Search result for sequence:
TACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGGGAGCAGGCGGCAGCAAGGGTCTGTGGTGAAAGCCTGAAGCTTAACTTCAGTAAGCCATAGAAACCAGGCAGCTAGAGTGCAGGAGAGGATCGTGGAATTCCATGT
common ontology terms
term enrichment score
TermScore
feces0.403994
homo sapiens0.392631
infant0.320725
adult0.219471
child0.166592
united states of america0.158859
age 1 year0.151351
china0.111948
germany0.108808
LOWER IN control0.106918
female0.106870
dog0.100000
canis lupus familiaris0.096774
formula fed0.091954
sweden0.086643
crohn's disease0.085366
state of california0.081081
clostridium difficile intestinal infectious disease0.075472
italy0.072917
LOWER IN adult0.069364
research facility0.068579
age < 3 years0.063492
guangzhou city prefecture0.063158
systemic lupus erythematosus0.062500
LOWER IN male0.058480
age 30-500.051282
age 2-4 years0.051282
oncorhynchus mykiss0.050633
rainbow trout0.050633
control0.050157
ulcerative colitis0.049383
hospital0.048980
monkey0.048980
kingdom of spain0.047059
city0.045627
age0.044944
fish0.044944
clostridium difficile infection0.038961
sigmoid colon0.038835
digestive system0.038835
breast fed0.038462
oslo0.038462
age 7 months0.038462
terminal ileum0.038462
indonesia0.038462
municipality of yogyakarta0.038462
defatted larvae insect diet0.038462
nanning city prefecture0.038462
age 50-60 years0.038462
age 3-60.038462
africa0.038462
LOWER IN rural community0.038462
india0.037975
age 2 months0.037736
state of minnesota0.037383
finland0.037383
biopsy0.037383
diarrhea0.037037
obsolete_juvenile stage0.036364
LOWER IN duodenum0.036364
french republic0.036036
kingdom of denmark0.035088
kingdom of norway0.034483
caecum0.032432
farm0.032432
LOWER IN age 2 months0.026144
central african republic0.026144
LOWER IN canis lupus0.026144
LOWER IN wolf0.026144
LOWER IN age 7 months0.025974
age<17 years0.025974
before hsct0.025974
puppy0.025974
age one year0.025974
nephrolithiasis0.025974
rhesus macaque0.025974
LOWER IN gay0.025974
LOWER IN age 30-500.025974
LOWER IN age 60-790.025974
age >940.025974
heterosexual0.025806
msw0.025806
LOWER IN homosexual0.025806
LOWER IN msm0.025806
atlanta0.025641
LOWER IN age 3 months0.025641
LOWER IN breast fed0.025641
dry season0.025641
LOWER IN wet season0.025641
state of oklahoma0.025641
czech republic0.025478
age < 1 year0.025478
age 8 weeks0.025316
switzerland0.025316
new zealand0.025316
lamb0.025316
commonwealth of virginia0.025000
rectal swab0.025000
rectum0.025000
age 1 month0.025000
Fraction of dbbact annotations with this term covered by the query
TermScore
clostridium difficile infection0.750000
clostridium difficile intestinal infectious disease0.666667
age 30-500.666667
age < 3 years0.666667
sigmoid colon0.666667
age 2-4 years0.666667
LOWER IN age 2 months0.666667
central african republic0.666667
LOWER IN canis lupus0.666667
LOWER IN wolf0.666667
guangzhou city prefecture0.600000
common variable immunodeficiency0.500000
irritable bowel syndrome0.500000
systemic lupus erythematosus0.500000
LOWER IN age 7 months0.500000
breast fed0.500000
valladolid0.500000
chronic fatigue syndrome0.500000
new york county0.500000
LOWER IN age 30-400.500000
oslo0.500000
tucson0.500000
crohn's disease0.500000
age<17 years0.500000
before hsct0.500000
after hcst0.500000
hematopoietic stem cell transplant0.500000
pemba island0.500000
age 7 months0.500000
juvenile0.500000
inflammatory bowel disease0.500000
terminal ileum0.500000
indonesia0.500000
municipality of yogyakarta0.500000
age 0-6 months0.500000
puppy0.500000
LOWER IN age 2-7 years0.500000
endospore enriched fraction0.500000
lysis0.500000
LOWER IN mammalian milk beverage0.500000
children0.500000
age one year0.500000
defatted larvae insect diet0.500000
LOWER IN larvae insect diet0.500000
oncorhynchus mykiss0.500000
rainbow trout0.500000
acute pancreatitis0.500000
pancreatitis0.500000
LOWER IN pre pupae insect diet0.500000
przewalski horse0.500000
stroke0.500000
nephrolithiasis0.500000
nanning city prefecture0.500000
age 50-60 years0.500000
lymphoma0.500000
LOWER IN fishmeal diet0.500000
little physical activity0.500000
LOWER IN physical activity0.500000
rhesus macaque0.500000
sesame allergy0.500000
LOWER IN milk allergy0.500000
age 4-10 years0.500000
LOWER IN vaccination0.500000
LOWER IN salmune vaccination0.500000
equine grass sickness0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
trachemys scripta elegans0.500000
red-eared slider turtle0.500000
turtle farm0.500000
africa0.500000
age 2-5 years0.500000
LOWER IN gay0.500000
denver0.500000
age one month0.500000
LOWER IN age one week0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
LOWER IN exocrine pancreatic insufficiency0.500000
dog breeding center0.500000
upano valley0.500000
LOWER IN cross-cutucu0.500000
shuar population0.500000
LOWER IN cyprinus carpio0.500000
LOWER IN common carp0.500000
england0.500000
LOWER IN wildlife sactuary0.500000
dnbs induced colitis0.500000
LOWER IN peru0.500000
LOWER IN tunapuco0.500000
LOWER IN rural community0.500000
glasgow0.500000
spondyloarthritis0.500000
spondylitis0.500000
atherosclerosis0.500000
LOWER IN state of oregon0.500000
strain 129s0.500000
theropithecus gelada0.500000
bogota0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.893333
homo sapiens0.793333
adult0.260000
united states of america0.246667
infant0.246667
china0.160000
LOWER IN control0.113333
child0.113333
female0.100000
age 1 year0.093333
germany0.093333
research facility0.086667
canis lupus familiaris0.060000
dog0.060000
state of california0.060000
sweden0.053333
formula fed0.053333
control0.053333
crohn's disease0.046667
italy0.046667
clostridium difficile intestinal infectious disease0.040000
LOWER IN adult0.040000
systemic lupus erythematosus0.033333
guangzhou city prefecture0.033333
age < 3 years0.033333
LOWER IN male0.033333
kingdom of spain0.026667
age0.026667
age 30-500.026667
hospital0.026667
ulcerative colitis0.026667
age 2-4 years0.026667
monkey0.026667
digestive system0.026667
oncorhynchus mykiss0.026667
fish0.026667
rainbow trout0.026667
city0.026667
clostridium difficile infection0.020000
age 2 months0.020000
state of minnesota0.020000
breast fed0.020000
diarrhea0.020000
kingdom of norway0.020000
oslo0.020000
obsolete_juvenile stage0.020000
finland0.020000
age 7 months0.020000
sigmoid colon0.020000
terminal ileum0.020000
biopsy0.020000
indonesia0.020000
municipality of yogyakarta0.020000
french republic0.020000
india0.020000
caecum0.020000
kingdom of denmark0.020000
defatted larvae insect diet0.020000
nanning city prefecture0.020000
age 50-60 years0.020000
farm0.020000
age 3-60.020000
LOWER IN duodenum0.020000
africa0.020000
LOWER IN rural community0.020000
czech republic0.013333
age < 1 year0.013333
LOWER IN age 7 months0.013333
commonwealth of virginia0.013333
atlanta0.013333
age<17 years0.013333
before hsct0.013333
russia0.013333
australia0.013333
age 8 weeks0.013333
puppy0.013333
rectal swab0.013333
LOWER IN age 3 months0.013333
LOWER IN breast fed0.013333
LOWER IN age 2 months0.013333
dry season0.013333
LOWER IN wet season0.013333
wild0.013333
age 3 months0.013333
rectum0.013333
colon0.013333
age one year0.013333
nephrolithiasis0.013333
age 1 month0.013333
macaca mulatta0.013333
captive0.013333
rhesus macaque0.013333
switzerland0.013333
rat0.013333
intestine0.013333
LOWER IN jejunum0.013333
ovis aries0.013333
new zealand0.013333
sheep0.013333
lamb0.013333
Exp. ID User ID Description Date Region Flag Sequences
702amnon high in clostridium difficile infection compared to control in feces united states of america canis lupus familiaris state of north carolina dog 2028-04-02v4No1 / 6
552amnon high in common variable immunodeficiency compared to control in feces homo sapiens czech republic 2019-09-05v3No1 / 8
294amnon high in irritable bowel syndrome compared to control in feces homo sapiens adult kingdom of spain 2018-02-09v4No1 / 9
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in age age < 1 year compared to age 1-3 years in feces homo sapiens infant )2017-11-13v4No1 / 13
669amnondominant feces, homo sapiens, infant, sweden, age 2 months2020-09-26v4No1 / 13
185amnoncommon in patients with c. diff infection before treatment (common feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
707amnon high in systemic lupus erythematosus compared to control in feces homo sapiens female adult guangzhou city prefecture age 30-50 china 2028-04-11v3No1 / 15
797amnon high in age 1 year compared to age 7 months in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 15
94amnoncommon feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 16
728amnoncommon feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 16
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v4No1 / 17
12amnon high in chronic fatigue syndrome compared to control in feces homo sapiens new york county 2016-11-02v4No1 / 18
330amnon high in infant age 1 year compared to adult age 30-40 in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 19
689amnoncommon feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 19
284amnoncommon feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
284amnondominant feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
797amnoncommon feces, homo sapiens, infant, germany, age 1 year, breast fed2021-06-13v3No1 / 20
185amnonhigh freq. in patients with c. diff infection before treatment (dominant feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
297amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years 2018-02-12v4No1 / 22
779amnoncommon feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 22
655amnondominant in patients before hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 22
655amnondominant in patients after hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No1 / 22
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, systemic lupus erythematosus, china2028-04-11v3No1 / 22
736amnon high in child age 1-3 years compared to female adult in feces homo sapiens tanzania pemba island 2021-01-25v3No1 / 22
241amnonhigh freq. in babies age < 3 years in russia (dominant feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 23
241amnoncommon in babies age < 3 years in finland (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 23
284amnondominant feces, homo sapiens, female, infant, state of california, age 1 year2018-01-27v4No1 / 23
669amnondominant feces, homo sapiens, infant, sweden, age 1 year2020-09-26v4No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, age 1 year, formula fed2021-06-13v3No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 23
241amnoncommon in babies age < 3 years in estonia (common feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 24
330amnondominant feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 24
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in feces homo sapiens hospital australia diarrhea )2018-11-04v4No1 / 24
641amnoncommon feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
284amnoncommon feces, homo sapiens, female, infant, state of california, age 6 months2018-01-27v4No1 / 25
395amnoncommon feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 25
714amnondominant homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 25
723amnondominant feces, homo sapiens, infant, child, indonesia, municipality of yogyakarta, age 0-6 months2021-01-02v3No1 / 26
766amnon high in age 8 weeks puppy compared to female organism adult organism age 2-7 years in feces canis lupus familiaris french republic dog rectal swab 2021-04-12v4No1 / 27
797amnon high in age 7 months compared to age 3 months in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 28
284amnoncommon feces, homo sapiens, female, infant, state of california, age 1 year2018-01-27v4No1 / 30
723amnoncommon feces, homo sapiens, child, indonesia, municipality of yogyakarta, age 2-4 years2021-01-02v3No1 / 30
45amnoncommon in feces babies age 0-2 in india (common feces, homo sapiens, infant, india)2016-12-19v4No1 / 31
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 31
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in feces homo sapiens united states of america adult )2018-11-18v4No1 / 31
655amnoncommon in patients before hematopoietic stem cell transplant (common feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 31
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 31
292amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens adult china 2018-02-05v4No1 / 32
24amnondisappears on transition to cow milk ( high in breast milk compared to mammalian milk beverage in feces homo sapiens infant )2016-12-01v4No1 / 35
284amnon high in age 1 year compared to age 2 months in feces homo sapiens female infant state of california 2018-01-27v4No1 / 35
669amnoncommon feces, homo sapiens, infant, sweden, age 1 year2020-09-26v4No1 / 35
240amnoncommon in infants age <3 years (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 36
407amnon high in dry season compared to wet season in feces costa rica monkey wild cebus capucinus white-faced capuchin 2018-11-21v4No1 / 36
330amnoncommon feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 39
797amnon high in age 3 months compared to age 1 month in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 39
19amnoncommon in biopsies of children (IBD study) (common homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 40
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, age 2-4 years2019-11-18v3No1 / 42
241amnoncommon in babies age < 3 years in russia (common feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 44
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one year2018-01-14v4No1 / 46
392amnon high in defatted larvae insect diet compared to larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 46
428amnon high in acute pancreatitis pancreatitis compared to control in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 46
797amnoncommon feces, homo sapiens, child, germany, formula fed, age 2 years2021-06-13v3No1 / 46
392amnon high in defatted larvae insect diet compared to pre pupae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 49
339amnon high in infant age < 1 year compared to adult in feces homo sapiens india 2018-05-24v4No1 / 50
406amnoncommon feces, united states of america, zoological garden, equus przewalskii, przewalski horse2018-11-21v4No1 / 50
564amnoncommon feces, homo sapiens, control, child, italy, age 2-4 years2019-11-18v3No1 / 50
797amnon high in infant age 1 year compared to child age 2 years in feces homo sapiens germany formula fed 2021-06-13v3No1 / 52
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in feces homo sapiens adult nanning city prefecture age 50-60 years china )2018-01-27v4No1 / 54
131amnon high in female compared to male in feces homo sapiens south korea 2017-04-16v4No1 / 55
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, systemic lupus erythematosus, china2028-04-11v3No1 / 55
368amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 56
488amnoncommon feces, canis lupus familiaris, italy, dog, lymphoma2019-02-25v4No1 / 56
650amnon high in female compared to male in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 57
392amnon high in defatted larvae insect diet compared to fishmeal diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 58
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 59
630amnon high in female compared to male in feces homo sapiens adult kingdom of spain madrid 2020-05-31v3No1 / 63
671amnon high in age 1 month compared to age 3 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 64
695amnon high in sesame allergy compared to milk allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 64
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
644amnon high in female compared to male in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v4No1 / 69
127amnonhigher in non-vaccinated chickens ( high in control compared to vaccination salmune vaccination in united states of america caecum gallus gallus chicken )2017-04-14v4No1 / 72
448amnon high in equine grass sickness disease compared to control in feces farm equus caballus horse united kingdom 2019-01-08v4No1 / 72
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 3 months 2021-06-13v3No1 / 75
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in feces homo sapiens china )2018-12-30v4No1 / 76
663amnon high in switzerland compared to poland in feces homo sapiens adult 2020-09-22v4No1 / 76
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic ampicillin neomycin compared to control in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 80
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
590amnoncommon farm, intestine, age 3-5 weeks, china, hainan autonomous prefecture, trachemys scripta elegans, red-eared slider turtle, turtle farm2020-02-10v4No1 / 83
649amnon high in ileum compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 92
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
488amnoncommon feces, control, canis lupus familiaris, italy, dog2019-02-25v4No1 / 94
723amnonhigher in children age 2-4 years compared to mothers ( high in child age 2-4 years compared to adult in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 95
804amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens child africa central african republic madagascar age 2-5 years 2021-06-18v4No1 / 100
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 106
797amnon high in age 1 year compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
273amnon high in age age one month compared to age one week in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 107
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china2018-12-30v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 126
753amnon high in farm canis lupus familiaris dog dog breeding center compared to zoological garden captive canis lupus wolf in feces adult china 2021-03-12v4No1 / 127
660amnonlower in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in upano valley compared to cross-cutucu in feces homo sapiens ecuador rural community village shuar population )2020-09-20v4No1 / 132
766amnon high in age 8 weeks compared to age 2 days in feces canis lupus familiaris french republic dog rectal swab puppy 2021-04-12v4No1 / 133
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in feces homo sapiens united states of america )2017-04-12v4No1 / 141
396amnon high in oncorhynchus mykiss rainbow trout compared to cyprinus carpio common carp in digestive system intestine england fish 2018-11-14v4No1 / 142
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
759amnon high in canis lupus familiaris dog compared to canis lupus wolf wildlife sactuary in feces united states of america state of minnesota 2021-04-06v4No1 / 148
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 154
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
669amnon high in age 1 year compared to age 2 months in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 217
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 220
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
214amnonlower in mice from jackson laboratories compared to taconic farms ( high in taconic farms compared to jackson laboratories in feces united states of america research facility mus musculus mouse strain 129s )2017-10-23v4No1 / 232
331amnon high in dry season compared to wet season in feces ethiopia monkey theropithecus gelada 2018-05-13v4No1 / 232
404amnon high in bogota medellin metropolitan area compared to municipality of santiago de cali bucaramanga barranquilla in feces homo sapiens city adult colombia 2018-11-20v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, age 50-60 years, nephrolithiasis, china)2018-01-27v4No1 / 239
483amnoncommon united states of america, research facility, hawaii, pearl harbor, hydroides elegans, tubeworm, shelled egg2019-02-13v4No1 / 243
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
438amnon high in child age 3-6 age 8-12 compared to adult age 30-50 age 60-79 in feces homo sapiens china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, age 50-60 years, china)2018-01-27v4No1 / 281
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v4No1 / 384
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 400
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in feces homo sapiens china )2018-12-30v4No1 / 474
214amnon high in diet mouse chow nih 31m chow compared to high fat diet in feces united states of america research facility mus musculus mouse 2017-10-23v4No1 / 495
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in feces homo sapiens child africa 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in feces homo sapiens china )2018-12-30v4No1 / 617
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261

Problems / suggestions? Please email info AT dbbact DOT org