Search result for sequence:
TACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT
common ontology terms
term enrichment score
TermScore
homo sapiens0.592960
adult0.408754
feces0.312074
saliva0.271493
united states of america0.264262
china0.118778
child0.117264
city0.087273
skin0.087165
infant0.073723
lung0.071429
state of california0.070175
hospital0.069364
female0.068563
bronchial epithelium0.064777
ulcerative colitis0.056090
rural community0.055777
control0.052022
mouth0.049866
LOWER IN control0.049383
bronchoalveolar lavage0.048900
sputum0.048583
bolivia0.048193
oral wash0.047809
poland0.047059
obsolete_juvenile stage0.046693
italy0.043956
sweden0.043478
jiangsu province0.043011
state of new york0.040486
india0.040486
state of michigan0.040282
state of colorado0.039947
crohn's disease0.039683
kingdom of the netherlands0.039683
united kingdom0.038911
commonwealth of pennsylvania0.038536
kingdom of spain0.036991
atlanta0.032922
oropharynx0.032653
LOWER IN mouth mucosa0.032653
mild disease course0.032653
state of new hampshire0.032653
acute respiratory failure0.032653
colombia0.032653
amsterdam0.032653
municipality of umea0.032653
diarrhea0.032301
respiratory failure0.032129
duodenum0.031788
sichuan province0.031621
south korea0.031455
cystic fibrosis0.031128
research facility0.029542
canada0.028674
australia0.028674
bronchus0.024845
skin of cheek0.024845
state of oklahoma0.024845
heterosexual0.024793
msw0.024793
trachea0.024691
clostridium difficile intestinal infectious disease0.024691
atherosclerosis0.024691
age 3-60.024691
homosexual0.024691
msm0.024691
age 60-790.024691
small village0.024691
chuquisaca department0.024691
mucosa0.024540
age 30-500.024390
age 5-13 years0.024390
mucus0.024242
kingdom of denmark0.024242
state of texas0.024096
tongue0.024096
obesity0.024096
high bmi0.024000
LOWER IN dentition0.023952
hiv infection0.023810
bird0.023810
oral cavity0.023256
age0.023256
LOWER IN feces0.023256
state of florida0.023121
germany0.023077
metabolic syndrome0.016667
induced sputum0.016598
endotracheal aspirate0.016598
bronchial brush0.016598
oropharyngeal swab0.016598
jinan city prefecture0.016598
age<17 years0.016598
spondyloarthritis0.016598
spondylitis0.016598
uganda0.016598
pneumonia0.016598
mallard0.016598
state of wyoming0.016598
Fraction of dbbact annotations with this term covered by the query
TermScore
bronchial epithelium0.800000
bronchoalveolar lavage0.714286
bronchus0.666667
atlanta0.666667
skin of cheek0.666667
state of oklahoma0.666667
metabolic syndrome0.666667
lung0.600000
sputum0.600000
heterosexual0.600000
msw0.600000
ulcerative colitis0.555556
oropharynx0.500000
LOWER IN mouth mucosa0.500000
mild disease course0.500000
state of new hampshire0.500000
protected brush sampling0.500000
induced sputum0.500000
acute respiratory failure0.500000
trachea0.500000
endotracheal aspirate0.500000
clostridium difficile intestinal infectious disease0.500000
bronchial brush0.500000
squamous esophagus0.500000
bolivia0.500000
gastric bypass0.500000
oropharyngeal swab0.500000
jinan city prefecture0.500000
severe0.500000
LOWER IN mild0.500000
anorexia nervosa0.500000
age one week0.500000
age<17 years0.500000
atherosclerosis0.500000
spondyloarthritis0.500000
spondylitis0.500000
state of new york0.500000
idiopathic pulmonary fibrosis0.500000
uganda0.500000
pneumonia0.500000
inflammatory bowel disease0.500000
mallard0.500000
schistosomiasis0.500000
urinary schistosomiasis0.500000
kebbi state0.500000
rural community0.500000
skin of forehead0.500000
cheek0.500000
oslo0.500000
beagle dog0.500000
acute pancreatitis0.500000
pancreatitis0.500000
salmonella gastroenteritis0.500000
LOWER IN cron diet0.500000
state of wyoming0.500000
centrocercus urophasianus0.500000
greater sage-grouse0.500000
LOWER IN cheek0.500000
cheyenne0.500000
native american0.500000
arapaho0.500000
caribbean latino0.500000
human immunodeficiency virus infectious disease0.500000
municipality of logrono0.500000
antiretroviral therapy0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
baoding city prefecture0.500000
colombia0.500000
denver0.500000
age <=24 hours0.500000
LOWER IN age &gt;= 7 days0.500000
LOWER IN pacific ocean0.500000
respiratory airway0.500000
north america0.500000
exhaled air condensate0.500000
whale blow0.500000
gay0.500000
homosexual0.500000
msm0.500000
metabolic syndrome x0.500000
amsterdam0.500000
LOWER IN skin under eye0.500000
municipality of umea0.500000
age 8-120.500000
shark0.500000
south florida0.500000
cornell university0.500000
days 1-150.500000
aerobic fermentation0.500000
LOWER IN days 30-600.500000
LOWER IN anaerobic fermentation0.500000
ensete ventricosum0.500000
ethiopian banana0.500000
age 60-790.500000
himalayas0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
boston0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.881857
feces0.455696
adult0.451477
united states of america0.358650
saliva0.189873
china0.147679
child0.075949
skin0.054852
city0.050633
control0.046414
female0.046414
infant0.042194
LOWER IN control0.042194
state of california0.042194
lung0.037975
hospital0.037975
bronchial epithelium0.033755
mouth0.029536
ulcerative colitis0.029536
rural community0.029536
bronchoalveolar lavage0.025316
sputum0.025316
oral wash0.025316
sweden0.025316
italy0.025316
bolivia0.025316
poland0.025316
obsolete_juvenile stage0.025316
research facility0.025316
jiangsu province0.025316
state of michigan0.021097
commonwealth of pennsylvania0.021097
crohn's disease0.021097
state of new york0.021097
kingdom of the netherlands0.021097
kingdom of spain0.021097
united kingdom0.021097
state of colorado0.021097
india0.021097
oropharynx0.016878
LOWER IN mouth mucosa0.016878
cystic fibrosis0.016878
mild disease course0.016878
state of new hampshire0.016878
respiratory failure0.016878
acute respiratory failure0.016878
sichuan province0.016878
diarrhea0.016878
atlanta0.016878
canada0.016878
australia0.016878
south korea0.016878
duodenum0.016878
colombia0.016878
amsterdam0.016878
municipality of umea0.016878
mucus0.012658
oral cavity0.012658
trachea0.012658
clostridium difficile intestinal infectious disease0.012658
bronchus0.012658
state of texas0.012658
kingdom of denmark0.012658
atherosclerosis0.012658
hiv infection0.012658
tongue0.012658
high bmi0.012658
obesity0.012658
mucosa0.012658
skin of cheek0.012658
LOWER IN dentition0.012658
bird0.012658
state of oklahoma0.012658
age 3-60.012658
heterosexual0.012658
msw0.012658
age0.012658
homosexual0.012658
msm0.012658
germany0.012658
state of florida0.012658
age 60-790.012658
age 30-500.012658
LOWER IN feces0.012658
small village0.012658
chuquisaca department0.012658
age 5-13 years0.012658
induced sputum0.008439
dense settlement biome0.008439
breast milk0.008439
tanzania0.008439
tracheal aspirate0.008439
endotracheal aspirate0.008439
bronchial brush0.008439
new york city0.008439
oropharyngeal swab0.008439
jinan city prefecture0.008439
vancouver0.008439
age<17 years0.008439
french republic0.008439
Exp. ID User ID Description Date Region Flag Sequences
63amnonhigh freq. in saliva in american gut (dominant homo sapiens, saliva)2017-02-15v4No1 / 1
731amnonhigher in oropharingeal otic fluid drainage compared to buccal mucosa ( high in oropharynx compared to mouth mucosa buccal mucosa in homo sapiens united states of america adult state of michigan )2021-01-09v4No1 / 5
646amnoncommon homo sapiens, united states of america, mucus, lung, cystic fibrosis, bronchoalveolar lavage, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 7
646amnoncommon homo sapiens, united states of america, mucus, lung, cystic fibrosis, adult, mild disease course, state of new hampshire, protected brush sampling2020-09-06v4No1 / 10
354amnondominant homo sapiens, sputum, united states of america, adult, induced sputum2018-07-30v4No1 / 11
335amnonhigh freq. in mouthwash (dominant homo sapiens, united states of america, oral cavity, oral wash, mouth)2018-05-16v4No1 / 12
354amnondominant homo sapiens, united states of america, saliva, adult, oral wash2018-07-30v4No1 / 12
669amnoncommon feces, homo sapiens, infant, sweden, age 2 months2020-09-26v4No1 / 12
35amnondominant homo sapiens, hospital, dense settlement biome, breast milk, tanzania2016-12-06v4No1 / 13
636amnoncommon homo sapiens, united states of america, hospital, adult, commonwealth of pennsylvania, tracheal aspirate, respiratory failure, acute respiratory failure, trachea, endotracheal aspirate2020-08-08v4No1 / 13
185amnoncommon in patients with c. diff infection before treatment (common feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
646amnondominant homo sapiens, sputum, united states of america, cystic fibrosis, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 14
63amnonhigh freq. in saliva in american gut ( high in compared to in homo sapiens saliva )2017-02-15v4No1 / 15
63amnonhigh freq. in saliva in american gut (dominant homo sapiens, saliva)2017-02-15v4No1 / 15
64amnondominant homo sapiens, saliva, sichuan province2017-02-16v4No1 / 15
335amnondominant homo sapiens, united states of america, bronchial epithelium2018-05-16v4No1 / 15
354amnondominant homo sapiens, united states of america, bronchus, bronchial epithelium, adult, bronchial brush2018-07-30v4No1 / 15
524amnondominant homo sapiens, saliva, adult, sichuan province, china2019-07-06v4No1 / 15
690amnondominant in squamous esophagos samples from patients undergoing endoscopy (dominant homo sapiens, united states of america, hospital, esophagus, new york city, esophageal disease, squamous esophagus)2028-03-11v4No1 / 15
94amnoncommon feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 16
319amnondominant homo sapiens, united states of america, saliva, state of texas2018-04-18v4No1 / 16
348amnondominant homo sapiens, saliva, adult, italy2018-07-16v4No1 / 16
32amnondominant homo sapiens, saliva, infant, bolivia2016-12-05v4No1 / 17
32amnondominant homo sapiens, saliva, adult, bolivia2016-12-05v4No1 / 17
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in feces homo sapiens united states of america )2017-10-23v4No1 / 17
278amnondominant homo sapiens, united states of america, saliva, adult, state of california2018-01-23v4No1 / 17
636amnoncommon homo sapiens, united states of america, hospital, oropharynx, adult, commonwealth of pennsylvania, acute respiratory failure, respiratory failure, oropharyngeal swab2020-08-08v4No1 / 17
775amnondominant homo sapiens, saliva, adult, china, jinan city prefecture2021-04-24v4No1 / 17
246amnondominant homo sapiens, saliva, italy2017-11-21v4No1 / 18
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in feces homo sapiens united states of america child )2018-11-22v4No1 / 18
663amnondominant homo sapiens, adult, poland, oral wash, mouth2020-09-22v4No1 / 18
54amnondominant homo sapiens, united states of america, saliva2017-01-23v4No1 / 19
2amnon high in anorexia nervosa compared to control in feces homo sapiens 2016-10-05v4No1 / 20
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one week2018-01-14v4No1 / 20
33amnondominant homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 21
87amnoncommon homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v4No1 / 22
297amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years 2018-02-12v4No1 / 22
455amnondominant homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 22
312amnondominant feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 23
636amnondominant homo sapiens, united states of america, hospital, adult, commonwealth of pennsylvania, tracheal aspirate, acute respiratory failure, respiratory failure, trachea, endotracheal aspirate2020-08-08v4No1 / 23
636amnondominant homo sapiens, united states of america, hospital, oropharynx, adult, commonwealth of pennsylvania, acute respiratory failure, respiratory failure, oropharyngeal swab2020-08-08v4No1 / 23
173amnondominant homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 24
469amnoncommon homo sapiens, united states of america, lung, bronchoalveolar lavage, adult, state of new york, idiopathic pulmonary fibrosis2019-01-14v4No1 / 24
35amnoncommon homo sapiens, hospital, dense settlement biome, breast milk, tanzania2016-12-06v4No1 / 25
258amnonhigh freq. in lungs of hiv patients with pneumonia (dominant homo sapiens, lung, bronchoalveolar lavage, hiv infection, bronchial epithelium, uganda, pneumonia)2017-11-27v4No1 / 25
395amnoncommon feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 25
683amnoncommon during antibiotics treatment in feces (common feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 25
193amnonlower in nares of people working in dairy farms ( high in control compared to farm bos taurus in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 29
3amnondominant homo sapiens, tongue, china2016-10-06v4No1 / 30
81amnoncommon cloaca, anas platyrhynchos, state of california, mallard2017-03-05v4No1 / 30
246amnon high in body mass index high bmi obesity compared to control in homo sapiens saliva italy 2017-11-21v4No1 / 30
320amnoncommon feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 30
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 31
63amnoncommon in saliva in american gut (common homo sapiens, saliva)2017-02-15v4No1 / 32
292amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens adult china 2018-02-05v4No1 / 32
646amnoncommon homo sapiens, sputum, united states of america, cystic fibrosis, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 33
669amnon high in age 2 weeks compared to age 1 year in feces homo sapiens infant sweden 2020-09-26v4No1 / 33
509amnon high in schistosomiasis urinary schistosomiasis compared to control in feces homo sapiens child nigeria kebbi state rural community age 10-15 years 2019-03-18v4No1 / 34
228amnoncommon in sinus brush of healthy participants (common homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space)2017-10-31v4No1 / 36
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of cheek, south korea, age 20-30 years2021-03-10v4No1 / 36
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of forehead, south korea, age 20-30 years2021-03-10v4No1 / 36
102amnonlower in teeth compared to cheeks, saliva ( high in saliva cheek compared to dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 37
227amnonhigher in nasopharynx of formula fed babies compared to breast fed ( high in diet formula fed compared to breast milk breast fed in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-11-03v4No1 / 38
330amnoncommon feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 39
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
69amnoncommon united states of america, research facility, bronchoalveolar lavage, canis lupus familiaris, beagle dog2017-02-21v4No1 / 44
428amnon high in acute pancreatitis pancreatitis compared to control in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 46
258amnoncommon in lungs of hiv patients with pneumonia (common homo sapiens, lung, bronchoalveolar lavage, hiv infection, bronchial epithelium, uganda, pneumonia)2017-11-27v4No1 / 49
651amnoncommon feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 49
576amnon high in tongue compared to mouth mucosa in homo sapiens adult czech republic 2020-01-09v3No1 / 50
335amnoncommon in mouthwash (common homo sapiens, united states of america, oral cavity, oral wash, mouth)2018-05-16v4No1 / 52
354amnoncommon homo sapiens, united states of america, saliva, adult, oral wash2018-07-30v4No1 / 52
650amnoncommon feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 52
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
390amnoncommon feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 55
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in antibiotic vancomycin metronidazole neomycin compared to control in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 55
368amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
651amnoncommon feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 58
228amnonlower in chronic sinositis compared to healthy controls in sinus brushing ( high in control compared to sinusitis in homo sapiens united states of america mucosa paranasal sinus sinusoidal space )2017-10-31v4No1 / 60
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in diet american diet compared to cron diet caloric restriction diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 61
335amnoncommon homo sapiens, united states of america, bronchial epithelium2018-05-16v4No1 / 61
354amnoncommon homo sapiens, sputum, united states of america, adult, induced sputum2018-07-30v4No1 / 63
558amnon high in duodenum compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 64
102amnonhigher in saliva compared to teeth, cheek ( high in saliva compared to cheek dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 65
242amnoncommon in native-americans (common feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 65
354amnoncommon homo sapiens, united states of america, bronchus, bronchial epithelium, adult, bronchial brush2018-07-30v4No1 / 65
803amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, age 50-80 years, type 2 diabetes mellitus, caribbean latino2021-06-18v4No1 / 70
26amnoncommon homo sapiens, united states of america, mucus, pair of nares2016-12-05v4No1 / 73
299amnon high in control compared to mouth neoplasm cancer in homo sapiens saliva adult china 2018-02-27v4No1 / 75
794amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, human immunodeficiency virus infectious disease, municipality of logrono, antiretroviral therapy2021-06-08v4No1 / 75
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in feces homo sapiens china )2018-12-30v4No1 / 76
54amnoncommon homo sapiens, united states of america, saliva2017-01-23v4No1 / 77
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 77
731amnoncommon in orophringeal otic secretion drainage (common homo sapiens, united states of america, oropharynx, adult, state of michigan)2021-01-09v4No1 / 77
819amnoncommon homo sapiens, female, skin, adult, skin of cheek, china, baoding city prefecture, age 25-45 years2021-07-12v1No1 / 77
404amnoncommon feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 79
3amnoncommon homo sapiens, tongue, china2016-10-06v4No1 / 81
643amnoncommon feces, homo sapiens, adult, south korea2020-08-30v4No1 / 81
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
663amnoncommon homo sapiens, lung, bronchoalveolar lavage, adult, poland2020-09-22v4No1 / 84
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 85
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
209amnon high in atlantic ocean compared to pacific ocean in respiratory airway north america megaptera novaeangliae humpback whale exhaled air condensate whale blow 2017-10-15v4No1 / 86
319amnoncommon homo sapiens, united states of america, saliva, state of texas2018-04-18v4No1 / 87
344amnoncommon in feces of homosexual males (common feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 87
487amnoncommon feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 88
293amnoncommon feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 89
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 89
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
348amnoncommon homo sapiens, saliva, adult, italy2018-07-16v4No1 / 94
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
58amnon high in conjunctiva compared to skin skin under eye in homo sapiens new york city 2017-02-02v4No1 / 96
238amnoncommon feces, homo sapiens, colombia2017-11-07v4No1 / 96
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 97
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
455amnoncommon homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 100
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 102
493amnoncommon homo sapiens, united states of america, saliva, adult, state of new york2019-02-27v4No1 / 104
777amnon high in age 2 days compared to age 3 months in homo sapiens saliva infant sweden municipality of umea 2021-04-26v3No1 / 104
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china2018-12-30v4No1 / 106
663amnoncommon homo sapiens, adult, poland, oral wash, mouth2020-09-22v4No1 / 106
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water sea water depth 0m in united states of america atlantic ocean state of florida south florida )2018-04-24v4No1 / 107
409amnoncommon feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 108
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china2018-12-30v4No1 / 109
524amnoncommon homo sapiens, saliva, adult, sichuan province, china2019-07-06v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 60-79, china2018-12-30v4No1 / 111
477amnon high in nepal himalayas rural community compared to united states of america in feces homo sapiens adult 2019-01-28v4No1 / 111
594amnoncommon homo sapiens, saliva, adult, cameroon2020-03-12v4No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 30-50, china2018-12-30v4No1 / 115
32amnoncommon homo sapiens, saliva, adult, bolivia2016-12-05v4No1 / 116
195amnoncommon in boston subway surfaces (common city, urban biome, boston, train)2017-09-07v4No1 / 116
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
640amnoncommon homo sapiens, female, saliva, adult, china, shanghai district2020-08-22v4No1 / 117
343amnoncommon in apple flowers (common united states of america, flower structure, malus x domestica, state of connecticut, flower, apple)2018-05-28v4No1 / 118
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
777amnon high in age 5 years compared to age 3 years in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china2018-12-30v4No1 / 121
449amnoncommon feces, homo sapiens, colombia2019-01-09v4No1 / 124
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to rectum biopsy site biopsy in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 126
273amnon high in age age 1 week compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 127
113amnon high in larval stage compared to adult in united states of america research facility intestine danio rerio zebra fish 2017-04-10v4No1 / 128
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in cloaca anas platyrhynchos state of california mallard )2017-03-05v4No1 / 131
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
246amnoncommon homo sapiens, saliva, italy2017-11-21v4No1 / 133
278amnoncommon homo sapiens, united states of america, saliva, adult, state of california2018-01-23v4No1 / 133
711amnon high in adult compared to child age 8-12 years in homo sapiens united states of america oral cavity state of colorado mouth 2028-05-21v4No1 / 133
775amnoncommon homo sapiens, saliva, adult, china, jinan city prefecture2021-04-24v4No1 / 133
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 132017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 141
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america adult state of california 2018-01-23v4No1 / 146
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in wastewater treatment plant sewer compared to feces in city south america low income )2017-01-21v4No1 / 148
64amnoncommon homo sapiens, saliva, sichuan province2017-02-16v4No1 / 152
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 162
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 162
408amnon high in larval stage compared to stomach in united states of america costa rica ant pseudomyrmex spinicola 2018-11-22v4No1 / 165
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, foot, australia)2017-11-05v4No1 / 166
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, age 13, india2017-09-12v4No1 / 170
299amnoncommon in healthy (non-tumor) controls (common homo sapiens, control, saliva, adult, china)2018-02-27v4No1 / 179
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
777amnon high in age 3 years compared to age 18 months in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 184
299amnoncommon homo sapiens, saliva, adult, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
371amnoncommon homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 195
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
6amnoncommon homo sapiens, urine, female, pregnancy, state of tennessee2016-10-13v4No1 / 201
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in feces homo sapiens china )2018-12-30v4No1 / 203
515amnon high in poland herbivorous beetle compared to bulgaria detritivorous beetle in whole body beetle 2019-04-19v4No1 / 205
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v3No1 / 214
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens female adult china shanghai district 2020-08-22v4No1 / 232
404amnon high in bogota medellin metropolitan area compared to municipality of santiago de cali bucaramanga barranquilla in feces homo sapiens city adult colombia 2018-11-20v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, age 50-60 years, nephrolithiasis, china)2018-01-27v4No1 / 239
483amnoncommon united states of america, research facility, hawaii, pearl harbor, hydroides elegans, tubeworm, shelled egg2019-02-13v4No1 / 243
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in feces homo sapiens infant india )2016-12-19v4No1 / 253
438amnon high in child age 3-6 age 8-12 compared to adult age 30-50 age 60-79 in feces homo sapiens china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, age 50-60 years, china)2018-01-27v4No1 / 281
53amnon high in el salvador small village compared to lima shantytown in feces homo sapiens city 2017-01-21v4No1 / 296
237amnonlower in burrow soil compared to bird ( high in bird oceanodroma leucorhoa seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
209amnonhigher in whale blow condensate compared to ocean water ( high in respiratory airway megaptera novaeangliae humpback whale exhaled air condensate whale blow compared to ocean sea water depth 25cm in north america )2017-10-15v4No1 / 359
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
558amnon high in gizzard compared to crop in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 408
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
339amnon high in adult compared to infant age < 1 year in feces homo sapiens india 2018-05-24v4No1 / 457
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee leaf populus tree cultivated environment 2019-01-13v4No1 / 559
777amnon high in child age 18 months compared to infant age 3 months in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 583
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in feces homo sapiens china )2018-12-30v4No1 / 617
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in homo sapiens skin )2018-09-06v4No1 / 854
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
515amnon high in carabidae compared to staphylinidae in river poland whole body beetle carnivorous beetle 2019-04-19v4No1 / 1130
252amnoncommon in river sand biofilm (common river, biofilm, sand, kingdom of spain)2017-11-22v4No1 / 1181
808amnon high in mucosa ileal mucosa compared to digesta in research facility ileum gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 1360
819amnon high in skin of cheek compared to scalp in homo sapiens female skin adult china age 25-45 years 2021-07-12v1No1 / 1684
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 1834
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
76amnonhigher in seleniferous soil compared to non-seleniferous soil ( high in selenium seleniferous compared to non-seleniferous in united states of america soil rhizosphere woodland area )2017-02-28v4No1 / 2259

Problems / suggestions? Please email info AT dbbact DOT org