No1 / 25
785amnoncommon research facility, ileum, sus scrofa, state of iowa, pig, age 9 weeks2021-05-16v4No1 / 26
565amnoncommon skin, felis catus, cat, canada2019-11-21v3No1 / 26
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 26
584amnondominant feces, research facility, rattus norvegicus, sprague dawley, type i diabetes mellitus, rat, china, male, induced type 1 diabetes2020-01-31v3No1 / 26
605amnon high in control compared to recurrent otitis media in nasopharynx child australia age 1-3 years perth 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 27
815amnondominant feces, mongolia, winter, wild, lake hulun, vulpes corsac, corsac fox2021-07-04v3No1 / 27
797amnon high in age 7 months compared to 3-month-old human stage in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 28
666amnoncommon feces, italy, ursus arctos, brown bear2020-09-25v3No1 / 29
723amnoncommon feces, homo sapiens, child, indonesia, municipality of yogyakarta, 2-5 year-old child stage2021-01-02v3No1 / 30
673amnon high in ileum compared to caecum ascending colon in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v4No1 / 31
655amnoncommon in patients before hematopoietic stem cell transplant (common feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 31
681amnondominant feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 31
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 31
666amnoncommon feces, italy, wild, canis lupus, wolf2020-09-25v3No1 / 32
745amnon high in 25-44 year-old human stage compared to human late adulthood stage in feces homo sapiens united states of america adult midwest region 2021-02-25v3No1 / 32
411amnonhigher in wild baboons feeding on discarded human foods ( high in human contact compared to low human contact in feces zambia monkey wild papio kindae kinda baboon )2018-11-23v4No1 / 33
284amnon high in 12-month-old human stage compared to age 2 months in feces homo sapiens female infant state of california 2018-01-27v4No1 / 35
509amnon high in control compared to schistosomiasis urinary schistosomiasis in feces homo sapiens child nigeria kebbi state rural community 10-15-years-old human 2019-03-18v4No1 / 35
669amnoncommon feces, homo sapiens, infant, sweden, 12-month-old human stage2020-09-26v4No1 / 35
233amnon high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens united states of america infant 2017-11-05v4No1 / 37
681amnoncommon feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 37
156amnonhigher in soil and rhizosphere supplemented with struvite ( high in struvite compared to control in soil rhizosphere brassica oleracea brassica china )2017-07-27v4No1 / 38
649amnoncommon research facility, jejunum, ovis aries, new zealand, sheep, lamb, age 6 weeks2020-09-07v3No1 / 38
744amnoncommon research facility, ileum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 38
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
778amnon high in decreased weight bottom weight group compared to increased weight top weight group in farm intestine thailand penaeus monodon black tiger shrimp 2021-04-28v3No1 / 40
825amnoncommon feces, homo sapiens, control, child, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 40
835amnoncommon feces, homo sapiens, adult, japan2021-09-11v3No1 / 40
389amnoncommon united states of america, farm, tonsil, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 41
825amnoncommon feces, homo sapiens, type i diabetes mellitus, child, type 1 diabetes mellitus, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 41
60amnoncommon feces, anser cygnoides, china2017-02-03v4No1 / 42
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 42
389amnoncommon united states of america, farm, vagina, sus scrofa, state of michigan, pig2018-11-04v4No1 / 43
666amnoncommon feces, italy, panthera tigris, tiger2020-09-25v3No1 / 43
831amnoncommon feces, homo sapiens, adult, israel, pancreatic cancer2021-09-11v3No1 / 43
365amnoncommon feces, homo sapiens, child, sudan, obsolete_juvenile stage2018-08-30v4No1 / 44
652amnon high in rheumatoid arthritis compared to control in homo sapiens saliva adult sichuan province china 2020-09-13v3No1 / 44
797amnon high in age 7 months compared to 3-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 44
818amnoncommon research facility, ileum, gallus gallus, digesta, chicken, intestinal contents, female organism, china, hen, age 60 weeks2021-07-10v3No1 / 45
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 46
570amnoncommon feces, homo sapiens, india, bihar state2019-12-16v3No1 / 46
597amnoncommon feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 46
666amnoncommon feces, canis lupus familiaris, italy, dog2020-09-25v3No1 / 46
797amnoncommon feces, homo sapiens, child, germany, formula fed, 2-year-old human stage2021-06-13v3No1 / 46
597amnoncommon feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 47
744amnon high in ileum compared to cloaca in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 47
666amnoncommon feces, italy, delphinus delphis, rectal swab, short beaked common dolphin2020-09-25v3No1 / 48
720amnoncommon feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 48
736amnoncommon feces, homo sapiens, child, tanzania, age 1-3 years, pemba island, 2-year-old human stage, 1-year-old human stage2021-01-25v3No1 / 49
121amnoncommon feces, homo sapiens, adult, bangladesh2017-04-13v4No1 / 50
406amnoncommon feces, united states of america, zoological garden, equus przewalskii, przewalski horse2018-11-21v4No1 / 50
564amnoncommon feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 50
797amnoncommon feces, homo sapiens, child, germany, breast fed, 2-year-old human stage2021-06-13v3No1 / 50
796amnoncommon feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 51
694amnoncommon feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 52
796amnoncommon feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 52
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
649amnoncommon research facility, ileum, ovis aries, new zealand, sheep, lamb, age 6 weeks2020-09-07v3No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 55
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
720amnoncommon feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 56
812amnoncommon feces, zoological garden, captive, china, pygoscelis antarcticus, chinstrap penguin2021-06-22v3No1 / 56
565amnoncommon farm, skin, equus caballus, horse, canada2019-11-21v3No1 / 58
666amnoncommon feces, homo sapiens, italy2020-09-25v3No1 / 58
700amnon high in colon compared to caecum in control research facility sus scrofa belgium pig age 2 months 2028-04-01v3No1 / 59
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 60
831amnoncommon feces, homo sapiens, control, adult, israel2021-09-11v3No1 / 60
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
637amnoncommon feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 61
790amnoncommon farm, intestine, anas platyrhynchos, russia, intestinal contents, omsk, peking duck2021-06-07v3No1 / 61
593amnoncommon feces, homo sapiens, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
575amnoncommon in professional martial arts athletes (common feces, homo sapiens, adult, high physical activity, china, athlete, young adult stage)2020-01-05v3No1 / 63
365amnoncommon feces, homo sapiens, child, nigeria, obsolete_juvenile stage2018-08-30v4No1 / 66
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
365amnoncommon feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 67
757amnoncommon feces, homo sapiens, adult, brazil, santa catarina state2021-03-28v3No1 / 67
417amnoncommon feces, mongolia, anser cygnoides, summer, bird, swan goose2018-12-01v4No1 / 68
574amnoncommon feces, homo sapiens, adult, russia2020-01-05v3No1 / 68
593amnoncommon feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 68
72amnoncommon feces, united states of america, canis lupus familiaris, iowa2017-02-25v4No1 / 69
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 4 days2019-03-03v4No1 / 69
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 1-month-old human stage 2021-06-13v3No1 / 69
417amnoncommon feces, anser cygnoides, winter, bird, swan goose, china2018-12-01v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
742amnoncommon feces, zoological garden, bird, captive, china, dalian city prefecture, pygoscelis papua, gentoo penguin2021-02-18v3No1 / 70
744amnon high in cloaca compared to caecum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 70
656amnoncommon feces, homo sapiens, sri lanka, age 1-18 years, child stage, adolescent stage2020-09-13v3No1 / 71
389amnoncommon united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 72
810amnoncommon in sea turtle feces from sea turtle rescue center (common feces, research facility, mediterranean sea, italy, adriatic sea coastal waters of italy, caretta caretta, loggerhead sea turtle)2021-06-22v3No1 / 72
697amnoncommon female, research facility, oral cavity, sprague dawley, sichuan province, female organism, china2028-03-29v3No1 / 73
832amnoncommon feces, homo sapiens, adult, nigeria, ibadan2021-09-11v4No1 / 74
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 74
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 3-month-old human stage 2021-06-13v3No1 / 75
666amnoncommon feces, italy, hexaprotodon liberiensis, pygmy hippopotamus2020-09-25v3No1 / 76
666amnoncommon feces, tursiops truncatus, italy, rectal swab, common bottlenose dolphin2020-09-25v3No1 / 76
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
529amnoncommon feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 79
732amnoncommon feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 79
736amnon high in female adult compared to child age 1-3 years 2-year-old human stage 1-year-old human stage in feces homo sapiens tanzania pemba island 2021-01-25v3No1 / 79
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 1-3 weeks2018-11-04v4No1 / 80
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 80
339amnoncommon feces, homo sapiens, adult, india2018-05-24v4No1 / 81
361amnoncommon leaf, austria, plant, greenhouse, beaucarnea recurvata2018-08-21v4No1 / 81
522amnon high in high sugar diet age 18 weeks compared to mouse chow age 6 weeks in feces female research facility mus musculus c57bl/6j germany mouse janvier labs 2019-07-03v3No1 / 81
562amnoncommon feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 82
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 82
590amnoncommon farm, intestine, age 3-5 weeks, china, hainan autonomous prefecture, trachemys scripta elegans, red-eared slider turtle, turtle farm2020-02-10v4No1 / 83
648amnoncommon feces, united states of america, canis lupus familiaris, dog, state of louisiana2020-09-06v4No1 / 83
565amnoncommon skin, canis lupus familiaris, dog, canada2019-11-21v3No1 / 83
565amnoncommon zoological garden, skin, captive, canada, eidolon helvum, toronto zoo, fruit bat2019-11-21v3No1 / 83
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
766amnon high in age 2 days compared to age 8 weeks in feces canis lupus familiaris french republic dog rectal swab puppy 2021-04-12v4No1 / 86
336amnoncommon feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 87
477amnoncommon feces, homo sapiens, raji, nepal, himalayas, rural community2019-01-29v4No1 / 88
673amnon high in control compared to salmonella enterica subsp. enterica serovar typhimurium salmonellosis in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 88
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
649amnon high in ileum compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 92
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
363amnoncommon dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 94
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
736amnoncommon feces, homo sapiens, female, adult, tanzania, pemba island2021-01-25v3No1 / 95
565amnoncommon zoological garden, skin, captive, canada, rangifer tarandus, african lion safari, reindeer2019-11-21v3No1 / 96
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, forager, rural community, chepang2019-01-28v4No1 / 97
361amnoncommon leaf, austria, plant, greenhouse, dracaena fragrans2018-08-21v4No1 / 100
363amnon high in rectum caecum colon compared to ruminant reticulum omasum rumen in dairy ovis aries italy obsolete_juvenile stage age 30 days 2018-08-29v4No1 / 101
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
673amnon high in control compared to salmonellosis salmonella enterica subsp. enterica serovar typhimurium in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 104
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 104
301amnoncommon united states of america, colon, canis lupus familiaris, dog2018-03-05v4No1 / 105
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 106
406amnoncommon feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 107
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 109
565amnoncommon zoological garden, skin, captive, canada, pteropus giganteus, african lion safari, indian flying fox2019-11-21v3No1 / 109
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in feces homo sapiens united states of america child )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, 65-79 year-old human stage2018-12-30v4No1 / 111
477amnon high in nepal himalayas rural community compared to united states of america in feces homo sapiens adult 2019-01-28v4No1 / 111
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 112
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
128amnonhigher in ivy leaves from moor compared to forest ( high in moor scrubland compared to forest ecosystem in leaf belgium ivy hedera hibernica )2017-04-14v4No1 / 114
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 12-19 weeks2018-11-03v4No1 / 114
565amnoncommon zoological garden, skin, captive, canada, canis lupus arctos, toronto zoo, arctic wolf2019-11-21v3No1 / 114
744amnoncommon research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 114
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 115
481amnonhigher in channel catfish intestine compared to the growing pond water ( high in intestine ictalurus punctatus fish channel catfish compared to pond water fresh water in united states of america research facility state of alabama )2019-02-12v4No1 / 118
294amnon high in control compared to irritable bowel syndrome in feces homo sapiens adult kingdom of spain 2018-02-09v4No1 / 121
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 121
744amnon high in ileum compared to caecum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 121
565amnoncommon zoological garden, skin, captive, canada, camelus bactrianus, african lion safari, bactrian camel2019-11-21v3No1 / 122
565amnoncommon zoological garden, skin, ceratotherium simum, white rhinoceros, captive, canada, african lion safari2019-11-21v3No1 / 122
565amnoncommon zoological garden, skin, acinonyx jubatus, cheetah, captive, canada, african lion safari2019-11-21v3No1 / 123
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in feces homo sapiens toronto )2016-10-27v4No1 / 125
392amnon high in pre pupae insect diet compared to larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 125
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 126
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to rectum biopsy site biopsy in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 126
522amnoncommon feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, janvier labs, high sugar diet, age 18 weeks2019-07-03v3No1 / 126
590amnoncommon in turtle pond water (common farm, water, pond water, china, hainan autonomous prefecture, turtle farm)2020-02-10v4No1 / 127
649amnoncommon research facility, ovis aries, new zealand, sheep, lamb, age 6 weeks, colon2020-09-07v3No1 / 128
557amnoncommon lake, freshwater lake, water, fresh water, french republic, depth 40m2019-09-14v3No1 / 129
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, fourth decade human stage2018-05-13v4No1 / 130
522amnoncommon feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, mouse chow, age 6 weeks, janvier labs2019-07-03v3No1 / 130
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
392amnon high in pre pupae insect diet compared to defatted larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 134
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v4No1 / 134
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, 13-year-old human stage2017-09-12v4No1 / 136
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in farm caecum tibet autonomous region cecal content china 2018-04-10v4No1 / 136
594amnoncommon feces, homo sapiens, adult, rural community, cameroon, ngoantet2020-03-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
617amnoncommon farm, milk, italy, cow milk (fluid), cow milk (raw), alpine, alpine pasture2020-05-03v3No1 / 137
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in feces homo sapiens united states of america )2017-04-12v4No1 / 141
744amnoncommon research facility, caecum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 141
396amnon high in oncorhynchus mykiss rainbow trout compared to cyprinus carpio common carp in digestive system intestine england fish 2018-11-14v4No1 / 142
62amnon high in egypt compared to united states of america in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 144
509amnoncommon feces, homo sapiens, child, nigeria, kebbi state, rural community, schistosomiasis, urinary schistosomiasis, 10-15-years-old human2019-03-18v4No1 / 146
666amnoncommon feces, zoological garden, italy, hippopotamus amphibius2020-09-25v3No1 / 146
815amnoncommon feces, mongolia, winter, wild, lake hulun, vulpes corsac, corsac fox2021-07-04v3No1 / 146
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
509amnoncommon feces, homo sapiens, control, child, nigeria, kebbi state, rural community, 10-15-years-old human2019-03-18v4No1 / 147
515amnoncommon feces, bulgaria, balkan mountains, whole body, beetle, detritivorous beetle, aphodius haemorrhoidalis2019-04-18v4No1 / 147
759amnon high in canis lupus familiaris dog compared to canis lupus wolf wildlife sactuary in feces united states of america state of minnesota 2021-04-06v4No1 / 148
565amnoncommon zoological garden, skin, panthera leo, lion, captive, canada, toronto zoo2019-11-21v3No1 / 150
481amnoncommon united states of america, research facility, intestine, ictalurus punctatus, state of alabama, channel catfish2019-02-12v4No1 / 151
392amnon high in pre pupae insect diet compared to fishmeal diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 153
361amnoncommon leaf, austria, plant, greenhouse, howea forsteriana2018-08-21v4No1 / 154
594amnoncommon feces, homo sapiens, city, adult, cameroon, yaounde2020-03-12v4No1 / 154
673amnoncommon control, research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, province of alberta2020-09-28v4No1 / 154
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 155
361amnoncommon leaf, austria, plant, greenhouse, dracaena draco2018-08-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, bile, gallbladder, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
815amnoncommon feces, mongolia, winter, wild, vulpes vulpes, lake hulun, red fox2021-07-04v3No1 / 160
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 162
159amnoncommon midgut, australia, siganidae, rabbitfish2017-07-06v4No1 / 169
190amnoncommon feces, homo sapiens, tanzania, hunter gatherer, hadza2017-09-04v4No1 / 169
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years 2-year-old human stage 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant )2017-11-13v4No1 / 173
565amnoncommon zoological garden, skin, captive, pongo abelii, canada, toronto zoo, sumatran orangutan2019-11-21v3No1 / 174
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol compared to npk fertilized from Germany ( high in manured soil manure fertilization organic fertilization compared to npk fertilization mineral fertilization in soil bulk soil germany thyrow pot expreiment albic luvisol ph 6.4 lettuce )2021-04-07v3No1 / 176
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
604amnoncommon research facility, caecum, gallus gallus, chicken, cecal content, china2020-04-06v3No1 / 185
389amnon high in age 1-3 weeks compared to age 4 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 189
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
620amnoncommon feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 197
411amnoncommon feces, zambia, monkey, wild, papio kindae, kinda baboon2018-11-23v4No1 / 200
584amnoncommon feces, research facility, rattus norvegicus, sprague dawley, type i diabetes mellitus, rat, china, male, induced type 1 diabetes2020-01-31v3No1 / 202
565amnoncommon zoological garden, skin, captive, canada, ammotragus lervia, african lion safari, barbary sheep2019-11-21v3No1 / 205
603amnonlower in inital batches of baijiu fermentation pit mud ( high in days 180-270 compared to days 0-90 in mud fermentation pit mud china hefei city prefecture baijiu )2020-04-05v3No1 / 205
568amnon high in thailand compared to viet nam in feces gallus gallus chicken broiler chicken 2019-12-08v3No1 / 206
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
159amnoncommon hindgut, australia, siganidae, rabbitfish2017-07-06v4No1 / 208
360amnoncommon desert, leaf, mexico, guanajuato, agave, agave tequiliana, leaf surface, cultivated environment2018-08-21v4No1 / 210
755sheryocommon in wild soybean (Glycine soja) rhizosphere (common soil, rhizosphere, ph 7, black soil, glycine soja, china, jilin province)2021-03-18v3No1 / 210
669amnon high in 12-month-old human stage compared to 2-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
466amnoncommon in cow feces left in field for 30-60 days (common feces, united states of america, farm, bos taurus, state of georgia, cow, late timepoints, 30-60 days)2019-01-14v4No1 / 221
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
584amnoncommon feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 221
666amnoncommon feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 223
411amnoncommon feces, zambia, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
388amnon high in age 12-19 weeks compared to age 6-10 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v4No1 / 231
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
755sheryocommon in domesticated soybean (Glycine max) rhizosphere (common soil, rhizosphere, glycine max, ph 7, black soil, china, jilin province)2021-03-18v3No1 / 234
404amnon high in bogota medellin metropolitan area compared to municipality of santiago de cali bucaramanga barranquilla in feces homo sapiens city adult colombia 2018-11-20v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
406amnoncommon feces, zoological garden, gorilla gorilla, french republic, monkey, gorilla2018-11-21v4No1 / 239
807amnoncommon surface water, sea water, autumn, near shore, filtered 0.2um, japan, okinawa islands, normal weather2021-06-20v3No1 / 240
398amnon high in control compared to crohn's disease in feces homo sapiens belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant india )2016-12-19v4No1 / 253
617amnoncommon farm, milk, italy, cow milk (fluid), cow milk (raw), lowland pasture, lowland farm2020-05-03v3No1 / 257
759amnon high in farm pig state of vermont compared to state of alabama wild wild boar in feces united states of america sus scrofa 2021-04-04v4No1 / 258
63amnon high in male compared to female in feces homo sapiens united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common air, french republic, autumn, cloud)2017-11-22v4No1 / 267
137amnon high in adult compared to juvenile stage in feces united states of america state of florida gopherus polyphemus gopher tortoise 2017-04-17v4No1 / 277
406amnonhigher in captive white rhinoceros compared to wild ( high in zoological garden french republic compared to south africa wild in feces ceratotherium simum white rhinoceros bovidae )2018-11-21v4No1 / 277
688amnoncommon feces, research facility, sus scrofa, nanchang city prefecture, pig, china, duroc pig, age 140 days2028-03-09v4No1 / 278
438amnon high in child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage compared to adult 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china 2018-12-30v4No1 / 279
770amnoncommon feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 280
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common soil, rhizosphere, switzerland, thyrow, pot expreiment, npk fertilization, lettuce, mineral fertilization, haplic luvisol)2021-04-08v3No1 / 286
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 288
551amnon high in diet clover hay diet compared to fresh clover diet in rumen adult egypt camel camelus dromedarius 2019-08-27v3No1 / 291
156amnoncommon leaf, brassica oleracea, brassica, phyllosphere, china2017-07-27v4No1 / 292
411amnoncommon feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 292
761sheryoHigher in bulk soil compared to maize rhizosphere in sandy soil maize field in Germany ( high in bulk soil compared to rhizosphere in germany ph 5 maize field lower saxony sandy soil )2021-04-06v3No1 / 294
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in organic fertilized compared to npk fertilized haplic luvisol Switzerland ( high in manured soil manure fertilization organic fertilization bio-dynamic fertilizer compared to npk fertilization mineral fertilization in soil bulk soil switzerland pot expreiment lettuce haplic luvisol therwil )2021-04-07v3No1 / 294
780amnoncommon research facility, caecum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 294
827sheryoHigher in soil depth of 60cm compared to soil depth of 275cm in clayey till loam soil, Lund Denmark ( high in depth 20-120cm compared to depth 200-350cm in kingdom of denmark agricultural field lund loam soil clayey till late weichselian glaciation )2021-09-13v3No1 / 295
53amnon high in el salvador small village compared to lima shantytown in feces homo sapiens city 2017-01-21v4No1 / 296
666amnoncommon feces, sus scrofa, italy, wild boar2020-09-25v3No1 / 305
723amnon high in 2-5 year-old child stage compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
751sheryoCommon in tomato soil infected with Fusarium oxysporum (common soil, solanum lycopersicum, fusarium oxysporum, shandong province, china, luojiazhuang)2021-03-11v3No1 / 305
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 306
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 306
565amnoncommon zoological garden, skin, giraffa camelopardalis, giraffe, captive, canada, african lion safari2019-11-21v3No1 / 310
190amnon high in dry season compared to wet season in feces homo sapiens tanzania hunter gatherer hadza 2017-09-04v4No1 / 311
816amnoncommon feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, early pregnancy2021-07-04v4No1 / 313
565amnoncommon farm, skin, bos taurus, cow, canada2019-11-21v3No1 / 318
827sheryoCommon in soil at 575cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 550-600cm)2021-09-13v3No1 / 318
399amnoncommon feces, united states of america, state of tennessee, zoological garden, sus scrofa, pig2018-11-16v4No1 / 319
568amnoncommon feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 320
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
759amnoncommon feces, united states of america, farm, sus scrofa, pig, state of vermont2021-04-04v4No1 / 328
565amnoncommon farm, skin, canada, equus asinus africanus, donkey2019-11-21v3No1 / 335
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
729amnon high in zoological garden captive europe pan troglodytes verus eastern chimpanzee compared to pan troglodytes troglodytes cameroon central chimpanzee in feces monkey 2021-01-05v3No1 / 337
649amnon high in ileum compared to colon in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 338
816amnoncommon feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, late pregnancy2021-07-04v4No1 / 340
729amnoncommon feces, zoological garden, monkey, europe, pan troglodytes verus, western chimpanzee2021-01-05v3No1 / 343
254amnoncommon river, water, fresh water, fujian province, depth 0.5m, jiulong river, china2017-11-23v4No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in populated place city upstream compared to downstream in river water fresh water fujian province depth 0.5m jiulong river china )2017-11-23v4No1 / 356
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chicago, chimpanzee, lincoln park zoo2020-05-06v4No1 / 358
565amnoncommon zoological garden, skin, captive, canada, african lion safari, macropus rufus, red kangaroo2019-11-21v3No1 / 360
759amnoncommon feces, united states of america, sus scrofa, state of alabama, wild, wild boar2021-04-04v4No1 / 362
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in feces papio zambia monkey baboon 2018-11-23v4No1 / 364
565amnoncommon zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 368
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
816amnonhigher in sows in first pregnancy compared to later pregnancies ( high in first pregnancy compared to multiple pregnancies in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 374
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in feces homo sapiens )2018-11-18v4No1 / 378
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in diet cron diet caloric restriction diet compared to american diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 381
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
412amnonhigh in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in manured soil compared to non-manured soil in soil cambisol red soil zea mays triticum aestivum hunan province china )2018-11-26v4No1 / 395
314amnoncommon farm, caecum, sus scrofa, tibet autonomous region, pig, cecal content, china2018-04-10v4No1 / 402
666amnoncommon feces, italy, rat, rattus rattus2020-09-25v3No1 / 406
399amnoncommon feces, united states of america, state of tennessee, zoological garden, pan troglodytes, chimpanzee2018-11-16v4No1 / 407
800amnoncommon 100-250 days following heavy metal contamination (common lake, sediment, fresh water, summer, autumn, heavy metal, reservoir, china, xiannv lake, sediment depth 0-10cm)2021-06-15v4No1 / 412
625amnoncommon feces, united states of america, zoological garden, state of minnesota, pongo abelii, sumatran orangutan, como zoo2020-05-16v4No1 / 414
755sheryocommon in domesticated rice (Oryza stavia) rhizosphere (common soil, rhizosphere, oryza sativa, ph 7, black soil, china, jilin province)2021-03-18v3No1 / 415
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
466amnonhigher in shaded compared to unshaded samples in cow feces left in field for 30-60 days ( high in shaded compared to unshaded sunlight in feces united states of america farm bos taurus state of georgia cow late timepoints 30-60 days )2019-01-14v4No1 / 432
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chimpanzee, saint louis, saint louis zoo2020-05-06v4No1 / 433
666amnoncommon feces, italy, lama guanicoe2020-09-25v3No1 / 437
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
807amnoncommon surface water, sea water, autumn, near shore, filtered 0.2um, storm, japan, okinawa islands, typhoon2021-06-20v3No1 / 447
702amnoncommon feces, united states of america, ovis aries, state of north carolina, sheep2028-04-02v4No1 / 450
424amnoncommon feces, farm, sus scrofa, jinhua city prefecture, pig, jinhua pig, china2018-12-06v4No1 / 452
762sheryocommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common soil, manured soil, rhizosphere, switzerland, thyrow, pot expreiment, manure fertilization, lettuce, organic fertilization, haplic luvisol, bio-dynamic fertilizer)2021-04-08v3No1 / 455
339amnon high in adult compared to infant under-1-year-old human stage in feces homo sapiens india 2018-05-24v4No1 / 457
470amnoncommon feces, female, pregnancy, farm, adult, sus scrofa, canada, province of quebec, pig2019-01-14v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
128amnoncommon city, dense settlement biome, leaf, belgium, ivy, hedera hibernica2017-04-14v4No1 / 461
504amnon high in water sea water compared to sediment marine sediment in nan'ao island china 2019-03-14v4No1 / 462
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnonhigher in centenarians compared to adults ( high in age >94 ninth decade human stage tenth decade human stage compared to 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 474
738amnon high in age 30 days compared to age 1 week in caecum gallus gallus chicken united kingdom 2021-01-30v3No1 / 474
666amnoncommon feces, bos taurus, italy, cow2020-09-25v3No1 / 482
617amnonlower in cow milk of cows in alpine pasture compared to lowland farm ( high in lowland pasture lowland farm compared to alpine alpine pasture in farm milk italy cow milk (fluid) cow milk (raw) )2020-05-03v3No1 / 484
256amnoncommon caecum, left colon, right colon, sus scrofa, pig, united kingdom2017-11-26v4No1 / 490
259amnonhigher in manured soil compared to non-manured ( high in manured soil compared to non-manured in soil fertilized soil rhizosphere arachis hypogaea ph 5 peanut china )2017-12-02v4No1 / 497
762sheryocommin in bulk soil of a pot experiment with lettuce planted in npk fertilzed albic luvisol from Germany (common soil, bulk soil, germany, thyrow, pot expreiment, npk fertilization, albic luvisol, ph 6.4, lettuce, mineral fertilization)2021-04-07v3No1 / 531
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 0-90)2020-04-05v3No1 / 542
729amnoncommon feces, zoological garden, gorilla gorilla, monkey, captive, europe2021-01-05v3No1 / 542
725amnon high in subgingival plaque subgingival dental plaque compared to mouth mucosa buccal mucosa in homo sapiens adult china municipality of beijing 2021-01-03v3No1 / 544
666amnoncommon feces, italy, vicugna pacos, alpaca2020-09-25v3No1 / 546
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in feces homo sapiens child africa 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 567
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in soil germany thyrow pot expreiment albic luvisol lettuce haplic luvisol )2021-04-08v3No1 / 578
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common soil, manured soil, bulk soil, switzerland, pot expreiment, manure fertilization, lettuce, organic fertilization, haplic luvisol, therwil, bio-dynamic fertilizer, ph 6.6)2021-04-07v3No1 / 602
603amnoncommon in baijiu fermentation pit mud in later batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 180-270)2020-04-05v3No1 / 608
518amnonhigher in end of experiment (older steers) ( high in days 14-28 compared to days 1-2 in feces united states of america bos taurus state of georgia cow post-weaning angus steer )2019-06-11v4No1 / 609
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617
128amnoncommon moor, scrubland, leaf, belgium, ivy, hedera hibernica2017-04-14v4No1 / 623
698amnoncommon park, rhizosphere, depth 0-30cm, united kingdom, london, quercus, ph 4-4.5, oak, depth (soil) 0-20cm2028-04-01v3No1 / 623
829sheryoHigher in soil depth of 0-56cm compared to soil depth of 56-140cm in Mollisol soil, Dekalb, Illinois, united states of america ( high in depth 0-56 compared to depth 56-140 in united states of america soil state of illinois mollisol silt loam dekalb county illinois )2021-08-26v3No1 / 631
800amnonhigher at 100-250 days compared to 7-28 days following heavy metal contamination ( high in summer autumn compared to spring in lake sediment fresh water heavy metal reservoir china xiannv lake sediment depth 0-10cm )2021-06-15v4No1 / 644
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common soil, bulk soil, switzerland, ph 5.6, pot expreiment, npk fertilization, lettuce, mineral fertilization, haplic luvisol, therwil)2021-04-07v3No1 / 648
666amnoncommon feces, italy, ovis aries musimon, mouflon2020-09-25v3No1 / 649
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 42020-04-22v4No1 / 655
729amnon high in zoological garden captive europe compared to wild cameroon in feces gorilla gorilla monkey 2021-01-05v3No1 / 656
565amnoncommon zoological garden, skin, captive, canada, tragelaphus oryx, toronto zoo, eland2019-11-21v3No1 / 674
666amnoncommon feces, italy, capra hircus, goat2020-09-25v3No1 / 674
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned corn and soybean diet age 4-7 weeks compared to suckling preweaned age 2-4 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 681
666amnoncommon feces, ovis aries, italy, sheep2020-09-25v3No1 / 688
128amnoncommon leaf, belgium, ivy, forest ecosystem, hedera hibernica2017-04-14v4No1 / 693
754sheryoCommon in soil planted with cucmber, fertilized with bioorganic fertilizer (Bacillus amyloliquefaciens SQR 9) and infected with Fusarium oxysporum f. sp. cucumerinum (common soil, zhejiang province, cucumber, fusarium oxysporum, china, bio-organic fertilizer, bacillus amyloliquefaciens sqr9)2021-03-15v3No1 / 701
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common soil, manured soil, bulk soil, germany, thyrow, pot expreiment, manure fertilization, albic luvisol, ph 6.4, lettuce, organic fertilization)2021-04-07v3No1 / 704
758amnon high in swisher sweets original cigar swisher sweets sweet cherry cigar compared to cheyenne full flavor cigar cheyenne menthol box cigar in nicotiana tabacum cigar tobacco 2021-03-28v3No1 / 710
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 5-6, cultivated environment, china2018-12-04v4No1 / 726
752sheryoCommon in soil planted with Panax notoginseng (common soil, yunnan province, ph 6, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 730
793amnoncommon rhizosphere, mangrove biome, kenya, depth 0-20cm, mangrove, sonneratia alba2021-06-08v3No1 / 733
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common rhizosphere, zea mays, germany, ph 5, maize field, lower saxony, sandy soil)2021-04-06v3No1 / 742
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
466amnoncommon feces, united states of america, farm, bos taurus, state of georgia, cow2019-01-14v4No1 / 783
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common soil, yunnan province, ph 6, biochar, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 783
827sheryoCommon in soil at 465cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 450-480cm)2021-09-13v3No1 / 786
384amnon high in nasal cavity pair of nares compared to saliva oral cavity mouth in farm equus caballus canada horse 2018-10-22v4No1 / 791
422amnoncommon soil, paddy field soil, oryza sativa, yunnan province, cultivated environment, china2018-12-02v4No1 / 821
761sheryoCommon in bulk sandy soil maize field in Germany (common bulk soil, germany, ph 5, maize field, lower saxony, sandy soil)2021-04-06v3No1 / 835
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
698amnoncommon park, rhizosphere, disease, ph 5-6, depth 0-30cm, united kingdom, quercus, oak, acute oak decline, plant disease, depth (soil) 0-20cm2028-04-01v3No1 / 848
412amnoncommon soil, cambisol, red soil, zea mays, triticum aestivum, hunan province, ph>5, china2018-11-26v4No1 / 856
827sheryoCommon in soil at 325cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 300-350cm)2021-08-24v3No1 / 866
793amnoncommon rhizosphere, mangrove biome, kenya, depth 0-20cm, mangrove, rhizophora mucronata2021-06-08v3No1 / 900
807amnoncommon surface water, sea water, summer, near shore, filtered 0.2um, tropical storm, japan, okinawa islands2021-06-20v3No1 / 905
701amnoncommon research facility, rumen, bos taurus, male, cow, rumen liquid, male organism, china, municipality of beijing, age 2 years2028-04-01v3No1 / 953
620amnon high in united states of america zoological garden pan troglodytes compared to wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park in feces chimpanzee 2020-05-06v4No1 / 964
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, china, ryegrass, days 30-40)2020-05-11v4No1 / 966
823sheryoHigher at 15-30cm depth compared to 50-90cm depth in foot slope ultisol soil in auburn, alabama ( high in depth 15-30cm compared to depth 50-90cm in soil agricultural field ultisol auburn alabama foot slope )2021-08-08v3No1 / 968
675sheryoCommon in watermelon rhizosphere soil (common rhizosphere, ph 7, citrullus lanatus, china, co culture with wheat (triticum aestivum l.), un-inoculated)2028-02-22v4No1 / 980
610sheryoCommon in agricultural field soil amended with straw (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, straw)2020-04-21v3No1 / 998
412amnon high in ph>5 compared to ph<5 in soil cambisol red soil zea mays triticum aestivum hunan province china 2018-11-26v4No1 / 1005
610sheryoCommon in agricultural field soil amended with low biochar (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, low biochar)2020-04-21v3No1 / 1009
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, biochar, china, ryegrass, days 30-40)2020-05-11v4No1 / 1017
768sheryoCommon in maize fields in Brittany, France (common soil, cambisol, zea mays, french republic, maize field, bretagne region)2021-04-18v3No1 / 1034
610sheryoCommon in agricultural field soil (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field)2020-04-21v3No1 / 1053
610sheryoCommon in agricultural field soil amended with high biochar (common soil, triticum aestivum, kingdom of denmark, wheat, ph 7, agricultural field, high biochar)2020-04-21v3No1 / 1079
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic)2017-11-22v4No1 / 1081
827sheryoCommon in soil at 25cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, depth (soil) 20-30cm, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, plough layer )2021-08-24v3No1 / 1111
698amnoncommon control, park, rhizosphere, ph 6-7, depth 0-30cm, united kingdom, quercus, oak, depth (soil) 0-20cm2028-04-01v3No1 / 1115
764sheryocommon in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (common soil, triticum aestivum, brassica napus, germany, ph 7.6, bernburg, crop rotation, rapeseed pre-crop)2021-04-12v3No1 / 1129
764sheryoCommon in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, crop rotation, conservation tillage, cultivator tillage)2021-04-12v3No1 / 1140
827sheryoCommon in soil at 95cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 70-120cm, sandy till )2021-08-24v3No1 / 1142
252amnoncommon in river sand biofilm (common river, biofilm, sand, kingdom of spain)2017-11-22v4No1 / 1181
807amnon high in tropical storm compared to normal weather in surface water sea water summer near shore filtered 0.2um japan okinawa islands 2021-06-20v3No1 / 1191
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
823sheryoCommon at 0-15cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, depth 0-15cm, foot slope )2021-08-08v3No1 / 1199
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, loess chernozem, conventional tillage, mouldboard plough, crop rotation)2021-04-12v3No1 / 1213
823sheryoCommon at 15-30cm depth in foot slope ultisol soil in auburn, alabama (common soil, agricultural field, ultisol, auburn, alabama, depth 15-30cm, foot slope )2021-08-08v3No1 / 1218
531amnoncommon farm, greenhouse soil, rhizosphere, cucumis sativus, orthic anthrosol, cucumber, china2019-07-21v3No1 / 1223
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common soil, triticum aestivum, germany, ph 7.6, bernburg, crop rotation, maize pre-crop)2021-04-12v3No1 / 1225
798amnoncommon orchard, soil, italy, depth 10 cm, ph 7-8, apennine mountains, prunus armeniaca, apricot, depth (soil) 0-20cm2021-06-13v3No1 / 1230
800amnoncommon 7-18 days following heavy metal contamination (common lake, sediment, fresh water, heavy metal, reservoir, china, xiannv lake, sediment depth 0-10cm, spring)2021-06-15v4No1 / 1248
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261
675sheryoCommon in watermelon rhizosphere soil inoculated with Fusarium oxysporum f. sp. niveum (common rhizosphere, ph 7, citrullus lanatus, china, co culture with wheat (triticum aestivum l.), inoculated with fusarium oxysporum f. sp. niveum)2028-02-22v4No1 / 1271
616amnoncommon in topsoil of non-fertilized sugarcane field (common soil, topsoil, guangzhou city prefecture, non-fertilized soil, depth 0-20cm, china, saccharum, sugarcane, ph 6.7)2020-04-27v3No1 / 1277
798amnon high in soil ph 7-8 compared to hay plant litter litter bag in orchard italy depth 10 cm apennine mountains prunus armeniaca apricot depth (soil) 0-20cm 2021-06-13v3No1 / 1285
631sheryoCommon in maize field biochar amended rhizosphere soil (common soil, rhizosphere, maize field, biochar, china, guizhou province, kaiyang county, after 6 years, ph 7.85)2020-06-02v3No1 / 1492
515amnon high in bulgaria detritivorous beetle compared to poland herbivorous beetle in whole body beetle 2019-04-19v4No1 / 1543
137amnoncommon feces, united states of america, state of florida, gopherus polyphemus, gopher tortoise2017-04-17v4No1 / 1622
665amnon high in inlet compared to outlet in united states of america state of california late time points biomat microbial biomat water treatment pond benthic biomat engineered wetland 2020-09-23v4No1 / 1629
631sheryocommon in maize field unamended rhizosphere soil (common soil, rhizosphere, maize field, china, guizhou province, kaiyang county, unamended soil, after 6 years, ph 7.6)2020-06-02v3No1 / 1637
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common soil, fertilized soil, topsoil, guangzhou city prefecture, depth 0-20cm, china, saccharum, sugarcane, ph 5.5-6)2020-04-27v3No1 / 1710
536amnon high in aquatic snake compared to terrestrial snake in united states of america skin snake southern united states 2019-07-28v4No1 / 1772
631sheryoCommon in maize field unamended bulk soil (common soil, bulk soil, maize field, china, guizhou province, kaiyang county, unamended soil, ph 7.9)2020-06-02v3No1 / 1814
631sheryocommon in maize field biochar amended bulk soil, after 6 years of biochar amended (common soil, bulk soil, maize field, biochar, china, guizhou province, kaiyang county, after 6 years, ph 8)2020-06-02v3No1 / 1872
156amnoncommon soil, rhizosphere, brassica oleracea, brassica, china2017-07-27v4No1 / 1885
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
443amnon high in particles filtered 2.7um compared to free floating filtered 0.2um in united states of america river water fresh water mississippi river depth 1m 2019-01-07v4No1 / 2266
166amnoncommon in river sediment (5cm) without mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877

Problems / suggestions? Please email info AT dbbact DOT org