Search result for sequence:
TACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT
common ontology terms
term enrichment score
TermScore
homo sapiens0.668435
adult0.416464
united states of america0.285685
saliva0.269693
child0.191047
feces0.183283
china0.148623
skin0.148263
infant0.143131
dentition0.126307
mouth0.116770
subgingival plaque0.090295
sweden0.083810
mouth mucosa0.080027
control0.077268
germany0.075694
canada0.075259
oral cavity0.074153
research facility0.073607
australia0.071672
state of new york0.067708
female0.065391
nasopharynx0.060981
supragingival plaque0.059117
state of california0.056799
tongue0.054138
pair of nares0.053540
province of ontario0.051546
epidermis0.050251
brazil0.048959
south korea0.048306
city0.047745
supragingival dental plaque0.043243
oral wash0.040900
age 3 months0.040706
poland0.040623
nasal cavity0.040350
municipality of umea0.040214
kingdom of spain0.040036
lung0.038275
buccal mucosa0.038173
hospital0.038043
municipality of beijing0.036939
felis catus0.036939
dermal layer of tongue0.035507
breast milk0.035350
air0.035217
duodenum0.034918
larval stage0.034837
italy0.034085
periodontitis0.033016
costa rica0.032258
belgium0.032086
LOWER IN control0.031674
cat0.031662
hunter gatherer0.030109
perth0.029810
bolivia0.029810
czech republic0.029663
stomach0.029517
age 1-3 years0.028947
age0.028433
water0.028332
venezuela0.027360
amerindian0.027360
age 7 years0.027360
state of nebraska0.027174
rural community0.026991
whole body0.026281
finland0.024705
recurrent otitis media0.024523
obsolete_juvenile stage0.024523
united kingdom0.024226
commonwealth of pennsylvania0.024226
mucus0.024080
new york city0.024080
state of florida0.023653
bronchoalveolar lavage0.022059
sputum0.022039
bronchial epithelium0.022039
palatine tonsil0.022039
LOWER IN dentition0.022030
subgingival dental plaque0.021978
ant0.021858
age 6 years0.021858
age 8 years0.021858
age 9 years0.021858
age 11 years0.021858
state of michigan0.021622
age 10 years0.021622
beetle0.021622
africa0.021390
leaf0.021390
captive0.021016
kingdom of the netherlands0.020942
age < 1 year0.019224
chuquisaca department0.019178
age 20-30 years0.019178
breast fed0.019178
macaca mulatta0.019178
Fraction of dbbact annotations with this term covered by the query
TermScore
subgingival plaque0.916667
lung0.900000
mouth mucosa0.888889
saliva0.880952
tongue0.875000
bronchoalveolar lavage0.857143
oral wash0.857143
dentition0.818182
sputum0.800000
buccal mucosa0.800000
bronchial epithelium0.800000
dermal layer of tongue0.800000
palatine tonsil0.800000
supragingival plaque0.777778
LOWER IN dentition0.777778
hunter gatherer0.750000
trachea0.750000
age 3 years0.750000
puerto rico0.750000
LOWER IN subgingival plaque0.750000
taiwan0.750000
small village0.750000
finland0.714286
age 3 months0.714286
oral cavity0.714286
infant0.708333
hospital0.700000
breast milk0.666667
subgingival dental plaque0.666667
age 5-10 years0.666667
building0.666667
state of illinois0.666667
conjunctiva0.666667
paranasal sinus0.666667
sinusoidal space0.666667
dust0.666667
arm0.666667
venezuela0.666667
amerindian0.666667
tracheal aspirate0.666667
bronchus0.666667
age 7 years0.666667
poland0.666667
supragingival dental plaque0.666667
formula fed0.666667
hong kong0.666667
tonsillitis0.666667
nectar0.666667
age < 3 years0.666667
endosphere0.666667
foot0.666667
atlanta0.666667
LOWER IN age 3 years0.666667
ice0.666667
LOWER IN subgingival dental plaque0.666667
republic of china0.666667
age 30-500.666667
state of oklahoma0.666667
madrid0.666667
estonia0.666667
stream0.666667
LOWER IN supragingival plaque0.666667
pair of nares0.642857
mouth0.640000
homo sapiens0.636364
south korea0.615385
nasopharynx0.600000
urine0.600000
axilla0.600000
tonsil0.600000
flower0.600000
gill0.600000
air0.583333
age < 1 year0.571429
nasal cavity0.545455
child0.542857
adult0.518987
skin0.515152
aphis gossypii0.500000
cotton aphid0.500000
age 24 hours0.500000
LOWER IN age 2 hours0.500000
LOWER IN age &gt;=7 days0.500000
perth0.500000
recurrent otitis media0.500000
middle ear rinse0.500000
LOWER IN periodontitis0.500000
LOWER IN chronic periodontitis0.500000
mild disease course0.500000
state of new hampshire0.500000
external acoustic meatus0.500000
ear canal0.500000
back0.500000
ant0.500000
bolivia0.500000
chuquisaca department0.500000
age 20-30 years0.500000
upper eyelid0.500000
municipality of umea0.500000
drosophila melanogaster0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.703911
adult0.347765
united states of america0.275140
saliva0.159218
feces0.153631
china0.118715
child0.115922
skin0.086592
infant0.079609
dentition0.068436
mouth0.064246
control0.053073
research facility0.048883
subgingival plaque0.047486
sweden0.046089
canada0.044693
mouth mucosa0.041899
germany0.041899
australia0.039106
oral cavity0.039106
female0.037709
state of new york0.036313
nasopharynx0.032123
state of california0.030726
supragingival plaque0.030726
province of ontario0.027933
epidermis0.027933
tongue0.027933
pair of nares0.027933
brazil0.026536
south korea0.025140
city0.025140
supragingival dental plaque0.022346
nasal cavity0.020950
kingdom of spain0.020950
municipality of umea0.020950
age 3 months0.020950
oral wash0.020950
poland0.020950
municipality of beijing0.019553
lung0.019553
felis catus0.019553
hospital0.019553
buccal mucosa0.019553
LOWER IN control0.019553
breast milk0.018156
larval stage0.018156
air0.018156
italy0.018156
periodontitis0.018156
duodenum0.018156
dermal layer of tongue0.018156
costa rica0.016760
cat0.016760
belgium0.016760
age0.015363
age 1-3 years0.015363
perth0.015363
stomach0.015363
bolivia0.015363
hunter gatherer0.015363
czech republic0.015363
water0.015363
whole body0.013966
rural community0.013966
venezuela0.013966
amerindian0.013966
age 7 years0.013966
state of nebraska0.013966
finland0.012570
recurrent otitis media0.012570
mucus0.012570
united kingdom0.012570
new york city0.012570
commonwealth of pennsylvania0.012570
obsolete_juvenile stage0.012570
state of florida0.012570
kingdom of the netherlands0.011173
subgingival dental plaque0.011173
bronchoalveolar lavage0.011173
ant0.011173
sputum0.011173
state of michigan0.011173
bronchial epithelium0.011173
age 10 years0.011173
age 6 years0.011173
age 8 years0.011173
age 9 years0.011173
age 11 years0.011173
captive0.011173
palatine tonsil0.011173
africa0.011173
beetle0.011173
LOWER IN dentition0.011173
leaf0.011173
chuquisaca department0.009777
age 5-13 years0.009777
age 20-30 years0.009777
age < 1 year0.009777
breast fed0.009777
Exp. ID User ID Description Date Region Flag Sequences
66amnon high in female compared to male in homo sapiens saliva adult amsterdam 2017-02-18v4No1 / 3
245amnondominant homo sapiens, breast milk, finland2017-11-21v4No1 / 4
771amnondominant body proper, whole body, china, aphis gossypii, cotton aphid2021-04-21v3No1 / 5
227amnonpeaks at 24hrs compared to 2hrs or later timepoints in baby nasopharynx ( high in age age 24 hours compared to age 2 hours age >=7 days in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 6
245amnondominant homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 6
605amnoncommon control, nasopharynx, child, australia, age 1-3 years, perth2020-04-07v3No1 / 6
605amnoncommon middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear rinse2020-04-07v3No1 / 6
725amnon high in control compared to periodontitis chronic periodontitis in homo sapiens adult subgingival plaque subgingival dental plaque china municipality of beijing 2021-01-03v3No1 / 6
646amnoncommon homo sapiens, united states of america, mucus, lung, cystic fibrosis, bronchoalveolar lavage, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 7
605amnoncommon external acoustic meatus, child, australia, ear canal, age 1-3 years, perth, recurrent otitis media2020-04-07v3No1 / 7
679amnondominant homo sapiens, saliva, fasting, child, south korea, age 5-10 years2028-03-02v3No1 / 7
717amnondominant homo sapiens, dorsum, skin, adult, canada, province of ontario, back, epidermis2028-05-22v3No1 / 7
284amnon high in age 2 months compared to age 1 year in feces homo sapiens female infant state of california 2018-01-27v4No1 / 8
408amnoncommon united states of america, stomach, costa rica, crematogaster, ant2018-11-22v4No1 / 8
517amnondominant homo sapiens, mouth mucosa, child, bolivia, chuquisaca department, rural community, age 5-13 years, mouth2019-05-29v4No1 / 8
749amnondominant homo sapiens, female, skin, adult, seoul, skin of cheek, south korea, age 20-30 years2021-03-10v4No1 / 8
565amnondominant skin, felis catus, cat, canada2019-11-21v3No1 / 8
717amnondominant homo sapiens, skin, adult, canada, province of ontario, upper eyelid, epidermis2028-05-22v3No1 / 8
777amnondominant homo sapiens, saliva, infant, sweden, municipality of umea, age 2 days2021-04-26v3No1 / 8
227amnoncommon in baby nasopharynx age 1 day to 3 months (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age 3 months)2017-10-30v4No1 / 9
244amnondominant digestive system, research facility, drosophila melanogaster, fruit fly, united kingdom2017-11-15v4No1 / 9
245amnondominant homo sapiens, breast milk, china2017-11-21v4No1 / 9
391amnoncommon feces, hospital, infant, age < 1 year, diarrhea, china2018-11-04v4No1 / 9
711amnondominant homo sapiens, united states of america, oral cavity, child, state of colorado, mouth, age 8-12 years2028-05-21v4No1 / 9
775amnon high in control compared to lichen planus in homo sapiens saliva adult china jinan city prefecture 2021-04-24v4No1 / 9
605amnoncommon middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear fluid2020-04-07v3No1 / 9
797amnoncommon feces, homo sapiens, infant, germany, age 1 month, breast fed2021-06-13v3No1 / 9
3amnonLower in chronic erosive gastritis patients with yellow tongue comapred to healthy controls ( high in control compared to chronic gastritis in homo sapiens tongue china )2016-10-06v4No1 / 10
227amnoncommon in baby nasopharynx age 6 months to 1 year (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age 1 year)2017-10-30v4No1 / 10
227amnonhigh freq. in baby nasopharynx age 6 months to 1 year (dominant homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age 1 year)2017-10-30v4No1 / 10
234amnoncommon homo sapiens, united states of america, lung2017-11-07v4No1 / 10
378amnon high in control compared to periodontitis in homo sapiens dentition adult brazil subgingival plaque mouth 2018-09-14v4No1 / 10
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex elongatus2018-11-22v4No1 / 10
523amnondominant united states of america, building, air, state of illinois, chicago, bedroom2019-07-03v4No1 / 10
646amnoncommon homo sapiens, united states of america, mucus, lung, cystic fibrosis, adult, mild disease course, state of new hampshire, protected brush sampling2020-09-06v4No1 / 10
711amnondominant homo sapiens, united states of america, oral cavity, adult, state of colorado, mouth2028-05-21v4No1 / 10
749amnondominant homo sapiens, female, skin, adult, seoul, skin of forehead, south korea, age 20-30 years2021-03-10v4No1 / 10
58amnondominant homo sapiens, conjunctiva, new york city2017-02-02v4No1 / 10
605amnondominant control, nasopharynx, child, australia, age 1-3 years, perth2020-04-07v3No1 / 10
655amnoncommon in patients after hematopoietic stem cell transplant (common feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No1 / 10
724amnon high in pregnancy pregnancy trimester 2 compared to non-pregnant in homo sapiens female vagina adult egypt ismailia age 25-45 years 2021-01-03v3No1 / 10
133amnonhigh freq. in infants 0-1 years (dominant homo sapiens, nasopharynx, infant, australia)2017-04-16v4No1 / 11
195amnonhigh freq. in boston subway surfaces (dominant city, urban biome, boston, train)2017-09-07v4No1 / 11
228amnonhigh freq. in sinus brush of healthy participants (dominant homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space)2017-10-31v4No1 / 11
308amnonhigh freq. in neonatal intensive care unit floor (dominant united states of america, dust, hospital, state of california, floor)2018-03-31v4No1 / 11
354amnondominant homo sapiens, sputum, united states of america, adult, induced sputum2018-07-30v4No1 / 11
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 11
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex pallidus2018-11-22v4No1 / 11
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex pallidus2018-11-22v4No1 / 11
567amnoncommon homo sapiens, nasopharynx, adult, belgium2019-12-05v4No1 / 11
717amnondominant homo sapiens, skin, adult, canada, province of ontario, chest, epidermis, torso2028-05-22v3No1 / 11
717amnondominant homo sapiens, skin, adult, canada, province of ontario, plantar part of pes, epidermis, bottom of foot2028-05-22v3No1 / 11
757amnon high in female compared to male in feces homo sapiens adult brazil santa catarina state 2021-03-28v3No1 / 11
26amnondominant homo sapiens, united states of america, mucus, pair of nares2016-12-05v4No1 / 12
227amnonhigh freq. in baby nasopharynx age 1 day to 3 months (dominant homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age 3 months)2017-10-30v4No1 / 12
335amnonhigh freq. in mouthwash (dominant homo sapiens, united states of america, oral cavity, oral wash, mouth)2018-05-16v4No1 / 12
354amnondominant homo sapiens, united states of america, saliva, adult, oral wash2018-07-30v4No1 / 12
460amnonhigh freq. in outdoor air (dominant united states of america, air, state of california, outdoor)2019-01-12v4No1 / 12
567amnoncommon homo sapiens, adult, belgium, maxillary sinus, ethmoid sinus2019-12-05v4No1 / 12
669amnoncommon feces, homo sapiens, infant, sweden, age 2 months2020-09-26v4No1 / 12
75amnondominant homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 12
596amnondominant homo sapiens, saliva, child, sweden, age 1 year2020-03-17v3No1 / 12
605amnondominant middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear rinse2020-04-07v3No1 / 12
717amnondominant homo sapiens, skin, adult, canada, province of ontario, palmar part of manus, epidermis, palm of hand2028-05-22v3No1 / 12
717amnondominant homo sapiens, skin, adult, canada, province of ontario, external nose, epidermis, outer nose2028-05-22v3No1 / 12
724amnondominant homo sapiens, female, pregnancy, vagina, adult, egypt, ismailia, age 25-45 years, pregnancy trimester 22021-01-03v3No1 / 12
777amnondominant homo sapiens, saliva, infant, sweden, age 3 months, municipality of umea2021-04-26v3No1 / 12
797amnoncommon feces, homo sapiens, infant, germany, breast fed, age 7 months2021-06-13v3No1 / 12
806amnondominant homo sapiens, united states of america, adult, state of new york, gingiva, keratinized gingiva2021-06-19v3No1 / 12
35amnondominant homo sapiens, hospital, dense settlement biome, breast milk, tanzania2016-12-06v4No1 / 13
158amnondominant united states of america, lower back, felis catus, cat2017-07-06v4No1 / 13
245amnoncommon homo sapiens, breast milk, kingdom of spain2017-11-21v4No1 / 13
408amnondominant united states of america, stomach, costa rica, crematogaster, ant2018-11-22v4No1 / 13
460amnonhigh freq. in occupied office air (dominant united states of america, air, state of california, indoor, office)2019-01-12v4No1 / 13
516amnondominant homo sapiens, united states of america, urine, adult, state of ohio2019-05-29v4No1 / 13
517amnondominant homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 13
567amnondominant homo sapiens, pair of nares, adult, belgium, anterior naris2019-12-05v4No1 / 13
636amnoncommon homo sapiens, united states of america, hospital, adult, commonwealth of pennsylvania, tracheal aspirate, respiratory failure, acute respiratory failure, trachea, endotracheal aspirate2020-08-08v4No1 / 13
731amnondominant homo sapiens, united states of america, mouth mucosa, adult, state of michigan, buccal mucosa2021-01-09v4No1 / 13
48amnondominant homo sapiens, hypopharynx, infant, kingdom of denmark2017-01-19v4No1 / 13
63amnonhigh freq. in skin in american gut (dominant homo sapiens, skin)2017-02-15v4No1 / 13
605amnondominant middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear fluid2020-04-07v3No1 / 13
605amnondominant external acoustic meatus, child, australia, ear canal, age 1-3 years, perth, recurrent otitis media2020-04-07v3No1 / 13
717amnondominant homo sapiens, axilla, skin, adult, canada, province of ontario, epidermis, armpit2028-05-22v3No1 / 13
725amnondominant homo sapiens, control, mouth mucosa, adult, buccal mucosa, china, municipality of beijing2021-01-03v3No1 / 13
797amnon high in breast fed compared to formula fed in feces homo sapiens infant germany age 3 months 2021-06-13v3No1 / 13
806amnondominant homo sapiens, united states of america, oral cavity, adult, state of new york, oral wash, mouth2021-06-19v3No1 / 13
106amnon high in control compared to periodontitis in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v4No1 / 14
158amnondominant united states of america, conjunctiva, felis catus, cat2017-07-06v4No1 / 14
229amnoncommon in sinuses from chronic rhinosinositis patients (common homo sapiens, paranasal sinus, sinusoidal space, australia, sinusitis)2017-10-31v4No1 / 14
245amnondominant homo sapiens, breast milk, south africa2017-11-21v4No1 / 14
277amnondominant homo sapiens, nasal cavity, pair of nares, adult, belgium2018-01-23v4No1 / 14
371amnondominant homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 14
456amnon high in tongue compared to caecum in united states of america female research facility mus musculus c57bl/6 mouse 2019-01-10v4No1 / 14
469amnondominant homo sapiens, united states of america, lung, bronchoalveolar lavage, adult, state of new york, idiopathic pulmonary fibrosis2019-01-14v4No1 / 14
646amnondominant homo sapiens, sputum, united states of america, cystic fibrosis, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 14
58amnondominant homo sapiens, skin of face, new york city, skin under eyes2017-02-02v4No1 / 14
546amnondominant homo sapiens, saliva, adult, slovak republic, morning, age 21-28 years2019-08-07v3No1 / 14
564amnon high in control compared to autistic disorder in feces homo sapiens child italy age 2-4 years 2019-11-18v3No1 / 14
576amnon high in control compared to aphthous stomatitis in homo sapiens mouth mucosa adult czech republic lip lower labial mucosa 2020-01-09v3No1 / 14
576amnondominant homo sapiens, mouth mucosa, adult, czech republic, lip, lower labial mucosa2020-01-09v3No1 / 14
576amnondominant homo sapiens, mouth mucosa, adult, czech republic, buccal mucosa2020-01-09v3No1 / 14
596amnondominant homo sapiens, saliva, infant, child, sweden, age 6 months2020-03-17v3No1 / 14
596amnondominant homo sapiens, saliva, child, sweden, age 2 years2020-03-17v3No1 / 14
596amnondominant homo sapiens, saliva, child, sweden, age 3 months2020-03-17v3No1 / 14
605amnoncommon nasopharynx, child, australia, age 1-3 years, perth, recurrent otitis media2020-04-07v3No1 / 14
605amnondominant nasopharynx, child, australia, age 1-3 years, perth, recurrent otitis media2020-04-07v3No1 / 14
725amnondominant homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, chronic periodontitis, china, municipality of beijing2021-01-03v3No1 / 14
725amnondominant homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 14
797amnon high in breast fed compared to formula fed in feces homo sapiens infant germany age 1 month 2021-06-13v3No1 / 14
158amnoncommon united states of america, lower back, felis catus, cat2017-07-06v4No1 / 15
245amnoncommon homo sapiens, breast milk, china2017-11-21v4No1 / 15
253amnonhigh freq. in clouds in puy de dome mountain in france (dominant air, french republic, autumn, cloud)2017-11-22v4No1 / 15
335amnondominant homo sapiens, united states of america, bronchial epithelium2018-05-16v4No1 / 15
354amnondominant homo sapiens, united states of america, bronchus, bronchial epithelium, adult, bronchial brush2018-07-30v4No1 / 15
371amnondominant homo sapiens, saliva, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 15
378amnondominant homo sapiens, control, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth2018-09-14v4No1 / 15
524amnondominant homo sapiens, saliva, adult, sichuan province, china2019-07-06v4No1 / 15
690amnondominant in squamous esophagos samples from patients undergoing endoscopy (dominant homo sapiens, united states of america, hospital, esophagus, new york city, esophageal disease, squamous esophagus)2028-03-11v4No1 / 15
802amnondominant homo sapiens, united states of america, saliva, adult, state of new york, cornell university2021-06-16v4No1 / 15
48amnoncommon homo sapiens, hypopharynx, infant, kingdom of denmark2017-01-19v4No1 / 15
58amnondominant homo sapiens, new york city, contact lens2017-02-02v4No1 / 15
63amnonhigh freq. in saliva in american gut ( high in compared to in homo sapiens saliva )2017-02-15v4No1 / 15
63amnonhigh freq. in saliva in american gut (dominant homo sapiens, saliva)2017-02-15v4No1 / 15
64amnondominant homo sapiens, saliva, sichuan province2017-02-16v4No1 / 15
596amnondominant homo sapiens, saliva, child, sweden, age 7 years2020-03-17v3No1 / 15
613amnondominant research facility, aquarium, gastrointestinal system, fish, poland, olsztyn, esox lucius, pike fry, gut2020-04-25v3No1 / 15
685amnondominant homo sapiens, oral cavity, mouth mucosa, adult, australia2028-03-08v3No1 / 15
777amnoncommon homo sapiens, saliva, infant, sweden, municipality of umea, age 2 days2021-04-26v3No1 / 15
797amnon high in age 3 months compared to age 7 months in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 15
797amnoncommon feces, homo sapiens, infant, germany, age 3 months, breast fed2021-06-13v3No1 / 15
805amnondominant homo sapiens, sputum, adult, united kingdom, city of london2021-06-18v3No1 / 15
806amnondominant homo sapiens, united states of america, dentition, adult, state of new york, supragingival plaque, supragingival dental plaque2021-06-19v3No1 / 15
806amnondominant homo sapiens, united states of america, adult, state of new york, dorsum of tongue2021-06-19v3No1 / 15
106amnondominant homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 16
133amnoncommon in infants 0-1 years (common homo sapiens, nasopharynx, infant, australia)2017-04-16v4No1 / 16
158amnondominant united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 16
319amnondominant homo sapiens, united states of america, saliva, state of texas2018-04-18v4No1 / 16
348amnondominant homo sapiens, saliva, adult, italy2018-07-16v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child inflammatory bowel disease crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
493amnondominant homo sapiens, united states of america, saliva, adult, state of new york2019-02-27v4No1 / 16
567amnondominant homo sapiens, nasopharynx, adult, belgium2019-12-05v4No1 / 16
719amnondominant united states of america, research facility, dentition, mus musculus, state of georgia, mouse, charles river laboratories, icr/cd-1 mice2028-05-23v4No1 / 16
519amnondominant homo sapiens, city, saliva, late adult stage, adult, china2019-06-25v3No1 / 16
576amnon high in aphthous stomatitis compared to control in homo sapiens tongue adult czech republic 2020-01-09v3No1 / 16
598amnondominant homo sapiens, saliva, oral cavity, child, kingdom of spain, age 13-15 years2020-03-25v3No1 / 16
652amnondominant homo sapiens, saliva, adult, sichuan province, china2020-09-13v3No1 / 16
678amnondominant homo sapiens, control, adult, kingdom of spain, supragingival plaque, supragingival dental plaque2028-03-02v3No1 / 16
713amnon high in active disease compared to remission in feces homo sapiens crohn's disease 2028-05-21v3No1 / 16
725amnondominant homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, chronic periodontitis, china, municipality of beijing2021-01-03v3No1 / 16
728amnoncommon feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 16
32amnondominant homo sapiens, saliva, infant, bolivia2016-12-05v4No1 / 17
32amnondominant homo sapiens, saliva, adult, bolivia2016-12-05v4No1 / 17
87amnondominant homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v4No1 / 17
158amnondominant united states of america, axilla, felis catus, cat2017-07-06v4No1 / 17
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in feces homo sapiens united states of america )2017-10-23v4No1 / 17
227amnonhigh freq. in baby nasopharynx age <= 1 day (dominant homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 17
277amnondominant homo sapiens, nasopharynx, adult, belgium2018-01-23v4No1 / 17
278amnondominant homo sapiens, united states of america, saliva, adult, state of california2018-01-23v4No1 / 17
352amnonhigh freq. in duodenal biopsies (dominant homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 17
418amnondominant ocean, skeleton, coral, acropora hyacinthus2018-12-02v4No1 / 17
418amnondominant ocean, tissue, coral, acropora hyacinthus2018-12-02v4No1 / 17
460amnoncommon in occupied office air (common united states of america, air, state of california, indoor, office)2019-01-12v4No1 / 17
607amnoncommon homo sapiens, control, nasopharynx, germany, nasal wash2020-04-19v4No1 / 17
607amnondominant homo sapiens, control, nasopharynx, germany, nasal wash2020-04-19v4No1 / 17
636amnoncommon homo sapiens, united states of america, hospital, oropharynx, adult, commonwealth of pennsylvania, acute respiratory failure, respiratory failure, oropharyngeal swab2020-08-08v4No1 / 17
640amnondominant homo sapiens, female, saliva, adult, china, shanghai district2020-08-22v4No1 / 17
775amnondominant homo sapiens, saliva, adult, china, jinan city prefecture2021-04-24v4No1 / 17
658amnondominant homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, age 10 years, supragingival dental plaque, asian, age 7 years, age 6 years, age 8 years, age 9 years, age 11 years, burmese2020-09-17v3No1 / 17
725amnondominant homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 17
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, age 18 months2021-04-26v3No1 / 17
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, age 3 years2021-04-26v3No1 / 17
797amnoncommon feces, homo sapiens, infant, germany, age 3 months, formula fed2021-06-13v3No1 / 17
806amnon high in dorsum of tongue compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 17
245amnoncommon homo sapiens, breast milk, finland2017-11-21v4No1 / 18
246amnondominant homo sapiens, saliva, italy2017-11-21v4No1 / 18
272amnonhigh freq. in subgingival plaque in south korea (dominant homo sapiens, dentition, subgingival plaque, mouth, south korea)2018-01-10v4No1 / 18
362amnondominant hydrothermal vent, volcanic crater, water, volcanic rock, marine sediment, sea water, marine hydrothermal vent, mediterranean sea, greece, active vent2018-08-29v4No1 / 18
663amnondominant homo sapiens, adult, poland, oral wash, mouth2020-09-22v4No1 / 18
715amnondominant homo sapiens, esophagus, adult, australia, oesophageal brush2028-05-22v4No1 / 18
817amnondominant united states of america, research facility, saliva, oral cavity, commonwealth of pennsylvania, oral wash, captive, cheek pouch, macaca fascicularis, cynomolgus macaque2021-07-07v4No1 / 18
519amnondominant homo sapiens, city, dentition, late adult stage, adult, supragingival plaque, china2019-06-25v3No1 / 18
555amnondominant homo sapiens, saliva, child, shanghai proper, age 7-14 years, china2019-09-10v3No1 / 18
716amnondominant homo sapiens, tongue, adult, dermal layer of tongue, china, halitosis, chronic bad breath2028-05-22v3No1 / 18
724amnoncommon homo sapiens, female, pregnancy, vagina, adult, egypt, ismailia, age 25-45 years, pregnancy trimester 22021-01-03v3No1 / 18
774amnondominant homo sapiens, control, saliva, oral cavity, adult, hong kong, oral wash2021-04-24v3No1 / 18
777amnoncommon homo sapiens, saliva, infant, sweden, age 3 months, municipality of umea2021-04-26v3No1 / 18
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, age 18 months2021-04-26v3No1 / 18
777amnondominant homo sapiens, saliva, child, sweden, age 5 years, municipality of umea2021-04-26v3No1 / 18
806amnondominant homo sapiens, united states of america, pair of nares, adult, state of new york, external naris2021-06-19v3No1 / 18
806amnondominant homo sapiens, united states of america, mouth mucosa, adult, state of new york, buccal mucosa2021-06-19v3No1 / 18
806amnondominant homo sapiens, united states of america, adult, state of new york, hard palate2021-06-19v3No1 / 18
245amnoncommon homo sapiens, breast milk, south africa2017-11-21v4No1 / 19
299amnondominant homo sapiens, saliva, adult, mouth neoplasm, cancer, china2018-02-27v4No1 / 19
339amnoncommon feces, homo sapiens, infant, age < 1 year, india2018-05-24v4No1 / 19
408amnoncommon united states of america, larval stage, costa rica, crematogaster, ant2018-11-22v4No1 / 19
607amnoncommon homo sapiens, nasopharynx, germany, parkinson's disease, nasal wash2020-04-19v4No1 / 19
54amnondominant homo sapiens, united states of america, saliva2017-01-23v4No1 / 19
66amnondominant homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 19
555amnondominant homo sapiens, dentition, child, shanghai proper, supragingival plaque, age 7-14 years, china2019-09-10v3No1 / 19
678amnondominant homo sapiens, adult, kingdom of spain, supragingival plaque, supragingival dental plaque, tooth disease, black dental staining2028-03-02v3No1 / 19
679amnondominant homo sapiens, tonsil, fasting, child, palatine tonsil, south korea, age 5-10 years2028-03-02v3No1 / 19
704amnondominant homo sapiens, saliva, child, turkey, istanbul, age 5-10 years2028-04-02v3No1 / 19
723amnondominant homo sapiens, female, breast milk, adult, breast milk material, indonesia, municipality of yogyakarta2021-01-02v3No1 / 19
725amnondominant homo sapiens, control, adult, subgingival plaque, subgingival dental plaque, china, municipality of beijing2021-01-03v3No1 / 19
774amnondominant homo sapiens, saliva, oral cavity, adult, hong kong, oral wash, tonsillitis2021-04-24v3No1 / 19
806amnondominant homo sapiens, united states of america, adult, state of new york, palatine tonsil2021-06-19v3No1 / 19
105amnondominant homo sapiens, dentition, brazil, mouth, pulpitis2017-04-05v4No1 / 20
162amnonhigh freq. in periodontal pocket in humans (dominant homo sapiens, united states of america, dentition, san diego, subgingival plaque, periodontal pocket, mouth)2017-07-13v4No1 / 20
227amnoncommon in baby nasopharynx age <= 1 day (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v4No1 / 20
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one week2018-01-14v4No1 / 20
277amnoncommon homo sapiens, nasopharynx, adult, belgium2018-01-23v4No1 / 20
284amnoncommon feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
299amnonhigh freq. in healthy (non-tumor) controls (dominant homo sapiens, control, saliva, adult, china)2018-02-27v4No1 / 20
468amnonhigh freq. in trachea of children with respiratory technology dependence (dominant homo sapiens, united states of america, trachea, child, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 20
535amnonhigh freq. in adult vaginal samples with ICC (dominant homo sapiens, united states of america, female, vagina, cervical carcinoma, adult, state of arizona, phoenix, invasive carcinoma, invasive cervical carcinoma)2019-07-25v4No1 / 20
594amnondominant homo sapiens, saliva, adult, cameroon2020-03-12v4No1 / 20
677amnondominant homo sapiens, tonsil, adult, palatine tonsil, south korea2028-03-01v3No1 / 20
703amnondominant homo sapiens, saliva, adult, germany, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 20
723amnoncommon feces, homo sapiens, infant, child, indonesia, municipality of yogyakarta, age 0-6 months2021-01-02v3No1 / 20
797amnoncommon feces, homo sapiens, infant, germany, age 1 year, breast fed2021-06-13v3No1 / 20
33amnondominant homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 21
162amnonhigh freq. in supragingival plaque in humans (dominant homo sapiens, united states of america, dentition, san diego, supragingival plaque, mouth)2017-07-13v4No1 / 21
203amnondominant homo sapiens, oral cavity, dentition, australia, obsolete_juvenile stage, mouth2017-10-01v4No1 / 21
278amnondominant homo sapiens, united states of america, adult, state of california, subgingival plaque2018-01-23v4No1 / 21
460amnoncommon in outdoor air (common united states of america, air, state of california, outdoor)2019-01-12v4No1 / 21
501amnoncommon nectar, costa rica, flower, psiguria triphylla2019-03-08v4No1 / 21
511amnon high in kingdom of norway sweden finland lapland compared to united states of america state of colorado in depth 0-5cm snow 2019-03-20v4No1 / 21
567amnoncommon homo sapiens, pair of nares, adult, belgium, anterior naris2019-12-05v4No1 / 21
58amnoncommon homo sapiens, skin of face, new york city, skin under eyes2017-02-02v4No1 / 21
75amnondominant homo sapiens, saliva, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 21
576amnondominant homo sapiens, tongue, adult, czech republic2020-01-09v3No1 / 21
596amnoncommon homo sapiens, saliva, child, sweden, age 3 months2020-03-17v3No1 / 21
658amnondominant homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, age 10 years, supragingival dental plaque, hispanic or latin american, age 7 years, age 6 years, age 8 years, age 9 years, age 11 years, hispanic2020-09-17v3No1 / 21
716amnondominant homo sapiens, control, tongue, adult, dermal layer of tongue, china2028-05-22v3No1 / 21
717amnondominant homo sapiens, pair of nares, skin, adult, canada, province of ontario, epidermis, inner nostril2028-05-22v3No1 / 21
726amnondominant homo sapiens, tongue, adult, italy, dermal layer of tongue, milan2021-01-03v3No1 / 21
806amnondominant homo sapiens, united states of america, saliva, adult, state of new york2021-06-19v3No1 / 21
87amnoncommon homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v4No1 / 22
96amnondominant homo sapiens, brazil, subgingival plaque, mouth2017-03-29v4No1 / 22
158amnoncommon united states of america, external acoustic meatus, felis catus, cat, ear canal2017-07-06v4No1 / 22
378amnondominant homo sapiens, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth, periodontitis2018-09-14v4No1 / 22
425amnondominant homo sapiens, duodenum, child, africa, madagascar, stunted growth, antananarivo2018-12-08v4No1 / 22
455amnondominant homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 22
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 22
731amnondominant in orophringeal otic secretion drainage (dominant homo sapiens, united states of america, oropharynx, adult, state of michigan)2021-01-09v4No1 / 22
576amnon high in mouth mucosa compared to tongue in homo sapiens adult czech republic 2020-01-09v3No1 / 22
655amnondominant in patients after hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No1 / 22
658amnondominant homo sapiens, united states of america, dentition, african american, child, state of nebraska, supragingival plaque, age 10 years, supragingival dental plaque, age 7 years, age 6 years, age 8 years, age 9 years, age 11 years2020-09-17v3No1 / 22
806amnoncommon homo sapiens, united states of america, adult, state of new york, gingiva, keratinized gingiva2021-06-19v3No1 / 22
241amnoncommon in babies age < 3 years in finland (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 23
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex simplex2018-11-22v4No1 / 23
425amnondominant homo sapiens, stomach, child, africa, central african republic, bangui, stunted growth2018-12-08v4No1 / 23
636amnondominant homo sapiens, united states of america, hospital, adult, commonwealth of pennsylvania, tracheal aspirate, acute respiratory failure, respiratory failure, trachea, endotracheal aspirate2020-08-08v4No1 / 23
636amnondominant homo sapiens, united states of america, hospital, oropharynx, adult, commonwealth of pennsylvania, acute respiratory failure, respiratory failure, oropharyngeal swab2020-08-08v4No1 / 23
58amnoncommon homo sapiens, new york city, contact lens2017-02-02v4No1 / 23
634amnondominant homo sapiens, saliva, adult, germany, high physical activity, endurance athlete2020-06-16v3No1 / 23
658amnondominant homo sapiens, united states of america, dentition, caucasian, child, state of nebraska, supragingival plaque, age 10 years, supragingival dental plaque, european, age 7 years, age 6 years, age 8 years, age 9 years, age 11 years2020-09-17v3No1 / 23
704amnondominant homo sapiens, saliva, child, age 10-15 years, turkey, istanbul2028-04-02v3No1 / 23
712amnondominant homo sapiens, saliva, adult, russia, kazan2028-05-21v3No1 / 23
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, epidermis, umbilicus, bellybutton2028-05-22v3No1 / 23
717amnon high in female female organism compared to male male organism in homo sapiens skin adult canada province of ontario upper leg skin epidermis inner thigh 2028-05-22v3No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 23
96amnon high in control compared to periodontitis in homo sapiens brazil subgingival plaque mouth 2017-03-29v4No1 / 24
173amnondominant homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 24
202amnondominant homo sapiens, oral cavity, mouth mucosa, mouth, china2017-10-01v4No1 / 24
260amnondominant homo sapiens, united states of america, dentition, state of nebraska, subgingival plaque, mouth2017-12-05v4No1 / 24
378amnondominant homo sapiens, dentition, adult, brazil, subgingival plaque, depth > 3mm, deep pocket depth, mouth, periodontitis2018-09-14v4No1 / 24
469amnoncommon homo sapiens, united states of america, lung, bronchoalveolar lavage, adult, state of new york, idiopathic pulmonary fibrosis2019-01-14v4No1 / 24
554amnondominant homo sapiens, dentition, adult, egypt, root canal, primary endodontic infection, root canal infection2019-09-10v3No1 / 24
713amnoncommon feces, homo sapiens, crohn's disease, active disease2028-05-21v3No1 / 24
717amnondominant homo sapiens, skin, adult, canada, province of ontario, epidermis, umbilicus, bellybutton2028-05-22v3No1 / 24
35amnoncommon homo sapiens, hospital, dense settlement biome, breast milk, tanzania2016-12-06v4No1 / 25
159amnon high in midgut compared to hindgut in australia siganidae rabbitfish 2017-07-06v4No1 / 25
258amnonhigh freq. in lungs of hiv patients with pneumonia (dominant homo sapiens, lung, bronchoalveolar lavage, hiv infection, bronchial epithelium, uganda, pneumonia)2017-11-27v4No1 / 25
425amnondominant homo sapiens, duodenum, child, africa, central african republic, bangui, stunted growth2018-12-08v4No1 / 25
428amnoncommon feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 25
607amnoncommon homo sapiens, nasopharynx, germany, rem sleep behavior disorder, nasal wash2020-04-19v4No1 / 25
640amnondominant homo sapiens, female, dentition, adult, supragingival plaque, supragingival dental plaque, china, shanghai district2020-08-22v4No1 / 25
663amnoncommon homo sapiens, nasal cavity, pair of nares, adult, poland2020-09-22v4No1 / 25
683amnoncommon during antibiotics treatment in feces (common feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 25
770amnondominant oral cavity, mouth mucosa, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 25
572amnondominant homo sapiens, tongue, dermal layer of tongue, pancreatic cancer, china2019-12-16v3No1 / 25
714amnondominant homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 25
717amnoncommon homo sapiens, axilla, skin, adult, canada, province of ontario, epidermis, armpit2028-05-22v3No1 / 25
723amnoncommon homo sapiens, female, breast milk, adult, breast milk material, indonesia, municipality of yogyakarta2021-01-02v3No1 / 25
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in united states of america felis catus cat )2017-07-06v4No1 / 26
354amnoncommon homo sapiens, united states of america, nasal cavity, pair of nares, adult, nasal brush2018-07-30v4No1 / 26
565amnoncommon skin, felis catus, cat, canada2019-11-21v3No1 / 26
572amnondominant homo sapiens, control, tongue, dermal layer of tongue, china2019-12-16v3No1 / 26
572amnondominant homo sapiens, tongue, dermal layer of tongue, liver carcinoma, china2019-12-16v3No1 / 26
104amnondominant homo sapiens, dentition, russia, moscow, subgingival plaque, mouth2017-04-05v4No1 / 27
158amnoncommon united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 27
685amnoncommon homo sapiens, oral cavity, mouth mucosa, adult, australia2028-03-08v3No1 / 27
717amnoncommon homo sapiens, pair of nares, skin, adult, canada, province of ontario, epidermis, inner nostril2028-05-22v3No1 / 27
378amnon high in depth < 3mm shallow pocket depth compared to depth > 3mm deep pocket depth in homo sapiens dentition adult brazil subgingival plaque mouth periodontitis 2018-09-13v4No1 / 28
817amnoncommon united states of america, research facility, lung, bronchoalveolar lavage, commonwealth of pennsylvania, captive, macaca fascicularis, cynomolgus macaque2021-07-08v4No1 / 28
58amnoncommon homo sapiens, conjunctiva, new york city2017-02-02v4No1 / 28
596amnon high in age 2 years compared to age 7 years in homo sapiens saliva child sweden 2020-03-18v3No1 / 28
806amnon high in gingiva keratinized gingiva compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, sebum, axilla, inguinal region)2016-12-05v4No1 / 29
193amnonlower in nares of people working in dairy farms ( high in control compared to farm bos taurus in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 29
711amnoncommon homo sapiens, united states of america, oral cavity, adult, state of colorado, mouth2028-05-21v4No1 / 29
797amnon high in age 3 months compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 29
806amnoncommon homo sapiens, united states of america, adult, state of new york, dorsum of tongue2021-06-19v3No1 / 29
3amnondominant homo sapiens, tongue, china2016-10-06v4No1 / 30
246amnon high in body mass index high bmi obesity compared to control in homo sapiens saliva italy 2017-11-21v4No1 / 30
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america stem vitis vinifera state of california grape endosphere )2017-08-30v4No1 / 31
262amnoncommon research facility, larval stage, body proper, ixodes scapularis, tick2017-12-10v4No1 / 31
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 31
655amnoncommon in patients before hematopoietic stem cell transplant (common feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 31
806amnoncommon homo sapiens, united states of america, adult, state of new york, hard palate2021-06-19v3No1 / 31
26amnoncommon united states of america, mucus, pair of nares, canis lupus familiaris2016-12-05v4No1 / 32
292amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens adult china 2018-02-05v4No1 / 32
63amnoncommon in saliva in american gut (common homo sapiens, saliva)2017-02-15v4No1 / 32
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, upper leg skin, epidermis, inner thigh2028-05-22v3No1 / 32
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, external nose, epidermis, outer nose2028-05-22v3No1 / 32
646amnoncommon homo sapiens, sputum, united states of america, cystic fibrosis, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 33
669amnon high in age 2 weeks compared to age 1 year in feces homo sapiens infant sweden 2020-09-26v4No1 / 33
131amnon high in male compared to female in feces homo sapiens south korea 2017-04-16v4No1 / 34
79amnoncommon united states of america, skin, stenella longirostris, spinner dolphin2017-03-03v4No1 / 34
24amnondisappears on transition to cow milk ( high in breast milk compared to mammalian milk beverage in feces homo sapiens infant )2016-12-01v4No1 / 35
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in age age < 1 year compared to age > 1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 35
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in research facility larval stage body proper ixodes scapularis tick )2017-12-10v4No1 / 35
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in age age 1 week compared to age 3 months in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 35
79amnoncommon united states of america, skin, steno bredanensis, rough-toothed dolphin2017-03-03v4No1 / 35
596amnoncommon homo sapiens, saliva, infant, child, sweden, age 6 months2020-03-17v3No1 / 35
228amnoncommon in sinus brush of healthy participants (common homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space)2017-10-31v4No1 / 36
240amnoncommon in infants age <3 years (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 36
367amnoncommon coast, air, namibia2018-09-02v4No1 / 36
468amnoncommon in trachea of children with respiratory technology dependence (common homo sapiens, united states of america, trachea, child, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 36
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of cheek, south korea, age 20-30 years2021-03-10v4No1 / 36
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of forehead, south korea, age 20-30 years2021-03-10v4No1 / 36
596amnoncommon homo sapiens, saliva, child, sweden, age 1 year2020-03-17v3No1 / 36
158amnoncommon united states of america, axilla, felis catus, cat2017-07-06v4No1 / 37
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, foot, australia, diabetes mellitus)2017-11-05v4No1 / 37
277amnoncommon homo sapiens, nasal cavity, pair of nares, adult, belgium2018-01-23v4No1 / 37
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, adult, austria, graz city district2018-06-11v4No1 / 37
711amnoncommon homo sapiens, united states of america, oral cavity, child, state of colorado, mouth, age 8-12 years2028-05-21v4No1 / 37
723amnon high in infant age 0-6 months compared to age 2-4 years in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 37
227amnonhigher in nasopharynx of formula fed babies compared to breast fed ( high in diet formula fed compared to breast milk breast fed in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-11-03v4No1 / 38
390amnoncommon feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 38
679amnoncommon homo sapiens, saliva, fasting, child, south korea, age 5-10 years2028-03-02v3No1 / 38
806amnoncommon homo sapiens, united states of america, pair of nares, adult, state of new york, external naris2021-06-19v3No1 / 38
677amnoncommon homo sapiens, tonsil, adult, palatine tonsil, south korea2028-03-01v3No1 / 39
797amnon high in age 3 months compared to age 1 month in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 39
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
501amnoncommon nectar, costa rica, flower, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 40
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
806amnoncommon homo sapiens, united states of america, mouth mucosa, adult, state of new york, buccal mucosa2021-06-19v3No1 / 40
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 41
117amnoncommon united states of america, research facility, larval stage, intestine, danio rerio, zebra fish2017-04-10v4No1 / 41
731amnonlower in oropharingeal otic fluid drainage compared to buccal mucosa ( high in mouth mucosa buccal mucosa compared to oropharynx in homo sapiens united states of america adult state of michigan )2021-01-09v4No1 / 41
782amnon high in juvenile organism age 1-2 years compared to adult organism age 3 years in fish farm skin portuguese republic sparus aurata ria formosa open water pond seabream 2021-05-06v4No1 / 41
806amnoncommon homo sapiens, united states of america, dentition, adult, state of new york, supragingival plaque, supragingival dental plaque2021-06-19v3No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to feces caecum transverse colon left colon right colon in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 42
158amnoncommon united states of america, interdigital region, felis catus, cat2017-07-06v4No1 / 42
79amnoncommon united states of america, skin, globicephala macrorhynchus, short finned pilot whale2017-03-03v4No1 / 42
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, age 2-4 years2019-11-18v3No1 / 42
763amnon high in subsurface depth 20-100cm compared to surface depth 0-20cm in glacier sweden filtered 0.2um ice 2021-04-10v3No1 / 42
231amnoncommon in dog genitalia (common united states of america, reproductive system, reproductive organ, canis lupus familiaris, dog, genitalia)2017-11-02v4No1 / 43
371amnoncommon homo sapiens, saliva, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 43
782amnon high in juvenile organism age 1-2 years compared to adult organism age 3 years in fish farm gill portuguese republic sparus aurata ria formosa open water pond seabream 2021-05-06v4No1 / 43
696amnoncommon stomach, gastrointestinal system, malaysia, state of sabah, helicarionidae, land snail, kaliella scandens, kaliella2028-03-27v3No1 / 43
517amnoncommon homo sapiens, mouth mucosa, child, bolivia, chuquisaca department, rural community, age 5-13 years, mouth2019-05-29v4No1 / 44
69amnoncommon united states of america, research facility, bronchoalveolar lavage, canis lupus familiaris, beagle dog2017-02-21v4No1 / 44
606amnoncommon homo sapiens, skin, adult, south africa, penis, male organism, male2020-04-15v3No1 / 44
703amnon high in saliva compared to dentition subgingival plaque subgingival dental plaque in homo sapiens adult germany type 2 diabetes mellitus city of dresden 2028-04-02v3No1 / 44
717amnoncommon homo sapiens, dorsum, skin, adult, canada, province of ontario, back, epidermis2028-05-22v3No1 / 44
113amnoncommon united states of america, research facility, larval stage, intestine, danio rerio, zebra fish2017-04-10v4No1 / 45
244amnoncommon digestive system, research facility, drosophila melanogaster, fruit fly, united kingdom2017-11-15v4No1 / 45
558amnoncommon united states of america, duodenum, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 45
773amnoncommon homo sapiens, adult, palatine tonsil, tonsillitis, japan, tonsillectomy, recurrent tonsillitis2021-04-23v4No1 / 45
32amnoncommon homo sapiens, saliva, infant, bolivia2016-12-05v4No1 / 46
428amnon high in acute pancreatitis pancreatitis compared to control in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 46
287amnoncommon mountain, snow field, depth 6-7m, japan2018-01-29v4No1 / 47
572amnoncommon homo sapiens, control, tongue, dermal layer of tongue, china2019-12-16v3No1 / 47
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, upper eyelid, epidermis2028-05-22v3No1 / 47
89amnoncommon cloaca, commonwealth of virginia, junco hyemalis, songbird2017-03-08v4No1 / 48
546amnoncommon homo sapiens, saliva, adult, slovak republic, morning, age 21-28 years2019-08-07v3No1 / 48
806amnoncommon homo sapiens, united states of america, adult, state of new york, palatine tonsil2021-06-19v3No1 / 48
258amnoncommon in lungs of hiv patients with pneumonia (common homo sapiens, lung, bronchoalveolar lavage, hiv infection, bronchial epithelium, uganda, pneumonia)2017-11-27v4No1 / 49
770amnon high in infant age < 1 year compared to age 10-15 years adult organism in oral cavity mouth mucosa macaca mulatta cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 49
339amnon high in infant age < 1 year compared to adult in feces homo sapiens india 2018-05-24v4No1 / 50
564amnoncommon feces, homo sapiens, control, child, italy, age 2-4 years2019-11-18v3No1 / 50
725amnoncommon homo sapiens, control, mouth mucosa, adult, buccal mucosa, china, municipality of beijing2021-01-03v3No1 / 51
335amnoncommon in mouthwash (common homo sapiens, united states of america, oral cavity, oral wash, mouth)2018-05-16v4No1 / 52
354amnoncommon homo sapiens, united states of america, saliva, adult, oral wash2018-07-30v4No1 / 52
416amnon high in fasting compared to wood diet in united states of america research facility colon termite reticulitermes flaviceps 2018-11-30v4No1 / 52
796amnoncommon feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 52
797amnon high in infant age 1 year compared to child age 2 years in feces homo sapiens germany formula fed 2021-06-13v3No1 / 52
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
661amnoncommon farm, lung, china, maojian district, andrias davidianus, chinese giant salamander, age 3 years2020-09-20v4No1 / 53
515amnoncommon poland, whole body, plant, beetle, aphthona venustula, nida basin, herbivorous beetle2019-04-18v4No1 / 54
773amnoncommon homo sapiens, adult, palatine tonsil, iga glomerulonephritis, japan, tonsillectomy2021-04-23v4No1 / 54
771amnoncommon body proper, whole body, china, aphis gossypii, cotton aphid2021-04-21v3No1 / 54
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in antibiotic vancomycin metronidazole neomycin compared to control in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, systemic lupus erythematosus, china2028-04-11v3No1 / 55
653amnon high in saliva compared to tongue dermal layer of tongue in homo sapiens adult toronto canada age 20-30 years 2020-09-13v3No1 / 55
817amnon high in saliva oral cavity oral wash cheek pouch compared to lung bronchoalveolar lavage in united states of america research facility commonwealth of pennsylvania captive macaca fascicularis cynomolgus macaque 2021-07-08v4No1 / 56
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, chest, epidermis, torso2028-05-22v3No1 / 56
26amnon high in mucus pair of nares compared to saliva mouth in united states of america canis lupus familiaris 2016-12-05v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, dust, hospital, state of california, floor)2018-03-31v4No1 / 57
431amnoncommon in midgut of hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 57
462amnon high in root compared to rhizosphere in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 57
56amnoncommon nectar, israel, nicotiana galuca, flower2017-01-30v4No1 / 57
596amnoncommon homo sapiens, saliva, child, sweden, age 2 years2020-03-17v3No1 / 57
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, palmar part of manus, epidermis, palm of hand2028-05-22v3No1 / 57
523amnoncommon united states of america, building, air, state of illinois, chicago, bedroom2019-07-03v4No1 / 58
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, plantar part of pes, epidermis, bottom of foot2028-05-22v3No1 / 58
260amnoncommon homo sapiens, united states of america, dentition, state of nebraska, subgingival plaque, mouth2017-12-05v4No1 / 59
770amnoncommon oral cavity, mouth mucosa, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 59
596amnoncommon homo sapiens, saliva, child, sweden, age 7 years2020-03-17v3No1 / 59
228amnonlower in chronic sinositis compared to healthy controls in sinus brushing ( high in control compared to sinusitis in homo sapiens united states of america mucosa paranasal sinus sinusoidal space )2017-10-31v4No1 / 60
572amnoncommon homo sapiens, tongue, dermal layer of tongue, liver carcinoma, china2019-12-16v3No1 / 60
335amnoncommon homo sapiens, united states of america, bronchial epithelium2018-05-16v4No1 / 61
374amnoncommon skin, costa rica, frog, amphibia, oophaga pumilio, strawberry poison frog2018-09-09v4No1 / 61
637amnoncommon feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 61
549amnoncommon puerto rico, isla palominos, coral, acropora cervicornis2019-08-17v4No1 / 62
593amnoncommon feces, homo sapiens, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
354amnoncommon homo sapiens, sputum, united states of america, adult, induced sputum2018-07-30v4No1 / 63
726amnoncommon homo sapiens, tongue, adult, italy, dermal layer of tongue, milan2021-01-03v3No1 / 63
558amnon high in duodenum compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 64
671amnon high in age 1 month compared to age 3 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 64
679amnoncommon homo sapiens, tonsil, fasting, child, palatine tonsil, south korea, age 5-10 years2028-03-02v3No1 / 64
242amnoncommon in native-americans (common feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 65
272amnoncommon in subgingival plaque in south korea (common homo sapiens, dentition, subgingival plaque, mouth, south korea)2018-01-10v4No1 / 65
354amnoncommon homo sapiens, united states of america, bronchus, bronchial epithelium, adult, bronchial brush2018-07-30v4No1 / 65
640amnoncommon homo sapiens, female, dentition, adult, supragingival plaque, supragingival dental plaque, china, shanghai district2020-08-22v4No1 / 65
576amnoncommon homo sapiens, mouth mucosa, adult, czech republic, lip, lower labial mucosa2020-01-09v3No1 / 66
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
162amnoncommon in periodontal pocket in humans (common homo sapiens, united states of america, dentition, san diego, subgingival plaque, periodontal pocket, mouth)2017-07-13v4No1 / 67
194amnon high in colon ileum compared to feces in homo sapiens kingdom of norway 2017-09-07v4No1 / 67
576amnoncommon homo sapiens, tongue, adult, czech republic2020-01-09v3No1 / 67
682amnoncommon city, air, kingdom of spain, madrid2028-03-04v3No1 / 67
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 68
690amnoncommon in squamous esophagos samples from patients undergoing endoscopy (common homo sapiens, united states of america, hospital, esophagus, new york city, esophageal disease, squamous esophagus)2028-03-11v4No1 / 68
770amnoncommon oral cavity, mouth mucosa, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 68
231amnoncommon in dog urine (common united states of america, urine, canis lupus familiaris, dog)2017-11-02v4No1 / 69
378amnoncommon homo sapiens, control, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth2018-09-14v4No1 / 69
594amnon high in city yaounde compared to rural community ngoantet in feces homo sapiens adult cameroon 2020-03-12v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
572amnoncommon homo sapiens, tongue, dermal layer of tongue, pancreatic cancer, china2019-12-16v3No1 / 70
763amnonhigher in blank compared to samples (contamination)2021-04-10v3No1 / 70
576amnoncommon homo sapiens, mouth mucosa, adult, czech republic, buccal mucosa2020-01-09v3No1 / 71
817amnoncommon united states of america, research facility, saliva, oral cavity, commonwealth of pennsylvania, oral wash, captive, cheek pouch, macaca fascicularis, cynomolgus macaque2021-07-07v4No1 / 72
716amnoncommon homo sapiens, control, tongue, adult, dermal layer of tongue, china2028-05-22v3No1 / 72
26amnoncommon homo sapiens, united states of america, mucus, pair of nares2016-12-05v4No1 / 73
634amnoncommon homo sapiens, saliva, adult, germany, high physical activity, endurance athlete2020-06-16v3No1 / 74
774amnoncommon homo sapiens, saliva, oral cavity, adult, hong kong, oral wash, tonsillitis2021-04-24v3No1 / 74
719amnoncommon united states of america, research facility, dentition, mus musculus, state of georgia, mouse, charles river laboratories, icr/cd-1 mice2028-05-23v4No1 / 75
725amnon high in mouth mucosa buccal mucosa compared to subgingival plaque subgingival dental plaque in homo sapiens adult china municipality of beijing 2021-01-03v3No1 / 75
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in research facility midgut belgium bombus terrestris bumble bee queen )2018-12-16v4No1 / 77
731amnoncommon in orophringeal otic secretion drainage (common homo sapiens, united states of america, oropharynx, adult, state of michigan)2021-01-09v4No1 / 77
54amnoncommon homo sapiens, united states of america, saliva2017-01-23v4No1 / 77
569amnoncommon in gastric biopsies of patients positive for h. pylori (common homo sapiens, stomach, biopsy, mucosa of stomach, helicobacter pylori infectious disease, south korea)2019-12-16v3No1 / 77
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
360amnoncommon desert, leaf, mexico, guanajuato, agave, leaf endosphere, agave tequiliana, cultivated environment2018-08-21v4No1 / 78
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
404amnoncommon feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 79
671amnon high in age 3 months age 6 months compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 79
732amnoncommon feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 79
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, age 18 months2021-04-26v3No1 / 79
777amnon high in infant age 3 months compared to child age 18 months in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 79
26amnoncommon united states of america, mucus, pair of nares, felis catus2016-12-05v4No1 / 80
203amnonnegatively correlated with age in child dental plaque ( high in young age compared to age old age in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth )2017-10-01v4No1 / 80
378amnoncommon homo sapiens, dentition, adult, brazil, subgingival plaque, depth > 3mm, deep pocket depth, mouth, periodontitis2018-09-14v4No1 / 80
534amnoncommon river, tributary, water, fresh water, nepal, free floating, depth 10 cm, filtered 0.2um, koshi river2019-07-22v4No1 / 80
3amnoncommon homo sapiens, tongue, china2016-10-06v4No1 / 81
203amnoncommon homo sapiens, oral cavity, dentition, australia, obsolete_juvenile stage, mouth2017-10-01v4No1 / 81
643amnoncommon feces, homo sapiens, adult, south korea2020-08-30v4No1 / 81
658amnoncommon homo sapiens, united states of america, dentition, caucasian, child, state of nebraska, supragingival plaque, age 10 years, supragingival dental plaque, european, age 7 years, age 6 years, age 8 years, age 9 years, age 11 years2020-09-17v3No1 / 82
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, china2028-04-11v3No1 / 82
716amnoncommon homo sapiens, tongue, adult, dermal layer of tongue, china, halitosis, chronic bad breath2028-05-22v3No1 / 82
565amnoncommon skin, canis lupus familiaris, dog, canada2019-11-21v3No1 / 83
777amnoncommon homo sapiens, saliva, child, sweden, age 5 years, municipality of umea2021-04-26v3No1 / 83
777amnon high in age 18 months compared to age 3 years in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 83
378amnoncommon homo sapiens, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth, periodontitis2018-09-14v4No1 / 84
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
663amnoncommon homo sapiens, lung, bronchoalveolar lavage, adult, poland2020-09-22v4No1 / 84
601amnoncommon feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 85
731amnoncommon homo sapiens, united states of america, mouth mucosa, adult, state of michigan, buccal mucosa2021-01-09v4No1 / 85
802amnoncommon homo sapiens, united states of america, saliva, adult, state of new york, cornell university2021-06-16v4No1 / 85
569amnoncommon in gastric biopsies of patients negative for h. pylori (common homo sapiens, stomach, biopsy, south korea, mucosa of stomach)2019-12-16v3No1 / 85
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
26amnon high in mucus pair of nares compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
162amnoncommon in supragingival plaque in humans (common homo sapiens, united states of america, dentition, san diego, supragingival plaque, mouth)2017-07-13v4No1 / 86
209amnon high in atlantic ocean compared to pacific ocean in respiratory airway north america megaptera novaeangliae humpback whale exhaled air condensate whale blow 2017-10-15v4No1 / 86
277amnon high in nasal cavity pair of nares compared to nasopharynx in homo sapiens adult belgium 2018-01-23v4No1 / 86
806amnoncommon homo sapiens, united states of america, oral cavity, adult, state of new york, oral wash, mouth2021-06-19v3No1 / 86
319amnoncommon homo sapiens, united states of america, saliva, state of texas2018-04-18v4No1 / 87
805amnoncommon homo sapiens, sputum, adult, united kingdom, city of london2021-06-18v3No1 / 88
703amnoncommon homo sapiens, dentition, adult, germany, subgingival plaque, subgingival dental plaque, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 89
199amnoncommon on shower wall tile (common united states of america, building, urban biome, bathroom, shower, tile, building wall)2017-10-01v4No1 / 90
79amnoncommon united states of america, skin, balaenoptera borealis, sei whale2017-03-03v4No1 / 90
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in united states of america building urban biome )2017-10-01v4No1 / 91
26amnon high in mucus pair of nares compared to sebum axilla inguinal region in homo sapiens united states of america 2016-12-05v4No1 / 92
715amnoncommon homo sapiens, esophagus, adult, australia, oesophageal brush2028-05-22v4No1 / 92
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
725amnoncommon homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, chronic periodontitis, china, municipality of beijing2021-01-03v3No1 / 92
774amnoncommon homo sapiens, control, saliva, oral cavity, adult, hong kong, oral wash2021-04-24v3No1 / 92
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, age 3 years2021-04-26v3No1 / 92
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
658amnoncommon homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, age 10 years, supragingival dental plaque, hispanic or latin american, age 7 years, age 6 years, age 8 years, age 9 years, age 11 years, hispanic2020-09-17v3No1 / 93
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
348amnoncommon homo sapiens, saliva, adult, italy2018-07-16v4No1 / 94
238amnoncommon feces, homo sapiens, colombia2017-11-07v4No1 / 96
278amnoncommon homo sapiens, united states of america, adult, state of california, subgingival plaque2018-01-23v4No1 / 96
58amnon high in conjunctiva compared to skin skin under eye in homo sapiens new york city 2017-02-02v4No1 / 96
555amnoncommon homo sapiens, saliva, child, shanghai proper, age 7-14 years, china2019-09-10v3No1 / 96
678amnoncommon homo sapiens, adult, kingdom of spain, supragingival plaque, supragingival dental plaque, tooth disease, black dental staining2028-03-02v3No1 / 96
558amnoncommon united states of america, gizzard, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 97
558amnon high in colon compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 97
323amnonlower in teeth compared to skin and gills in sharks ( high in gill skin compared to dentition in united states of america atlantic ocean state of florida south florida shark )2018-04-24v4No1 / 98
658amnoncommon homo sapiens, united states of america, dentition, african american, child, state of nebraska, supragingival plaque, age 10 years, supragingival dental plaque, age 7 years, age 6 years, age 8 years, age 9 years, age 11 years2020-09-17v3No1 / 98
105amnoncommon homo sapiens, dentition, brazil, mouth, pulpitis2017-04-05v4No1 / 100
202amnoncommon homo sapiens, oral cavity, mouth mucosa, mouth, china2017-10-01v4No1 / 100
455amnoncommon homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 100
483amnoncommon united states of america, research facility, larval stage, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-13v4No1 / 100
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 102
554amnoncommon homo sapiens, dentition, adult, egypt, root canal, primary endodontic infection, root canal infection2019-09-10v3No1 / 102
198amnoncommon united states of america, hot spring, geothermal field, water, yellowstone national park, high temperature environment2017-09-13v4No1 / 103
563amnoncommon feces, homo sapiens, control, united states of america, homosexual, msm, male, rectal swab2019-11-18v4No1 / 103
493amnoncommon homo sapiens, united states of america, saliva, adult, state of new york2019-02-27v4No1 / 104
519amnoncommon homo sapiens, city, dentition, late adult stage, adult, supragingival plaque, china2019-06-25v3No1 / 104
777amnon high in age 2 days compared to age 3 months in homo sapiens saliva infant sweden municipality of umea 2021-04-26v3No1 / 104
79amnoncommon united states of america, skin, balaenoptera physalus, fin whale2017-03-03v4No1 / 105
704amnoncommon homo sapiens, saliva, child, age 10-15 years, turkey, istanbul2028-04-02v3No1 / 105
663amnoncommon homo sapiens, adult, poland, oral wash, mouth2020-09-22v4No1 / 106
712amnoncommon homo sapiens, saliva, adult, russia, kazan2028-05-21v3No1 / 106
806amnoncommon homo sapiens, united states of america, saliva, adult, state of new york2021-06-19v3No1 / 106
149amnon high in stream compared to pond in larval stage intestine amphibian larval stage germany salamandra salamandra fire salamander 2017-04-24v4No1 / 107
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
278amnon high in control compared to periodontitis in homo sapiens united states of america adult state of california subgingival plaque 2018-01-23v4No1 / 107
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water sea water depth 0m in united states of america atlantic ocean state of florida south florida )2018-04-24v4No1 / 107
704amnoncommon homo sapiens, saliva, child, turkey, istanbul, age 5-10 years2028-04-02v3No1 / 107
524amnoncommon homo sapiens, saliva, adult, sichuan province, china2019-07-06v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
425amnoncommon homo sapiens, stomach, child, africa, stunted growth2018-12-08v4No1 / 111
555amnoncommon homo sapiens, dentition, child, shanghai proper, supragingival plaque, age 7-14 years, china2019-09-10v3No1 / 112
198amnoncommon united states of america, geothermal field, sediment, thermophilic sediment, yellowstone national park, high temperature environment2017-09-13v4No1 / 113
594amnoncommon homo sapiens, saliva, adult, cameroon2020-03-12v4No1 / 113
79amnoncommon united states of america, skin, delphinus delphis2017-03-03v4No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
691amnon high in spring compared to summer in water drinking water french republic commune of paris 2028-03-11v3No1 / 115
703amnoncommon homo sapiens, saliva, adult, germany, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 115
32amnoncommon homo sapiens, saliva, adult, bolivia2016-12-05v4No1 / 116
195amnoncommon in boston subway surfaces (common city, urban biome, boston, train)2017-09-07v4No1 / 116
613amnoncommon research facility, aquarium, gastrointestinal system, poland, fish, olsztyn, esox lucius, pike fry, gut2020-04-25v3No1 / 116
640amnoncommon homo sapiens, female, saliva, adult, china, shanghai district2020-08-22v4No1 / 117
343amnoncommon in apple flowers (common united states of america, flower structure, malus x domestica, state of connecticut, flower, apple)2018-05-28v4No1 / 118
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
517amnoncommon homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 121
323amnoncommon freq. in shark teeth (common united states of america, dentition, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 123
425amnoncommon homo sapiens, duodenum, child, africa, madagascar, antananarivo2018-12-08v4No1 / 123
598amnoncommon homo sapiens, saliva, oral cavity, child, kingdom of spain, age 13-15 years2020-03-25v3No1 / 124
425amnoncommon homo sapiens, duodenum, child, africa, central african republic, bangui, stunted growth2018-12-08v4No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to rectum biopsy site biopsy in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 126
273amnon high in age age 1 week compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 127
113amnon high in larval stage compared to adult in united states of america research facility intestine danio rerio zebra fish 2017-04-10v4No1 / 128
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
75amnoncommon homo sapiens, saliva, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 129
199amnoncommon in kitchen sink (common united states of america, building, urban biome, kitchen, sink)2017-10-01v4No1 / 130
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in cloaca anas platyrhynchos state of california mallard )2017-03-05v4No1 / 131
515amnoncommon river, poland, whole body, beetle, carnivorous beetle, raba river, bembidion modestum2019-04-18v4No1 / 131
246amnoncommon homo sapiens, saliva, italy2017-11-21v4No1 / 133
278amnoncommon homo sapiens, united states of america, saliva, adult, state of california2018-01-23v4No1 / 133
775amnoncommon homo sapiens, saliva, adult, china, jinan city prefecture2021-04-24v4No1 / 133
511amnoncommon united states of america, state of colorado, depth 0-5cm, snow2019-03-20v4No1 / 134
519amnoncommon homo sapiens, city, saliva, late adult stage, adult, china2019-06-25v3No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 132017-09-12v4No1 / 136
725amnoncommon homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 136
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
255amnoncommon in fish feed (common united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 141
615amnoncommon leaf, brazil, leaf surface, greenhouse, exosphere, campinas, saccharum, sugarcane2020-04-27v4No1 / 143
291amnoncommon nasal cavity, pair of nares, canis lupus familiaris, germany, dog2018-02-01v4No1 / 144
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america adult state of california 2018-01-23v4No1 / 146
85amnoncommon digestive system, sea water, litopenaeus vannamei, shenzhen city prefecture, pacific white shrimp, china2017-03-06v4No1 / 147
475amnoncommon in air next to subway stations in hong kong (common city, air, hong kong)2019-01-20v4No1 / 147
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 148
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in wastewater treatment plant sewer compared to feces in city south america low income )2017-01-21v4No1 / 148
605amnon high in recurrent otitis media compared to control in nasopharynx child australia age 1-3 years perth 2020-04-07v3No1 / 149
362amnoncommon hydrothermal vent, volcanic crater, water, volcanic rock, marine sediment, sea water, marine hydrothermal vent, mediterranean sea, greece, active vent2018-08-29v4No1 / 150
64amnoncommon homo sapiens, saliva, sichuan province2017-02-16v4No1 / 152
615amnon high in stem stem endosphere upper stem compared to leaf leaf endosphere in brazil endosphere greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 153
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 154
273amnon high in age age one month compared to age one year in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 155
725amnoncommon homo sapiens, control, adult, subgingival plaque, subgingival dental plaque, china, municipality of beijing2021-01-03v3No1 / 156
108amnon high in colon compared to caecum in united states of america research facility texas coturnix coturnix common quail 2017-04-07v4No1 / 157
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
658amnoncommon homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, age 10 years, supragingival dental plaque, asian, age 7 years, age 6 years, age 8 years, age 9 years, age 11 years, burmese2020-09-17v3No1 / 157
96amnoncommon homo sapiens, brazil, subgingival plaque, mouth2017-03-29v4No1 / 158
519amnon high in saliva compared to dentition supragingival plaque in homo sapiens city late adult stage adult china 2019-06-25v3No1 / 159
678amnoncommon homo sapiens, control, adult, kingdom of spain, supragingival plaque, supragingival dental plaque2028-03-02v3No1 / 160
209amnoncommon in whale blow condensate (common respiratory airway, north america, megaptera novaeangliae, humpback whale, exhaled air condensate, whale blow)2017-10-15v4No1 / 161
475amnoncommon in air in subway train in hong kong (common city, air, hong kong, subway)2019-01-20v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 162
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 162
517amnon high in mouth mucosa mouth compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 162
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, foot, australia)2017-11-05v4No1 / 166
652amnoncommon homo sapiens, saliva, adult, sichuan province, china2020-09-13v3No1 / 166
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
323amnoncommon in shark cloaca (common united states of america, anal canal, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 167
159amnoncommon midgut, australia, siganidae, rabbitfish2017-07-06v4No1 / 169
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, age 13, india2017-09-12v4No1 / 170
323amnoncommon in shark gills (common united states of america, gill, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 170
374amnoncommon skin, costa rica, frog, amphibia, craugastor bransfordii, bransford’s litter frog2018-09-09v4No1 / 171
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
565amnoncommon zoological garden, skin, captive, pongo abelii, canada, toronto zoo, sumatran orangutan2019-11-21v3No1 / 174
299amnoncommon in healthy (non-tumor) controls (common homo sapiens, control, saliva, adult, china)2018-02-27v4No1 / 179
782amnon high in adult organism age 3 years compared to juvenile organism age 1 year in fish farm skin portuguese republic dicentrarchus labrax ria formosa open water pond seabass 2021-05-07v4No1 / 183
536amnoncommon united states of america, skin, pantherophis obsoletus, snake, southern united states, black rat snake, arboreal snake2019-07-28v4No1 / 184
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
299amnoncommon homo sapiens, saliva, adult, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
75amnoncommon homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site c 2017-04-08v4No1 / 193
201amnoncommon in decaying Saguaro cactus (common desert, mexico, cactus, carnegiea gigantea, saguaro, decaying)2017-10-01v4No1 / 193
201amnoncommon in decaying Cardon cactus (common desert, mexico, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 193
371amnoncommon homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 195
777amnon high in age 3 months compared to age 2 days in homo sapiens saliva infant sweden municipality of umea 2021-04-26v3No1 / 197
515amnoncommon river, poland, whole body, beetle, bembidion decorum, carnivorous beetle, raba river2019-04-18v4No1 / 198
6amnoncommon homo sapiens, urine, female, pregnancy, state of tennessee2016-10-13v4No1 / 201
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in feces homo sapiens china )2018-12-30v4No1 / 203
515amnon high in poland herbivorous beetle compared to bulgaria detritivorous beetle in whole body beetle 2019-04-19v4No1 / 205
555amnon high in saliva compared to dentition supragingival plaque in homo sapiens child shanghai proper age 7-14 years china 2019-09-10v3No1 / 205
725amnoncommon homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, chronic periodontitis, china, municipality of beijing2021-01-03v3No1 / 206
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
542amnoncommon research facility, dentition, adult, macaca mulatta, puerto rico, subgingival plaque, monkey, age 12-23 years2019-08-01v4No1 / 208
388amnon high in age 6-10 weeks compared to age 12-19 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v4No1 / 210
323amnoncommon in shark skin (common united states of america, skin, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 213
511amnoncommon kingdom of norway, sweden, finland, lapland, depth 0-5cm, snow2019-03-20v4No1 / 213
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v3No1 / 214
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
104amnoncommon homo sapiens, dentition, russia, moscow, subgingival plaque, mouth2017-04-05v4No1 / 227
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
331amnon high in dry season compared to wet season in feces ethiopia monkey theropithecus gelada 2018-05-13v4No1 / 232
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens female adult china shanghai district 2020-08-22v4No1 / 232
811amnoncommon glacier, glacial ice, ice, shetland islands, south shetland glacier2021-06-22v3No1 / 234
492amnoncommon skin, adult, rana catesbeiana, bullfrog, frog, lithobates catesbeianus, japan2019-02-27v4No1 / 236
404amnon high in bogota medellin metropolitan area compared to municipality of santiago de cali bucaramanga barranquilla in feces homo sapiens city adult colombia 2018-11-20v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, age 50-60 years, nephrolithiasis, china)2018-01-27v4No1 / 239
725amnoncommon homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 240
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 242
483amnoncommon united states of america, research facility, hawaii, pearl harbor, hydroides elegans, tubeworm, shelled egg2019-02-13v4No1 / 243
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 263
253amnoncommon in clouds in puy de dome mountain in france (common air, french republic, autumn, cloud)2017-11-22v4No1 / 267
558amnon high in summer compared to winter in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 274
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, age 50-60 years, china)2018-01-27v4No1 / 281
696amnon high in georissa georissa similis compared to alycaeus jagori in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 282
653amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens adult toronto canada age 20-30 years 2020-09-13v3No1 / 291
53amnon high in el salvador small village compared to lima shantytown in feces homo sapiens city 2017-01-21v4No1 / 296
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common leaf, maryland county)2016-12-09v4No1 / 298
237amnonlower in burrow soil compared to bird ( high in bird oceanodroma leucorhoa seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
78amnon high in male compared to female in feces tropical grassland biome kenya nanger granti gazelle 2017-03-01v4No1 / 301
615amnon high in soil compared to rhizosphere in brazil greenhouse campinas saccharum sugarcane 2020-04-27v4No1 / 306
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in homo sapiens adult toronto canada age 20-30 years 2020-09-13v3No1 / 306
615amnon high in leaf leaf surface compared to stem upper stem stem surface in brazil greenhouse exosphere campinas saccharum sugarcane 2020-04-27v4No1 / 321
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
190amnon high in wet season compared to dry season in feces homo sapiens tanzania hunter gatherer hadza 2017-09-04v4No1 / 341
209amnonhigher in whale blow condensate compared to ocean water ( high in respiratory airway megaptera novaeangliae humpback whale exhaled air condensate whale blow compared to ocean sea water depth 25cm in north america )2017-10-15v4No1 / 359
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in united states of america water drinking water tap water state of illinois )2018-05-28v4No1 / 365
308amnoncommon united states of america, research facility, foot, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 368
565amnoncommon zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 368
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
170amnonhigher in low turbidity river water ( high in turbidity low turbidity compared to high turbidity in united states of america river stream water fresh water depth 10 cm )2017-07-24v4No1 / 395
662amnoncommon soil, israel, depth 0-10cm, irrigated, agricultural field, clay soil, neve yaar2020-09-21v3No1 / 402
558amnon high in gizzard compared to crop in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 408
353amnoncommon in wild Lissotriton vulgaris newts skin (common skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 418
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
642amnon high in gill compared to gastrointestinal system alimentary part of gastrointestinal system in pacific ocean san diego fish scomber japonicus chub mackerel 2020-08-28v4No1 / 434
577amnon high in high salinity hypersaline water depth 4-9m monimolimnion compared to low salinity depth 0-3m mixolimnion in lake water lake water romania ursu lake 2020-01-09v3No1 / 439
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
75amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 442
438amnon high in adult age 30-50 age 60-79 compared to child age 3-6 age 8-12 in feces homo sapiens china 2018-12-30v4No1 / 486
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee leaf populus tree cultivated environment 2019-01-13v4No1 / 559
425amnon high in central african republic bangui compared to madagascar antananarivo in feces homo sapiens child africa 2018-12-08v4No1 / 564
696amnon high in georissa georissa similis compared to opisthostoma concinnum plectostoma concinnum in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 576
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in feces homo sapiens china )2018-12-30v4No1 / 617
425amnon high in duodenum compared to feces in homo sapiens child africa 2018-12-08v4No1 / 622
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
471amnon high in tadpole compared to adult in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2019-01-14v4No1 / 648
360amnoncommon desert, leaf, state of california, agave, agave deserti, leaf surface2018-08-21v4No1 / 649
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium officinale, flowerpot2021-06-20v4No1 / 715
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in homo sapiens skin )2018-09-06v4No1 / 854
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium moniliforme, flowerpot2021-06-20v4No1 / 1002
18amnoncommon feces, united states of america, equus caballus2016-11-09v4No1 / 1071
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic)2017-11-22v4No1 / 1081
515amnon high in carabidae compared to staphylinidae in river poland whole body beetle carnivorous beetle 2019-04-19v4No1 / 1130
266amnon high in leaf compared to root in united states of america state of idaho plant brassicaceae boechera stricta 2017-12-19v4No1 / 1175
252amnoncommon in river sand biofilm (common river, biofilm, sand, kingdom of spain)2017-11-22v4No1 / 1181
505amnon high in particle bound size 1-80um compared to free floating size < 1um in water surface water sea water state of california pacific ocean 2019-03-14v4No1 / 1218
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium huoshanense, flowerpot2021-06-20v4No1 / 1356
141amnoncommon sediment, brackish water, marine sediment, caspian sea, depth 200m, sample depth 12-35cm2017-04-18v4No1 / 1659
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 1834
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162

Problems / suggestions? Please email info AT dbbact DOT org