Search result for sequence:
TACGTAGGTGACAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGACTGTCAAGTCAGTCGTGAAATACCGGGGCTTAACCCCGGGGCTGCGATTGAAACTGACAGCCTTGAGTATCGGAGAGGAAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
feces0.638315
homo sapiens0.617973
adult0.491805
united states of america0.240366
control0.208278
china0.180556
child0.155378
rat0.106809
female0.106507
city0.091131
research facility0.090973
kingdom of spain0.084829
infant0.083067
obesity0.075122
germany0.069971
sprague dawley0.068807
heterosexual0.063103
msw0.063103
obsolete_juvenile stage0.060708
rattus0.056417
rattus norvegicus0.055172
male0.052023
taiwan0.049412
LOWER IN crohn's disease0.049123
czech republic0.042179
high bmi0.040886
south korea0.040886
zoological garden0.040472
italy0.039867
sweden0.038339
jiangsu province0.037975
state of california0.037267
republic of china0.035524
age 30-500.035524
guangzhou city prefecture0.035419
amsterdam0.035211
india0.035211
russia0.034803
kingdom of the netherlands0.034602
monkey0.034404
pregnancy0.034014
state of new york0.034014
state of colorado0.034014
age0.033898
israel0.033259
colon0.032362
caecum0.031471
LOWER IN homosexual0.028674
LOWER IN msm0.028674
overweight body mass index status0.028571
LOWER IN rural community0.028571
wistar rat0.028571
colombia0.028369
obese body mass index status0.028369
LOWER IN ulcerative colitis0.028369
LOWER IN infant0.028269
age 50-80 years0.028169
rural community0.028169
formula fed0.027972
LOWER IN wild0.027875
age 1 year0.027842
switzerland0.027586
hiv infection0.027211
dog0.025478
canis lupus familiaris0.024845
LOWER IN gay0.021583
age 2-4 years0.021544
state of oklahoma0.021544
zhengzhou city prefecture0.021429
LOWER IN age < 1 year0.021429
LOWER IN colitis0.021429
homosexual0.021429
msm0.021429
systemic lupus erythematosus0.021429
age 3-60.021429
denver0.021429
africa0.021429
age 60-790.021429
age 130.021429
age < 3 years0.021201
hispanic or latin american0.021201
poland0.021201
commonwealth of massachusetts0.021090
biopsy0.021090
finland0.021090
age 2 years0.020979
LOWER IN child0.020979
belgium0.020979
new zealand0.020979
lamb0.020979
commonwealth of virginia0.020761
age 6 weeks0.020761
juvenile organism0.020548
river0.020548
captive0.020033
sheep0.019737
ovis aries0.019355
medellin metropolitan area0.014440
LOWER IN age 2 months0.014440
age 19-240.014440
Fraction of dbbact annotations with this term covered by the query
TermScore
rattus0.833333
heterosexual0.800000
msw0.800000
LOWER IN homosexual0.800000
LOWER IN msm0.800000
taiwan0.750000
LOWER IN gay0.750000
medellin metropolitan area0.666667
LOWER IN age 2 months0.666667
overweight body mass index status0.666667
age 2-4 years0.666667
republic of china0.666667
age 30-500.666667
age 19-240.666667
state of oklahoma0.666667
LOWER IN rural community0.666667
age 5-13 years0.666667
central african republic0.666667
metabolic syndrome0.666667
wistar rat0.666667
LOWER IN crohn&#39;s disease0.636364
rat0.625000
sprague dawley0.600000
guangzhou city prefecture0.600000
obesity0.583333
czech republic0.571429
LOWER IN trichuriasis0.500000
colombia0.500000
daycare0.500000
age 1-5 years0.500000
before hsct0.500000
LOWER IN after hcst0.500000
LOWER IN hematopoietic stem cell transplant0.500000
LOWER IN schizophrenia0.500000
chengdu city prefecture0.500000
gestational age 8-12 weeks0.500000
rattus norvegicus0.500000
LOWER IN autoimmune hepatitis0.500000
zhengzhou city prefecture0.500000
LOWER IN parkinson&#39;s disease0.500000
LOWER IN chronic fatigue syndrome0.500000
new york county0.500000
age > 1 year0.500000
LOWER IN age &lt; 1 year0.500000
obese body mass index status0.500000
age 50-70 years0.500000
plant diet0.500000
age 7 months0.500000
LOWER IN diarrhea0.500000
autoimmune hepatitis0.500000
LOWER IN colitis0.500000
LOWER IN tnbs0.500000
breast fed0.500000
taoyuan city0.500000
graves' disease0.500000
gay0.500000
homosexual0.500000
msm0.500000
systemic lupus erythematosus0.500000
midwest region0.500000
vegetarian diet0.500000
schizophrenia0.500000
athlete0.500000
cheyenne0.500000
native american0.500000
arapaho0.500000
coronary heart disease0.500000
jordan0.500000
omnivore diet0.500000
indonesia0.500000
municipality of yogyakarta0.500000
yaounde0.500000
LOWER IN ngoantet0.500000
type 2 diabetes mellitus0.500000
caribbean latino0.500000
LOWER IN insomnia0.500000
human immunodeficiency virus infectious disease0.500000
municipality of logrono0.500000
antiretroviral therapy0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
age 17-290.500000
taipei city0.500000
municipality of reus0.500000
age 4-10 years0.500000
sesame allergy0.500000
denver0.500000
quito0.500000
weight loss0.500000
weight loss diet0.500000
high protein diet0.500000
gaz:000521000.500000
LOWER IN enzyme supplementation0.500000
LOWER IN exocrine pancreatic insufficiency0.500000
amsterdam0.500000
africa0.500000
age 2-5 years0.500000
novosibirsk0.500000
age 200.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.934307
homo sapiens0.824818
adult0.496350
united states of america0.299270
control0.189781
china0.189781
child0.094891
research facility0.083942
female0.069343
rat0.058394
city0.051095
infant0.047445
kingdom of spain0.047445
germany0.043796
obesity0.040146
sprague dawley0.036496
male0.032847
heterosexual0.032847
msw0.032847
obsolete_juvenile stage0.032847
rattus norvegicus0.029197
rattus0.029197
taiwan0.025547
LOWER IN crohn&#39;s disease0.025547
italy0.021898
state of california0.021898
sweden0.021898
high bmi0.021898
south korea0.021898
czech republic0.021898
jiangsu province0.021898
zoological garden0.021898
pregnancy0.018248
caecum0.018248
age0.018248
russia0.018248
israel0.018248
guangzhou city prefecture0.018248
republic of china0.018248
state of new york0.018248
age 30-500.018248
state of colorado0.018248
kingdom of the netherlands0.018248
amsterdam0.018248
india0.018248
colon0.018248
monkey0.018248
colombia0.014599
switzerland0.014599
age 50-80 years0.014599
age 1 year0.014599
obese body mass index status0.014599
overweight body mass index status0.014599
formula fed0.014599
hiv infection0.014599
LOWER IN rural community0.014599
canis lupus familiaris0.014599
dog0.014599
LOWER IN homosexual0.014599
LOWER IN msm0.014599
LOWER IN ulcerative colitis0.014599
wistar rat0.014599
rural community0.014599
LOWER IN infant0.014599
LOWER IN wild0.014599
zhengzhou city prefecture0.010949
LOWER IN age &lt; 1 year0.010949
commonwealth of virginia0.010949
age 2-4 years0.010949
age < 3 years0.010949
age 2 years0.010949
LOWER IN colitis0.010949
homosexual0.010949
msm0.010949
systemic lupus erythematosus0.010949
state of oklahoma0.010949
hispanic or latin american0.010949
commonwealth of massachusetts0.010949
age 3-60.010949
denver0.010949
africa0.010949
biopsy0.010949
poland0.010949
LOWER IN gay0.010949
LOWER IN child0.010949
belgium0.010949
age 60-790.010949
ovis aries0.010949
new zealand0.010949
sheep0.010949
lamb0.010949
age 6 weeks0.010949
juvenile organism0.010949
finland0.010949
age 130.010949
river0.010949
captive0.010949
medellin metropolitan area0.007299
chengdu city prefecture0.007299
gestational age 8-12 weeks0.007299
Exp. ID User ID Description Date Region Flag Sequences
482amnonlower in kids with parasitic worms compared to non-infected kids ( high in control compared to trichuriasis in feces homo sapiens child colombia medellin metropolitan area daycare age 1-5 years )2019-02-12v4No1 / 3
655amnon high in before hsct compared to after hcst hematopoietic stem cell transplant in feces homo sapiens italy 2020-09-13v3No1 / 4
502amnon high in control compared to schizophrenia in feces homo sapiens united states of america adult 2019-03-12v4No1 / 14
637amnondominant feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 19
434amnondominant feces, research facility, caecum, rattus norvegicus, sprague dawley, switzerland, rat2018-12-20v4No1 / 20
720amnon high in control compared to autoimmune hepatitis in feces homo sapiens adult china zhengzhou city prefecture 2028-05-23v3No1 / 22
303amnondominant feces, homo sapiens, adult, germany2018-03-12v4No1 / 23
591amnon high in control compared to parkinson's disease in feces homo sapiens united states of america adult age 50-80 years 2020-02-17v4No1 / 30
12amnon high in control compared to chronic fatigue syndrome in feces homo sapiens new york county 2016-11-02v4No1 / 35
284amnon high in age 1 year compared to age 2 months in feces homo sapiens female infant state of california 2018-01-27v4No1 / 35
669amnoncommon feces, homo sapiens, infant, sweden, age 1 year2020-09-26v4No1 / 35
233amnon high in age age > 1 year compared to age < 1 year in feces homo sapiens united states of america infant 2017-11-05v4No1 / 37
814amnonlower after 2 months of caloric restriction diet ( high in control diet compared to caloric restriction diet in feces homo sapiens female obesity adult obese body mass index status germany high bmi overweight body mass index status age 50-70 years )2021-06-30v4No1 / 37
681amnoncommon feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 37
74amnonHigher in plant diet compared to animal product diet ( high in diet plant diet compared to animal product diet in feces homo sapiens united states of america )2017-02-27v4No1 / 39
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v4No1 / 39
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, age 2-4 years2019-11-18v3No1 / 42
36amnoncommon feces, homo sapiens, sichuan province2016-12-06v4No1 / 44
241amnoncommon in babies age < 3 years in russia (common feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 44
797amnon high in age 7 months compared to age 3 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 44
597amnoncommon feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 46
797amnoncommon feces, homo sapiens, child, germany, formula fed, age 2 years2021-06-13v3No1 / 46
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
779amnoncommon feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 47
597amnoncommon feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 47
720amnoncommon feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 48
221amnonhigher in control compared to tnbs induced colitis in rat feces ( high in control compared to colitis in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 49
442amnonlower in tnbs induced colitis compared to controls ( high in control compared to tnbs colitis in feces research facility rattus norvegicus sprague dawley male rat china )2019-01-06v4No1 / 49
564amnoncommon feces, homo sapiens, control, child, italy, age 2-4 years2019-11-18v3No1 / 50
797amnoncommon feces, homo sapiens, child, germany, breast fed, age 2 years2021-06-13v3No1 / 50
796amnoncommon feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 51
650amnoncommon feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 52
651amnon high in control compared to parkinson's disease in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 52
694amnoncommon feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 52
796amnoncommon feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 52
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
131amnon high in female compared to male in feces homo sapiens south korea 2017-04-16v4No1 / 55
814amnoncommon feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 55
578amnon high in sweden compared to kingdom of spain in feces homo sapiens hiv infection adult gay homosexual msm male 2020-01-14v3No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, systemic lupus erythematosus, china2028-04-11v3No1 / 55
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
368amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
591amnoncommon feces, homo sapiens, control, united states of america, adult, age 50-80 years2020-02-17v4No1 / 56
650amnoncommon feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 56
720amnoncommon feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 56
651amnoncommon feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 58
666amnoncommon feces, homo sapiens, italy2020-09-25v3No1 / 58
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 60
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
637amnoncommon feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 61
593amnoncommon feces, homo sapiens, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
502amnoncommon feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 63
575amnoncommon in professional martial arts athletes (common feces, homo sapiens, adult, high physical activity, age 19-24, china, athlete)2020-01-05v3No1 / 63
242amnoncommon in native-americans (common feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 65
650amnoncommon feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 66
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
365amnoncommon feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 67
574amnoncommon feces, homo sapiens, adult, russia2020-01-05v3No1 / 68
593amnoncommon feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 68
644amnon high in female compared to male in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v4No1 / 69
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
22amnon high in control compared to hiv infection in feces homo sapiens united states of america 2016-11-28v4No1 / 70
594amnon high in city yaounde compared to rural community ngoantet in feces homo sapiens adult cameroon 2020-03-12v4No1 / 70
803amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, age 50-80 years, type 2 diabetes mellitus, caribbean latino2021-06-18v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
566amnon high in control compared to insomnia in feces homo sapiens adult china 2019-11-24v4No1 / 71
644amnoncommon feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 71
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, switzerland2020-09-22v4No1 / 71
395amnoncommon feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 75
794amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, human immunodeficiency virus infectious disease, municipality of logrono, antiretroviral therapy2021-06-08v4No1 / 75
74amnoncommon feces, homo sapiens, united states of america2017-02-27v4No1 / 76
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in feces homo sapiens china )2018-12-30v4No1 / 76
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, age 17-292019-02-13v4No1 / 76
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 77
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 77
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
401amnoncommon feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 79
529amnoncommon feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 79
732amnoncommon feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 79
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 80
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
643amnoncommon feces, homo sapiens, adult, south korea2020-08-30v4No1 / 81
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 82
562amnoncommon feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 82
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, china2028-04-11v3No1 / 82
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 83
721amnon high in weight loss weight loss diet high protein diet compared to high fiber fiber diet in feces homo sapiens obesity adult scotland overweight body mass index status gaz:00052100 2028-05-23v4No1 / 83
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to enzyme supplementation exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 85
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
601amnoncommon feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 85
629amnon high in heterosexual msw compared to homosexual msm in feces homo sapiens adult male kingdom of the netherlands amsterdam 2020-05-31v4No1 / 85
663amnoncommon feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 85
804amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens child africa central african republic madagascar age 2-5 years 2021-06-18v4No1 / 85
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
249amnoncommon feces, homo sapiens, united states of america2017-11-22v4No1 / 86
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 86
344amnoncommon in feces of homosexual males (common feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 87
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, age 202018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
487amnoncommon feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 88
293amnoncommon feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 89
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 89
803amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, age 50-80 years, caribbean latino2021-06-18v4No1 / 89
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
238amnoncommon feces, homo sapiens, colombia2017-11-07v4No1 / 96
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 97
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 97
730amnoncommon feces, homo sapiens, control, child, kingdom of the netherlands, amsterdam2021-01-05v1No1 / 97
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
438amnoncommon feces, homo sapiens, age 19-24, china2018-12-30v4No1 / 101
477amnoncommon feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 103
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 106
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china2018-12-30v4No1 / 106
797amnon high in age 1 year compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
409amnoncommon feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 108
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in feces homo sapiens united states of america child )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 60-79, china2018-12-30v4No1 / 111
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 30-50, china2018-12-30v4No1 / 115
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
358amnonlower in helminth infected rats compared to controls ( high in control compared to hymenolepis diminuta in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china2018-12-30v4No1 / 121
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to child obsolete_juvenile stage crohn's disease in feces homo sapiens glasgow )2017-02-26v4No1 / 125
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 125
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 126
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to rectum biopsy site biopsy in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 126
753amnon high in farm canis lupus familiaris dog dog breeding center compared to zoological garden captive canis lupus wolf in feces adult china 2021-03-12v4No1 / 127
779amnon high in control compared to crohn's disease in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 127
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
649amnoncommon research facility, ovis aries, new zealand, sheep, lamb, age 6 weeks, colon2020-09-07v3No1 / 128
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, age 30-402018-05-13v4No1 / 130
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
660amnonlower in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in upano valley compared to cross-cutucu in feces homo sapiens ecuador rural community village shuar population )2020-09-20v4No1 / 132
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 132017-09-12v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 136
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens juvenile organism obsolete_juvenile stage age 13 2017-09-12v4No1 / 138
797amnon high in child age 2 years compared to infant age 1 year in feces homo sapiens germany formula fed 2021-06-13v3No1 / 139
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 140
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 141
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 145
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 146
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
594amnoncommon feces, homo sapiens, city, adult, cameroon, yaounde2020-03-12v4No1 / 154
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, bile, gallbladder, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens adult china 2018-02-05v4No1 / 161
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 162
700amnoncommon feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 164
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, age 13, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in feces homo sapiens infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces homo sapiens united states of america 2018-11-16v4No1 / 180
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
399amnoncommon feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v4No1 / 184
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in feces homo sapiens china )2018-12-30v4No1 / 203
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
669amnon high in age 1 year compared to age 2 months in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
17amnoncommon feces, stomach, ochotona, tibetan plateau2016-11-09v4No1 / 214
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
759amnon high in research facility commonwealth of massachusetts city of boston compared to state of new york new york city wild in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 217
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 220
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
10amnonpositively correlated with age (6-35) ( high in adult compared to child in feces homo sapiens toronto )2016-10-27v4No1 / 228
349amnoncommon feces, research facility, sprague dawley, rattus, male, rat, china2018-07-29v4No1 / 235
404amnon high in bogota medellin metropolitan area compared to municipality of santiago de cali bucaramanga barranquilla in feces homo sapiens city adult colombia 2018-11-20v4No1 / 237
434amnoncommon feces, research facility, caecum, rattus norvegicus, sprague dawley, switzerland, rat2018-12-20v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, age 50-60 years, nephrolithiasis, china)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in feces homo sapiens belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in feces homo sapiens infant india )2016-12-19v4No1 / 253
419amnoncommon feces, research facility, rattus norvegicus, sprague dawley, rat, china2018-12-02v4No1 / 254
625amnoncommon feces, united states of america, zoological garden, state of minnesota, ateles geoffroyi, como zoo, black-handed spider monkey2020-05-16v4No1 / 256
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
368amnonhigher in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in latetimepoints age 23-33 weeks systemic lupus erythematosus compared to control early timepoints 10-18 weeks in feces united states of america research facility mus musculus mouse nzb/w f1 )2018-09-03v4No1 / 265
438amnon high in child age 3-6 age 8-12 compared to adult age 30-50 age 60-79 in feces homo sapiens china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, age 50-60 years, china)2018-01-27v4No1 / 281
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
411amnoncommon feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 292
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
419amnoncommon in rats with induced constipation (common feces, research facility, rattus norvegicus, sprague dawley, rat, constipation, china)2018-12-02v4No1 / 300
78amnon high in male compared to female in feces tropical grassland biome kenya nanger granti gazelle 2017-03-01v4No1 / 301
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
723amnon high in age 2-4 years compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 306
358amnoncommon feces, research facility, rattus, czech republic, rat, wistar rat2018-08-19v4No1 / 309
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in feces homo sapiens adult czech republic 2019-07-21v1No1 / 334
190amnon high in wet season compared to dry season in feces homo sapiens tanzania hunter gatherer hadza 2017-09-04v4No1 / 341
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
187amnoncommon feces, research facility, rattus, czech republic, rat, wistar rat2017-08-23v4No1 / 351
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in feces papio zambia monkey baboon 2018-11-23v4No1 / 364
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
442amnoncommon feces, research facility, rattus norvegicus, sprague dawley, male, rat, china2019-01-06v4No1 / 378
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
186amnoncommon united states of america, research facility, caecum, sprague dawley, rattus, rat2017-08-23v4No1 / 407
625amnoncommon feces, united states of america, zoological garden, state of minnesota, pongo abelii, sumatran orangutan, como zoo2020-05-16v4No1 / 414
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
666amnoncommon feces, italy, lama guanicoe2020-09-25v3No1 / 437
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
75amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 442
339amnon high in adult compared to infant age < 1 year in feces homo sapiens india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
221amnoncommon feces, research facility, sprague dawley, rattus, rat, china2017-10-25v4No1 / 470
620amnon high in chimpanzee pan troglodytes troglodytes compared to gorilla gorilla in feces wild republic of congo nouabale-ndoki national park 2020-05-06v4No1 / 478
671amnon high in state of oregon compared to state of california in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 534
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in feces homo sapiens child africa 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in feces homo sapiens china )2018-12-30v4No1 / 617
279amnon high in caecum colon compared to stomach small intestine in ochotonidae pikas china 2018-01-24v4No1 / 634
729amnon high in zoological garden captive europe compared to wild cameroon in feces gorilla gorilla monkey 2021-01-05v3No1 / 656
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned corn and soybean diet age 4-7 weeks compared to suckling preweaned age 2-4 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 681
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
358amnonlower in dnbs induced colitis compared to controls in rat feces ( high in control compared to dnbs induced colitis colitis in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 754
649amnon high in colon compared to ileum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 897
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common soil, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil fumigation, dazomet)2021-04-14v4No1 / 946
671amnon high in age 8 months compared to age 3 months age 6 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 955
620amnon high in united states of america zoological garden compared to wild republic of congo nouabale-ndoki national park in feces gorilla gorilla gorilla 2020-05-06v4No1 / 1019
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic)2017-11-22v4No1 / 1081
252amnoncommon in river sand biofilm (common river, biofilm, sand, kingdom of spain)2017-11-22v4No1 / 1181
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261

Problems / suggestions? Please email info AT dbbact DOT org