Search result for sequence:
TACGTAGGTGGCAAGCGTTATCCGGAATCATTGGGCGTAAAGGGTGCGTAGGTGGCACGATAAGTCTGAAGTAAAAGGCAACAGCTCAACTGTTGTATGCTTTGGAAACTGTCGAGCTAGAGTGCAGAAGAGGGCGATGGAATTCCATGT
common ontology terms
term enrichment score
TermScore
rat0.226629
rattus norvegicus0.200000
homo sapiens0.193064
feces0.182030
infant0.148148
finland0.147239
LOWER IN rural community0.117647
age < 3 years0.111111
obsolete_juvenile stage0.109091
united states of america0.107640
taconic farms0.105263
LOWER IN jackson laboratories0.105263
age 8 weeks0.105263
sprague dawley0.100000
child0.100000
city0.093750
adult0.088670
LOWER IN adult0.088235
israel0.086957
LOWER IN estonia0.081633
age 3-60.081633
terminal ileum0.081633
LOWER IN gay0.081633
LOWER IN age 30-500.081633
LOWER IN age 60-790.081633
age >940.081633
heterosexual0.080000
msw0.080000
LOWER IN homosexual0.080000
LOWER IN msm0.080000
wistar rat0.078431
state of colorado0.075472
caecum0.075000
research facility0.072488
rattus0.070175
czech republic0.067797
c57bl/60.062500
colon0.060606
age0.060606
LOWER IN control0.056338
canada0.055556
control diet0.054795
acquired immunodeficiency syndrome0.042553
chronic fatigue syndrome0.042553
new york county0.042553
centererians0.042553
stroke0.042553
high capacity running strain0.042553
LOWER IN low capacity running strain0.042553
age 38 weeks0.042553
little physical activity0.042553
LOWER IN physical activity0.042553
sesame allergy0.042553
LOWER IN milk allergy0.042553
age 4-10 years0.042553
LOWER IN age 8-120.042553
LOWER IN age 13-140.042553
usa born0.042553
LOWER IN non usa born0.042553
denver0.042553
LOWER IN india0.042553
age 130.042553
LOWER IN russia0.042553
LOWER IN plant diet0.042553
dnbs induced colitis0.042553
age<17 years0.042553
LOWER IN peru0.042553
LOWER IN tunapuco0.042553
glasgow0.042553
age 8-120.042553
nanning city prefecture0.042553
age 50-60 years0.042553
LOWER IN nepal0.042553
LOWER IN himalayas0.042553
LOWER IN venezuela0.042553
LOWER IN amerindian0.042553
LOWER IN hunter gatherer0.042553
children0.042553
new delhi0.042553
age one year0.042553
LOWER IN age one month0.042553
age 60-790.042553
LOWER IN age 19-240.042553
LOWER IN soldiers0.042553
LOWER IN ulcer0.042553
LOWER IN wound0.042553
ovariectomy0.041667
food allergy0.041667
hispanic or latin american0.041667
animal product diet0.041667
atlanta0.041667
state of oklahoma0.041667
LOWER IN age 2 months0.041667
LOWER IN neomycin0.041667
LOWER IN thailand0.041667
sigmoid colon0.041667
european0.041667
LOWER IN asian0.041667
LOWER IN age &lt;1 year0.041667
age 30-500.041667
Fraction of dbbact annotations with this term covered by the query
TermScore
acquired immunodeficiency syndrome0.500000
chronic fatigue syndrome0.500000
new york county0.500000
centererians0.500000
stroke0.500000
LOWER IN estonia0.500000
high capacity running strain0.500000
LOWER IN low capacity running strain0.500000
age 38 weeks0.500000
little physical activity0.500000
LOWER IN physical activity0.500000
sesame allergy0.500000
LOWER IN milk allergy0.500000
age 4-10 years0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
usa born0.500000
LOWER IN non usa born0.500000
terminal ileum0.500000
LOWER IN gay0.500000
denver0.500000
LOWER IN india0.500000
age 130.500000
LOWER IN russia0.500000
LOWER IN plant diet0.500000
dnbs induced colitis0.500000
age<17 years0.500000
LOWER IN peru0.500000
LOWER IN tunapuco0.500000
LOWER IN rural community0.500000
glasgow0.500000
age 8-120.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
nanning city prefecture0.500000
age 50-60 years0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN venezuela0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
children0.500000
age >940.500000
new delhi0.500000
age one year0.500000
LOWER IN age one month0.500000
age 60-790.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
LOWER IN ulcer0.500000
LOWER IN wound0.500000
finland0.428571
rattus norvegicus0.400000
heterosexual0.400000
msw0.400000
LOWER IN homosexual0.400000
LOWER IN msm0.400000
age < 3 years0.333333
ovariectomy0.333333
food allergy0.333333
hispanic or latin american0.333333
animal product diet0.333333
wistar rat0.333333
atlanta0.333333
state of oklahoma0.333333
LOWER IN age 2 months0.333333
LOWER IN neomycin0.333333
LOWER IN thailand0.333333
sigmoid colon0.333333
european0.333333
LOWER IN asian0.333333
LOWER IN age &lt;1 year0.333333
age 30-500.333333
foot0.333333
diabetes mellitus0.333333
rat0.312500
obsolete_juvenile stage0.300000
amsterdam0.250000
LOWER IN fructose diet0.250000
LOWER IN fructose0.250000
neomycin0.250000
taconic farms0.250000
LOWER IN jackson laboratories0.250000
age 8 weeks0.250000
state of colorado0.250000
LOWER IN small village0.250000
LOWER IN vancomycin0.250000
caucasian0.250000
age > 1 year0.250000
guangzhou city prefecture0.200000
sprague dawley0.200000
ampicillin0.200000
right colon0.200000
colitis0.200000
kingdom of the netherlands0.166667
infant0.166667
juvenile organism0.166667
rattus0.166667
small intestine0.166667
Fraction of annotations for the query sequences containing the term
TermScore
feces0.866667
homo sapiens0.755556
united states of america0.377778
research facility0.244444
adult0.200000
rat0.177778
LOWER IN control0.133333
rattus norvegicus0.133333
china0.133333
infant0.133333
finland0.088889
child0.088889
control0.088889
LOWER IN adult0.066667
age < 3 years0.066667
caecum0.066667
sprague dawley0.066667
israel0.066667
taconic farms0.066667
LOWER IN jackson laboratories0.066667
mus musculus0.066667
c57bl/60.066667
canada0.066667
mouse0.066667
age 8 weeks0.066667
city0.066667
obsolete_juvenile stage0.066667
LOWER IN rural community0.066667
LOWER IN estonia0.044444
female0.044444
control diet0.044444
male0.044444
age 3-60.044444
terminal ileum0.044444
heterosexual0.044444
msw0.044444
LOWER IN gay0.044444
LOWER IN homosexual0.044444
LOWER IN msm0.044444
state of colorado0.044444
colon0.044444
rattus0.044444
czech republic0.044444
wistar rat0.044444
LOWER IN age 30-500.044444
LOWER IN age 60-790.044444
age >940.044444
age0.044444
hiv infection0.022222
acquired immunodeficiency syndrome0.022222
kingdom of the netherlands0.022222
amsterdam0.022222
chronic fatigue syndrome0.022222
new york county0.022222
centererians0.022222
sichuan province0.022222
stroke0.022222
guangzhou city prefecture0.022222
high capacity running strain0.022222
LOWER IN low capacity running strain0.022222
ovariectomy0.022222
age 38 weeks0.022222
little physical activity0.022222
LOWER IN physical activity0.022222
LOWER IN fructose diet0.022222
LOWER IN fructose0.022222
sesame allergy0.022222
LOWER IN milk allergy0.022222
food allergy0.022222
age 4-10 years0.022222
LOWER IN age 8-120.022222
LOWER IN age 13-140.022222
usa born0.022222
LOWER IN non usa born0.022222
hispanic or latin american0.022222
antibiotic0.022222
ampicillin0.022222
neomycin0.022222
switzerland0.022222
ileum0.022222
denver0.022222
right colon0.022222
LOWER IN india0.022222
juvenile organism0.022222
age 130.022222
russia0.022222
LOWER IN russia0.022222
diet0.022222
animal product diet0.022222
LOWER IN plant diet0.022222
dnbs induced colitis0.022222
colitis0.022222
atlanta0.022222
age<17 years0.022222
state of oklahoma0.022222
LOWER IN peru0.022222
LOWER IN small village0.022222
LOWER IN tunapuco0.022222
crohn's disease0.022222
glasgow0.022222
Exp. ID User ID Description Date Region Flag Sequences
629amnon high in hiv infection acquired immunodeficiency syndrome compared to control in feces homo sapiens adult kingdom of the netherlands amsterdam 2020-05-31v4No1 / 10
12amnon high in chronic fatigue syndrome compared to control in feces homo sapiens new york county 2016-11-02v4No1 / 18
399amnondominant feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v4No1 / 27
36amnonhigher in centernarians ( high in centererians compared to adult in feces homo sapiens sichuan province )2016-12-06v4No1 / 30
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in feces homo sapiens adult guangzhou city prefecture china )2018-05-15v4No1 / 30
241amnonhigher in babies from finland compared to estonia ( high in finland compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 45
300amnon high in high capacity running strain compared to low capacity running strain in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks 2018-02-27v4No1 / 45
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 59
586amnon high in control diet compared to fructose diet fructose in feces research facility rattus norvegicus sprague dawley israel rat male 2020-02-09v4No1 / 61
695amnon high in sesame allergy compared to milk allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 64
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in feces homo sapiens china )2018-12-30v4No1 / 76
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 77
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic ampicillin neomycin compared to control in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 80
538amnon high in taconic farms compared to jackson laboratories in research facility ileum mus musculus c57bl/6 terminal ileum canada mouse age 8 weeks 2019-07-29v4No1 / 104
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 106
393amnon high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 107
538amnon high in taconic farms compared to jackson laboratories in research facility colon right colon mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 108
538amnon high in taconic farms compared to jackson laboratories in feces research facility mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 135
197amnon high in finland compared to india in feces homo sapiens juvenile organism obsolete_juvenile stage age 13 2017-09-12v4No1 / 138
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 146
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 148
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in feces homo sapiens united states of america )2017-02-27v4No1 / 149
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 154
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
399amnoncommon feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v4No1 / 184
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
669amnon high in age 1 year compared to age 2 months in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
586amnoncommon feces, research facility, rattus norvegicus, sprague dawley, israel, rat, control diet, male2020-02-09v4No1 / 241
438amnon high in child age 3-6 age 8-12 compared to adult age 30-50 age 60-79 in feces homo sapiens china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, age 50-60 years, china)2018-01-27v4No1 / 281
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
358amnoncommon feces, research facility, rattus, czech republic, rat, wistar rat2018-08-19v4No1 / 309
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v4No1 / 384
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in feces homo sapiens china )2018-12-30v4No1 / 474
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in feces homo sapiens china )2018-12-30v4No1 / 617
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836

Problems / suggestions? Please email info AT dbbact DOT org