Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT
common ontology terms
term enrichment score
TermScore
homo sapiens0.639806
adult0.396297
saliva0.299149
feces0.275265
child0.234125
dentition0.211061
united states of america0.191214
mouth0.170122
infant0.162791
china0.150781
supragingival plaque0.138329
subgingival plaque0.129108
oral cavity0.121951
supragingival dental plaque0.104167
mouth mucosa0.093960
germany0.093448
state of new york0.075000
oral wash0.064171
australia0.064118
state of nebraska0.062500
hospital0.061538
control0.060606
LOWER IN control0.060606
formula fed0.058433
crohn's disease0.058069
africa0.057592
obsolete_juvenile stage0.056774
canada0.056738
municipality of beijing0.055980
kingdom of spain0.054455
age 6 years0.052632
age 8 years0.052632
age 9 years0.052632
age 11 years0.052632
age 10 years0.051282
age 7 years0.051282
buccal mucosa0.048485
female0.048261
ulcerative colitis0.048193
periodontitis0.048193
macaca mulatta0.047619
monkey0.046154
city0.045662
subgingival dental plaque0.043011
rural community0.042553
sweden0.041451
duodenum0.041096
italy0.040404
brazil0.040201
state of california0.039216
research facility0.039068
skin0.038760
bronchial epithelium0.037966
central african republic0.037787
breast fed0.037433
bolivia0.037433
commonwealth of pennsylvania0.036745
pair of nares0.036411
captive0.033373
age 7 months0.032258
LOWER IN age 3 months0.032258
bangui0.032258
rhesus macaque0.032258
age 1 month0.032000
diarrhea0.031915
age 3 months0.031496
united kingdom0.031250
age < 3 years0.027211
toronto0.027211
finland0.027119
india0.027027
acute respiratory failure0.027027
clostridium difficile intestinal infectious disease0.027027
oropharynx0.027027
respiratory failure0.026667
shanghai district0.026667
hiv infection0.026549
age 1 year0.026549
horse0.026316
state of michigan0.026144
equus caballus0.026144
lung0.025974
poland0.025641
farm0.022346
age 2-4 years0.021858
age 7-14 years0.021739
chronic periodontitis0.021739
acute pericementitis0.021739
late adult stage0.021739
city of dresden0.021739
stunted growth0.021739
chuquisaca department0.021739
municipality of umea0.021739
sputum0.021622
shanghai proper0.021505
age 5-13 years0.021505
czech republic0.021390
nasal cavity0.021352
LOWER IN saliva0.021333
sichuan province0.021277
Fraction of dbbact annotations with this term covered by the query
TermScore
subgingival plaque0.916667
supragingival plaque0.888889
oral wash0.857143
supragingival dental plaque0.833333
buccal mucosa0.800000
bronchial epithelium0.800000
mouth mucosa0.777778
dentition0.772727
saliva0.761905
small village0.750000
oral cavity0.714286
mouth0.680000
LOWER IN remission0.666667
autistic disorder0.666667
subgingival dental plaque0.666667
formula fed0.666667
ulcerative colitis0.666667
tonsillitis0.666667
LOWER IN breast milk0.666667
hispanic or latin american0.666667
age < 3 years0.666667
state of oklahoma0.666667
central african republic0.666667
age 1-7 years0.666667
age 2-4 years0.666667
LOWER IN breast fed0.666667
venezuela0.666667
amerindian0.666667
toronto0.666667
madagascar0.666667
LOWER IN nasopharynx0.666667
crohn's disease0.583333
child0.571429
finland0.571429
visceral leishmaniasis0.500000
india0.500000
bihar state0.500000
age 13-15 years0.500000
denver0.500000
gay0.500000
after hcst0.500000
hematopoietic stem cell transplant0.500000
LOWER IN recurrent tonsillitis0.500000
tonsillectomy0.500000
infant0.500000
breast fed0.500000
age 7 months0.500000
acute respiratory failure0.500000
endotracheal aspirate0.500000
autism0.500000
age 7-14 years0.500000
chronic periodontitis0.500000
acute pericementitis0.500000
cornell university0.500000
inflammatory bowel disease0.500000
before antibiotics0.500000
LOWER IN amoxicillin0.500000
LOWER IN doxycycline0.500000
acute severe colitis0.500000
active disease0.500000
clostridium difficile intestinal infectious disease0.500000
valladolid0.500000
bolivia0.500000
oropharynx0.500000
oropharyngeal swab0.500000
jinan city prefecture0.500000
state of nebraska0.500000
age 6 years0.500000
age 8 years0.500000
age 9 years0.500000
age 11 years0.500000
burmese0.500000
severe0.500000
LOWER IN mild0.500000
late adult stage0.500000
hard palate0.500000
tooth disease0.500000
black dental staining0.500000
age one week0.500000
city of dresden0.500000
autoimmune hepatitis0.500000
zhengzhou city prefecture0.500000
mammalian milk beverage0.500000
hispanic0.500000
age<17 years0.500000
atherosclerosis0.500000
LOWER IN tongue0.500000
LOWER IN age 3 months0.500000
gingiva0.500000
keratinized gingiva0.500000
cheyenne0.500000
native american0.500000
arapaho0.500000
LOWER IN american0.500000
africa0.500000
bangui0.500000
stunted growth0.500000
LOWER IN age 12-23 years0.500000
macaca mulatta0.500000
puerto rico0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.894444
adult0.430556
feces0.366667
united states of america0.250000
saliva0.186111
china0.175000
child0.147222
dentition0.122222
mouth0.097222
infant0.097222
supragingival plaque0.075000
subgingival plaque0.069444
oral cavity0.066667
germany0.063889
supragingival dental plaque0.055556
mouth mucosa0.050000
control0.050000
LOWER IN control0.044444
state of new york0.041667
australia0.036111
research facility0.036111
hospital0.033333
oral wash0.033333
state of nebraska0.033333
canada0.033333
female0.030556
obsolete_juvenile stage0.030556
crohn's disease0.030556
kingdom of spain0.030556
municipality of beijing0.030556
formula fed0.030556
africa0.030556
periodontitis0.027778
age 10 years0.027778
age 7 years0.027778
age 6 years0.027778
age 8 years0.027778
age 9 years0.027778
age 11 years0.027778
buccal mucosa0.025000
ulcerative colitis0.025000
city0.025000
macaca mulatta0.025000
monkey0.025000
italy0.022222
subgingival dental plaque0.022222
state of california0.022222
brazil0.022222
duodenum0.022222
sweden0.022222
rural community0.022222
skin0.022222
breast fed0.019444
commonwealth of pennsylvania0.019444
bolivia0.019444
bronchial epithelium0.019444
central african republic0.019444
pair of nares0.019444
captive0.019444
age 7 months0.016667
age 3 months0.016667
age 1 month0.016667
diarrhea0.016667
LOWER IN age 3 months0.016667
bangui0.016667
rhesus macaque0.016667
united kingdom0.016667
india0.013889
hiv infection0.013889
respiratory failure0.013889
acute respiratory failure0.013889
state of michigan0.013889
clostridium difficile intestinal infectious disease0.013889
oropharynx0.013889
shanghai district0.013889
poland0.013889
age 1 year0.013889
lung0.013889
finland0.013889
age < 3 years0.013889
toronto0.013889
farm0.013889
equus caballus0.013889
horse0.013889
shanghai proper0.011111
age 7-14 years0.011111
chronic periodontitis0.011111
acute pericementitis0.011111
sichuan province0.011111
late adult stage0.011111
type 2 diabetes mellitus0.011111
city of dresden0.011111
sputum0.011111
guangzhou city prefecture0.011111
czech republic0.011111
stunted growth0.011111
LOWER IN adult0.011111
nasal cavity0.011111
age 2-4 years0.011111
chuquisaca department0.011111
Exp. ID User ID Description Date Region Flag Sequences
203amnon high in female compared to male in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth 2017-10-01v4No1 / 4
320amnonlower in CD patients with remission ( high in crohn's disease compared to remission in feces homo sapiens adult )2018-04-19v4No1 / 4
570amnon high in visceral leishmaniasis compared to control in feces homo sapiens india bihar state 2019-12-16v3No1 / 4
598amnon high in female compared to male in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 2020-03-25v3No1 / 5
344amnon high in hiv infection compared to control in feces homo sapiens united states of america state of colorado denver gay homosexual msm 2018-05-31v4No1 / 6
655amnoncommon in patients after hematopoietic stem cell transplant (common feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No1 / 10
773amnon high in iga glomerulonephritis compared to tonsillitis recurrent tonsillitis in homo sapiens adult palatine tonsil japan tonsillectomy 2021-04-23v4No1 / 12
797amnoncommon feces, homo sapiens, infant, germany, breast fed, age 7 months2021-06-13v3No1 / 12
636amnoncommon homo sapiens, united states of america, hospital, adult, commonwealth of pennsylvania, tracheal aspirate, respiratory failure, acute respiratory failure, trachea, endotracheal aspirate2020-08-08v4No1 / 13
731amnondominant homo sapiens, united states of america, mouth mucosa, adult, state of michigan, buccal mucosa2021-01-09v4No1 / 13
555amnon high in autistic disorder autism compared to control in homo sapiens saliva child shanghai proper age 7-14 years china 2019-09-10v3No1 / 13
806amnondominant homo sapiens, united states of america, oral cavity, adult, state of new york, oral wash, mouth2021-06-19v3No1 / 13
725amnondominant homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, chronic periodontitis, china, municipality of beijing2021-01-03v3No1 / 14
725amnondominant homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 14
797amnondominant feces, homo sapiens, infant, germany, breast fed, age 7 months2021-06-13v3No1 / 14
63amnonhigh freq. in saliva in american gut ( high in compared to in homo sapiens saliva )2017-02-15v4No1 / 15
63amnonhigh freq. in saliva in american gut (dominant homo sapiens, saliva)2017-02-15v4No1 / 15
64amnondominant homo sapiens, saliva, sichuan province2017-02-16v4No1 / 15
524amnondominant homo sapiens, saliva, adult, sichuan province, china2019-07-06v4No1 / 15
802amnondominant homo sapiens, united states of america, saliva, adult, state of new york, cornell university2021-06-16v4No1 / 15
797amnoncommon feces, homo sapiens, infant, germany, age 3 months, breast fed2021-06-13v3No1 / 15
797amnondominant feces, homo sapiens, infant, germany, age 3 months, breast fed2021-06-13v3No1 / 15
797amnoncommon feces, homo sapiens, infant, germany, age 1 month, formula fed2021-06-13v3No1 / 15
806amnondominant homo sapiens, united states of america, dentition, adult, state of new york, supragingival plaque, supragingival dental plaque2021-06-19v3No1 / 15
319amnondominant homo sapiens, united states of america, saliva, state of texas2018-04-18v4No1 / 16
348amnondominant homo sapiens, saliva, adult, italy2018-07-16v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child inflammatory bowel disease crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
493amnondominant homo sapiens, united states of america, saliva, adult, state of new york2019-02-27v4No1 / 16
659amnon high in before antibiotics compared to antibiotic vancomycin metronidazole amoxicillin doxycycline in feces homo sapiens ulcerative colitis child acute severe colitis 2020-09-19v4No1 / 16
678amnondominant homo sapiens, control, adult, kingdom of spain, supragingival plaque, supragingival dental plaque2028-03-02v3No1 / 16
713amnon high in active disease compared to remission in feces homo sapiens crohn's disease 2028-05-21v3No1 / 16
725amnondominant homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, chronic periodontitis, china, municipality of beijing2021-01-03v3No1 / 16
728amnoncommon feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 16
32amnondominant homo sapiens, saliva, adult, bolivia2016-12-05v4No1 / 17
278amnondominant homo sapiens, united states of america, saliva, adult, state of california2018-01-23v4No1 / 17
636amnoncommon homo sapiens, united states of america, hospital, oropharynx, adult, commonwealth of pennsylvania, acute respiratory failure, respiratory failure, oropharyngeal swab2020-08-08v4No1 / 17
640amnondominant homo sapiens, female, saliva, adult, china, shanghai district2020-08-22v4No1 / 17
775amnondominant homo sapiens, saliva, adult, china, jinan city prefecture2021-04-24v4No1 / 17
658amnondominant homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, age 10 years, supragingival dental plaque, asian, age 7 years, age 6 years, age 8 years, age 9 years, age 11 years, burmese2020-09-17v3No1 / 17
725amnondominant homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 17
797amnoncommon feces, homo sapiens, infant, germany, age 3 months, formula fed2021-06-13v3No1 / 17
246amnondominant homo sapiens, saliva, italy2017-11-21v4No1 / 18
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in feces homo sapiens united states of america child )2018-11-22v4No1 / 18
663amnondominant homo sapiens, adult, poland, oral wash, mouth2020-09-22v4No1 / 18
519amnondominant homo sapiens, city, dentition, late adult stage, adult, supragingival plaque, china2019-06-25v3No1 / 18
806amnondominant homo sapiens, united states of america, mouth mucosa, adult, state of new york, buccal mucosa2021-06-19v3No1 / 18
806amnondominant homo sapiens, united states of america, adult, state of new york, hard palate2021-06-19v3No1 / 18
54amnondominant homo sapiens, united states of america, saliva2017-01-23v4No1 / 19
66amnondominant homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 19
299amnondominant homo sapiens, saliva, adult, mouth neoplasm, cancer, china2018-02-27v4No1 / 19
555amnondominant homo sapiens, dentition, child, shanghai proper, supragingival plaque, age 7-14 years, china2019-09-10v3No1 / 19
678amnondominant homo sapiens, adult, kingdom of spain, supragingival plaque, supragingival dental plaque, tooth disease, black dental staining2028-03-02v3No1 / 19
725amnondominant homo sapiens, control, adult, subgingival plaque, subgingival dental plaque, china, municipality of beijing2021-01-03v3No1 / 19
774amnondominant homo sapiens, saliva, oral cavity, adult, hong kong, oral wash, tonsillitis2021-04-24v3No1 / 19
797amnondominant feces, homo sapiens, infant, germany, age 1 month, formula fed2021-06-13v3No1 / 19
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one week2018-01-14v4No1 / 20
299amnonhigh freq. in healthy (non-tumor) controls (dominant homo sapiens, control, saliva, adult, china)2018-02-27v4No1 / 20
594amnondominant homo sapiens, saliva, adult, cameroon2020-03-12v4No1 / 20
703amnondominant homo sapiens, saliva, adult, germany, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 20
720amnondominant feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 20
797amnoncommon feces, homo sapiens, infant, germany, age 1 year, breast fed2021-06-13v3No1 / 20
797amnondominant feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 20
797amnondominant feces, homo sapiens, infant, germany, age 3 months, formula fed2021-06-13v3No1 / 20
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in feces homo sapiens infant )2016-12-01v4No1 / 21
33amnondominant homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 21
203amnondominant homo sapiens, oral cavity, dentition, australia, obsolete_juvenile stage, mouth2017-10-01v4No1 / 21
390amnondominant feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 21
658amnondominant homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, age 10 years, supragingival dental plaque, hispanic or latin american, age 7 years, age 6 years, age 8 years, age 9 years, age 11 years, hispanic2020-09-17v3No1 / 21
703amnondominant homo sapiens, dentition, adult, germany, subgingival plaque, subgingival dental plaque, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 21
728amnondominant feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 21
94amnondominant feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 22
96amnondominant homo sapiens, brazil, subgingival plaque, mouth2017-03-29v4No1 / 22
297amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years 2018-02-12v4No1 / 22
455amnondominant homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 22
731amnondominant in orophringeal otic secretion drainage (dominant homo sapiens, united states of america, oropharynx, adult, state of michigan)2021-01-09v4No1 / 22
779amnoncommon feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 22
576amnon high in mouth mucosa compared to tongue in homo sapiens adult czech republic 2020-01-09v3No1 / 22
655amnondominant in patients after hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, after hcst, hematopoietic stem cell transplant)2020-09-13v3No1 / 22
658amnondominant homo sapiens, united states of america, dentition, african american, child, state of nebraska, supragingival plaque, age 10 years, supragingival dental plaque, age 7 years, age 6 years, age 8 years, age 9 years, age 11 years2020-09-17v3No1 / 22
797amnon high in age 1 month compared to age 3 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 22
806amnoncommon homo sapiens, united states of america, adult, state of new york, gingiva, keratinized gingiva2021-06-19v3No1 / 22
241amnoncommon in babies age < 3 years in finland (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 23
242amnonhigher in native-americans compared to non native-american ( high in cheyenne native american arapaho compared to american in feces homo sapiens united states of america state of oklahoma )2017-11-14v4No1 / 23
425amnondominant homo sapiens, stomach, child, africa, central african republic, bangui, stunted growth2018-12-08v4No1 / 23
542amnon high in child age 1-7 years compared to adult age 12-23 years in research facility dentition macaca mulatta puerto rico subgingival plaque monkey 2019-08-01v4No1 / 23
636amnondominant homo sapiens, united states of america, hospital, adult, commonwealth of pennsylvania, tracheal aspirate, acute respiratory failure, respiratory failure, trachea, endotracheal aspirate2020-08-08v4No1 / 23
636amnondominant homo sapiens, united states of america, hospital, oropharynx, adult, commonwealth of pennsylvania, acute respiratory failure, respiratory failure, oropharyngeal swab2020-08-08v4No1 / 23
779amnondominant feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 23
658amnondominant homo sapiens, united states of america, dentition, caucasian, child, state of nebraska, supragingival plaque, age 10 years, supragingival dental plaque, european, age 7 years, age 6 years, age 8 years, age 9 years, age 11 years2020-09-17v3No1 / 23
713amnondominant feces, homo sapiens, crohn's disease, active disease2028-05-21v3No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, age 7 months2021-06-13v3No1 / 23
96amnon high in control compared to periodontitis in homo sapiens brazil subgingival plaque mouth 2017-03-29v4No1 / 24
173amnondominant homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 24
202amnondominant homo sapiens, oral cavity, mouth mucosa, mouth, china2017-10-01v4No1 / 24
241amnoncommon in babies age < 3 years in estonia (common feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 24
260amnondominant homo sapiens, united states of america, dentition, state of nebraska, subgingival plaque, mouth2017-12-05v4No1 / 24
554amnondominant homo sapiens, dentition, adult, egypt, root canal, primary endodontic infection, root canal infection2019-09-10v3No1 / 24
597amnondominant feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 24
605amnon high in middle ear rinse compared to middle ear fluid in middle ear child australia age 1-3 years perth recurrent otitis media 2020-04-07v3No1 / 24
685amnon high in morning compared to evening in homo sapiens oral cavity mouth mucosa adult australia 2028-03-08v3No1 / 24
713amnoncommon feces, homo sapiens, crohn's disease, active disease2028-05-21v3No1 / 24
258amnonhigh freq. in lungs of hiv patients with pneumonia (dominant homo sapiens, lung, bronchoalveolar lavage, hiv infection, bronchial epithelium, uganda, pneumonia)2017-11-27v4No1 / 25
284amnoncommon feces, homo sapiens, female, infant, state of california, age 6 months2018-01-27v4No1 / 25
425amnondominant homo sapiens, duodenum, child, africa, central african republic, bangui, stunted growth2018-12-08v4No1 / 25
428amnoncommon feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 25
640amnondominant homo sapiens, female, dentition, adult, supragingival plaque, supragingival dental plaque, china, shanghai district2020-08-22v4No1 / 25
663amnoncommon homo sapiens, nasal cavity, pair of nares, adult, poland2020-09-22v4No1 / 25
779amnoncommon feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 25
104amnondominant homo sapiens, dentition, russia, moscow, subgingival plaque, mouth2017-04-05v4No1 / 27
685amnoncommon homo sapiens, oral cavity, mouth mucosa, adult, australia2028-03-08v3No1 / 27
797amnon high in age 3 months compared to age 1 month in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 27
203amnonpositively correlated with age in child dental plaque ( high in age older age compared to younger age in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth )2017-10-01v4No1 / 28
797amnon high in age 7 months compared to age 3 months in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 28
711amnoncommon homo sapiens, united states of america, oral cavity, adult, state of colorado, mouth2028-05-21v4No1 / 29
658amnon high in african american compared to asian burmese in homo sapiens united states of america dentition child state of nebraska supragingival plaque age 10 years supragingival dental plaque age 7 years age 6 years age 8 years age 9 years age 11 years 2020-09-17v3No1 / 29
3amnondominant homo sapiens, tongue, china2016-10-06v4No1 / 30
320amnoncommon feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 30
658amnon high in caucasian european compared to asian burmese in homo sapiens united states of america dentition child state of nebraska supragingival plaque age 10 years supragingival dental plaque age 7 years age 6 years age 8 years age 9 years age 11 years 2020-09-17v3No1 / 30
723amnoncommon feces, homo sapiens, child, indonesia, municipality of yogyakarta, age 2-4 years2021-01-02v3No1 / 30
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 31
655amnoncommon in patients before hematopoietic stem cell transplant (common feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 31
796amnon high in graves' disease compared to control in feces homo sapiens adult taiwan republic of china taoyuan city 2021-06-10v3No1 / 31
63amnoncommon in saliva in american gut (common homo sapiens, saliva)2017-02-15v4No1 / 32
292amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens adult china 2018-02-05v4No1 / 32
354amnon high in sputum induced sputum compared to bronchus bronchial epithelium bronchial brush in homo sapiens united states of america adult 2018-07-30v4No1 / 32
354amnon high in saliva oral wash compared to bronchus bronchial epithelium bronchial brush in homo sapiens united states of america adult 2018-07-30v4No1 / 33
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens duodenum child africa 2018-12-08v4No1 / 33
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 34
258amnonhigher lungs of hiv pneumonia patients treated with ceftriaxone ( high in ceftriaxone compared to no ceftriaxone in homo sapiens lung bronchoalveolar lavage hiv infection bronchial epithelium uganda pneumonia )2017-11-27v4No1 / 35
669amnoncommon feces, homo sapiens, infant, sweden, age 1 year2020-09-26v4No1 / 35
228amnoncommon in sinus brush of healthy participants (common homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space)2017-10-31v4No1 / 36
240amnoncommon in infants age <3 years (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 36
277amnoncommon homo sapiens, nasal cavity, pair of nares, adult, belgium2018-01-23v4No1 / 37
711amnoncommon homo sapiens, united states of america, oral cavity, child, state of colorado, mouth, age 8-12 years2028-05-21v4No1 / 37
227amnonhigher in nasopharynx of formula fed babies compared to breast fed ( high in diet formula fed compared to breast milk breast fed in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-11-03v4No1 / 38
390amnoncommon feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 38
330amnoncommon feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 39
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
542amnoncommon research facility, dentition, macaca mulatta, child, puerto rico, subgingival plaque, monkey, age 1-7 years2019-08-01v4No1 / 41
806amnoncommon homo sapiens, united states of america, dentition, adult, state of new york, supragingival plaque, supragingival dental plaque2021-06-19v3No1 / 41
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, age 2-4 years2019-11-18v3No1 / 42
371amnoncommon homo sapiens, saliva, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 43
517amnoncommon homo sapiens, mouth mucosa, child, bolivia, chuquisaca department, rural community, age 5-13 years, mouth2019-05-29v4No1 / 44
797amnon high in age 7 months compared to age 1 year in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 44
773amnoncommon homo sapiens, adult, palatine tonsil, tonsillitis, japan, tonsillectomy, recurrent tonsillitis2021-04-23v4No1 / 45
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one year2018-01-14v4No1 / 46
779amnoncommon feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 47
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, upper eyelid, epidermis2028-05-22v3No1 / 47
720amnoncommon feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 48
258amnoncommon in lungs of hiv patients with pneumonia (common homo sapiens, lung, bronchoalveolar lavage, hiv infection, bronchial epithelium, uganda, pneumonia)2017-11-27v4No1 / 49
725amnoncommon homo sapiens, control, mouth mucosa, adult, buccal mucosa, china, municipality of beijing2021-01-03v3No1 / 51
335amnoncommon in mouthwash (common homo sapiens, united states of america, oral cavity, oral wash, mouth)2018-05-16v4No1 / 52
354amnoncommon homo sapiens, united states of america, saliva, adult, oral wash2018-07-30v4No1 / 52
651amnon high in control compared to parkinson's disease in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 52
797amnon high in infant age 1 year compared to child age 2 years in feces homo sapiens germany formula fed 2021-06-13v3No1 / 52
279amnon high in mouth compared to stomach small intestine in ochotonidae pikas china 2018-01-24v4No1 / 53
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
773amnoncommon homo sapiens, adult, palatine tonsil, iga glomerulonephritis, japan, tonsillectomy2021-04-23v4No1 / 54
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
390amnoncommon feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 55
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in antibiotic vancomycin metronidazole neomycin compared to control in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 55
653amnon high in saliva compared to tongue dermal layer of tongue in homo sapiens adult toronto canada age 20-30 years 2020-09-13v3No1 / 55
63amnoncommon in skin in american gut (common homo sapiens, skin)2017-02-15v4No1 / 56
519amnon high in dentition supragingival plaque compared to saliva in homo sapiens city late adult stage adult china 2019-06-25v3No1 / 56
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, chest, epidermis, torso2028-05-22v3No1 / 56
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, palmar part of manus, epidermis, palm of hand2028-05-22v3No1 / 57
260amnoncommon homo sapiens, united states of america, dentition, state of nebraska, subgingival plaque, mouth2017-12-05v4No1 / 59
32amnon high in adult compared to infant in homo sapiens saliva bolivia 2016-12-05v4No1 / 60
228amnonlower in chronic sinositis compared to healthy controls in sinus brushing ( high in control compared to sinusitis in homo sapiens united states of america mucosa paranasal sinus sinusoidal space )2017-10-31v4No1 / 60
335amnoncommon homo sapiens, united states of america, bronchial epithelium2018-05-16v4No1 / 61
637amnoncommon feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 61
354amnoncommon homo sapiens, sputum, united states of america, adult, induced sputum2018-07-30v4No1 / 63
671amnon high in age 1 month compared to age 3 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 64
272amnoncommon in subgingival plaque in south korea (common homo sapiens, dentition, subgingival plaque, mouth, south korea)2018-01-10v4No1 / 65
354amnoncommon homo sapiens, united states of america, bronchus, bronchial epithelium, adult, bronchial brush2018-07-30v4No1 / 65
448amnoncommon feces, farm, equus caballus, horse, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 65
640amnoncommon homo sapiens, female, dentition, adult, supragingival plaque, supragingival dental plaque, china, shanghai district2020-08-22v4No1 / 65
720amnon high in autoimmune hepatitis compared to control in feces homo sapiens adult china zhengzhou city prefecture 2028-05-23v3No1 / 65
576amnoncommon homo sapiens, mouth mucosa, adult, czech republic, lip, lower labial mucosa2020-01-09v3No1 / 66
162amnoncommon in periodontal pocket in humans (common homo sapiens, united states of america, dentition, san diego, subgingival plaque, periodontal pocket, mouth)2017-07-13v4No1 / 67
690amnoncommon in squamous esophagos samples from patients undergoing endoscopy (common homo sapiens, united states of america, hospital, esophagus, new york city, esophageal disease, squamous esophagus)2028-03-11v4No1 / 68
378amnoncommon homo sapiens, control, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth2018-09-14v4No1 / 69
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 1 month 2021-06-13v3No1 / 69
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, switzerland2020-09-22v4No1 / 71
576amnoncommon homo sapiens, mouth mucosa, adult, czech republic, buccal mucosa2020-01-09v3No1 / 71
448amnon high in equine grass sickness disease compared to control in feces farm equus caballus horse united kingdom 2019-01-08v4No1 / 72
817amnoncommon united states of america, research facility, saliva, oral cavity, commonwealth of pennsylvania, oral wash, captive, cheek pouch, macaca fascicularis, cynomolgus macaque2021-07-07v4No1 / 72
26amnoncommon homo sapiens, united states of america, mucus, pair of nares2016-12-05v4No1 / 73
425amnoncommon feces, homo sapiens, child, africa, madagascar, antananarivo2018-12-08v4No1 / 73
299amnon high in control compared to mouth neoplasm cancer in homo sapiens saliva adult china 2018-02-27v4No1 / 75
54amnoncommon homo sapiens, united states of america, saliva2017-01-23v4No1 / 77
731amnoncommon in orophringeal otic secretion drainage (common homo sapiens, united states of america, oropharynx, adult, state of michigan)2021-01-09v4No1 / 77
425amnoncommon feces, homo sapiens, child, africa, central african republic, bangui2018-12-08v4No1 / 79
598amnonhigher in mouthwash of kids with braces compared to no braces ( high in braces teeth braces compared to control in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years )2020-03-25v3No1 / 79
378amnoncommon homo sapiens, dentition, adult, brazil, subgingival plaque, depth > 3mm, deep pocket depth, mouth, periodontitis2018-09-14v4No1 / 80
3amnoncommon homo sapiens, tongue, china2016-10-06v4No1 / 81
203amnoncommon homo sapiens, oral cavity, dentition, australia, obsolete_juvenile stage, mouth2017-10-01v4No1 / 81
777amnon high in age 3 years compared to age 5 years in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 81
658amnoncommon homo sapiens, united states of america, dentition, caucasian, child, state of nebraska, supragingival plaque, age 10 years, supragingival dental plaque, european, age 7 years, age 6 years, age 8 years, age 9 years, age 11 years2020-09-17v3No1 / 82
378amnoncommon homo sapiens, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth, periodontitis2018-09-14v4No1 / 84
663amnoncommon feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 85
731amnoncommon homo sapiens, united states of america, mouth mucosa, adult, state of michigan, buccal mucosa2021-01-09v4No1 / 85
802amnoncommon homo sapiens, united states of america, saliva, adult, state of new york, cornell university2021-06-16v4No1 / 85
26amnon high in mucus pair of nares compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
162amnoncommon in supragingival plaque in humans (common homo sapiens, united states of america, dentition, san diego, supragingival plaque, mouth)2017-07-13v4No1 / 86
277amnon high in nasal cavity pair of nares compared to nasopharynx in homo sapiens adult belgium 2018-01-23v4No1 / 86
806amnoncommon homo sapiens, united states of america, oral cavity, adult, state of new york, oral wash, mouth2021-06-19v3No1 / 86
319amnoncommon homo sapiens, united states of america, saliva, state of texas2018-04-18v4No1 / 87
806amnon high in oral cavity oral wash compared to palatine tonsil in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 87
703amnoncommon homo sapiens, dentition, adult, germany, subgingival plaque, subgingival dental plaque, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 89
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in united states of america building urban biome )2017-10-01v4No1 / 91
26amnon high in mucus pair of nares compared to sebum axilla inguinal region in homo sapiens united states of america 2016-12-05v4No1 / 92
715amnoncommon homo sapiens, esophagus, adult, australia, oesophageal brush2028-05-22v4No1 / 92
725amnoncommon homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, chronic periodontitis, china, municipality of beijing2021-01-03v3No1 / 92
774amnoncommon homo sapiens, control, saliva, oral cavity, adult, hong kong, oral wash2021-04-24v3No1 / 92
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
658amnoncommon homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, age 10 years, supragingival dental plaque, hispanic or latin american, age 7 years, age 6 years, age 8 years, age 9 years, age 11 years, hispanic2020-09-17v3No1 / 93
348amnoncommon homo sapiens, saliva, adult, italy2018-07-16v4No1 / 94
723amnonhigher in children age 2-4 years compared to mothers ( high in child age 2-4 years compared to adult in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 95
58amnon high in conjunctiva compared to skin skin under eye in homo sapiens new york city 2017-02-02v4No1 / 96
278amnoncommon homo sapiens, united states of america, adult, state of california, subgingival plaque2018-01-23v4No1 / 96
678amnoncommon homo sapiens, adult, kingdom of spain, supragingival plaque, supragingival dental plaque, tooth disease, black dental staining2028-03-02v3No1 / 96
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
658amnoncommon homo sapiens, united states of america, dentition, african american, child, state of nebraska, supragingival plaque, age 10 years, supragingival dental plaque, age 7 years, age 6 years, age 8 years, age 9 years, age 11 years2020-09-17v3No1 / 98
105amnoncommon homo sapiens, dentition, brazil, mouth, pulpitis2017-04-05v4No1 / 100
202amnoncommon homo sapiens, oral cavity, mouth mucosa, mouth, china2017-10-01v4No1 / 100
455amnoncommon homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 100
804amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens child africa central african republic madagascar age 2-5 years 2021-06-18v4No1 / 100
438amnoncommon feces, homo sapiens, age 19-24, china2018-12-30v4No1 / 101
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 102
554amnoncommon homo sapiens, dentition, adult, egypt, root canal, primary endodontic infection, root canal infection2019-09-10v3No1 / 102
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in caecum sus scrofa pig united kingdom )2017-11-26v4No1 / 103
493amnoncommon homo sapiens, united states of america, saliva, adult, state of new york2019-02-27v4No1 / 104
519amnoncommon homo sapiens, city, dentition, late adult stage, adult, supragingival plaque, china2019-06-25v3No1 / 104
777amnon high in age 2 days compared to age 3 months in homo sapiens saliva infant sweden municipality of umea 2021-04-26v3No1 / 104
663amnoncommon homo sapiens, adult, poland, oral wash, mouth2020-09-22v4No1 / 106
806amnoncommon homo sapiens, united states of america, saliva, adult, state of new york2021-06-19v3No1 / 106
149amnon high in stream compared to pond in larval stage intestine amphibian larval stage germany salamandra salamandra fire salamander 2017-04-24v4No1 / 107
278amnon high in control compared to periodontitis in homo sapiens united states of america adult state of california subgingival plaque 2018-01-23v4No1 / 107
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china2018-12-30v4No1 / 109
524amnoncommon homo sapiens, saliva, adult, sichuan province, china2019-07-06v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
425amnoncommon homo sapiens, stomach, child, africa, stunted growth2018-12-08v4No1 / 111
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 60-79, china2018-12-30v4No1 / 111
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
555amnoncommon homo sapiens, dentition, child, shanghai proper, supragingival plaque, age 7-14 years, china2019-09-10v3No1 / 112
594amnoncommon homo sapiens, saliva, adult, cameroon2020-03-12v4No1 / 113
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 30-50, china2018-12-30v4No1 / 115
691amnon high in spring compared to summer in water drinking water french republic commune of paris 2028-03-11v3No1 / 115
703amnoncommon homo sapiens, saliva, adult, germany, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 115
32amnoncommon homo sapiens, saliva, adult, bolivia2016-12-05v4No1 / 116
195amnoncommon in boston subway surfaces (common city, urban biome, boston, train)2017-09-07v4No1 / 116
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
640amnoncommon homo sapiens, female, saliva, adult, china, shanghai district2020-08-22v4No1 / 117
343amnoncommon in apple flowers (common united states of america, flower structure, malus x domestica, state of connecticut, flower, apple)2018-05-28v4No1 / 118
636amnon high in oropharynx oropharyngeal swab compared to tracheal aspirate trachea endotracheal aspirate in homo sapiens united states of america hospital adult commonwealth of pennsylvania acute respiratory failure respiratory failure 2020-08-08v4No1 / 122
425amnoncommon homo sapiens, duodenum, child, africa, madagascar, antananarivo2018-12-08v4No1 / 123
449amnoncommon feces, homo sapiens, colombia2019-01-09v4No1 / 124
598amnoncommon homo sapiens, saliva, oral cavity, child, kingdom of spain, age 13-15 years2020-03-25v3No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in feces homo sapiens toronto )2016-10-27v4No1 / 125
425amnoncommon homo sapiens, duodenum, child, africa, central african republic, bangui, stunted growth2018-12-08v4No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to rectum biopsy site biopsy in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 126
806amnon high in dorsum of tongue compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 126
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
75amnoncommon homo sapiens, saliva, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 129
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, age 30-402018-05-13v4No1 / 130
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in cloaca anas platyrhynchos state of california mallard )2017-03-05v4No1 / 131
526amnon high in cholelithiasis compared to control in homo sapiens bile gallbladder adult kingdom of spain 2019-07-14v3No1 / 131
660amnonlower in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in upano valley compared to cross-cutucu in feces homo sapiens ecuador rural community village shuar population )2020-09-20v4No1 / 132
246amnoncommon homo sapiens, saliva, italy2017-11-21v4No1 / 133
278amnoncommon homo sapiens, united states of america, saliva, adult, state of california2018-01-23v4No1 / 133
775amnoncommon homo sapiens, saliva, adult, china, jinan city prefecture2021-04-24v4No1 / 133
578amnon high in kingdom of spain compared to sweden in feces homo sapiens hiv infection adult gay homosexual msm male 2020-01-14v3No1 / 133
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
519amnoncommon homo sapiens, city, saliva, late adult stage, adult, china2019-06-25v3No1 / 134
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 132017-09-12v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 136
725amnoncommon homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 136
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 140
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america adult state of california 2018-01-23v4No1 / 146
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 148
64amnoncommon homo sapiens, saliva, sichuan province2017-02-16v4No1 / 152
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 154
725amnoncommon homo sapiens, control, adult, subgingival plaque, subgingival dental plaque, china, municipality of beijing2021-01-03v3No1 / 156
108amnon high in colon compared to caecum in united states of america research facility texas coturnix coturnix common quail 2017-04-07v4No1 / 157
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
653amnon high in dentition supragingival plaque supragingival dental plaque compared to saliva in homo sapiens adult toronto canada age 20-30 years 2020-09-13v3No1 / 157
658amnoncommon homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, age 10 years, supragingival dental plaque, asian, age 7 years, age 6 years, age 8 years, age 9 years, age 11 years, burmese2020-09-17v3No1 / 157
96amnoncommon homo sapiens, brazil, subgingival plaque, mouth2017-03-29v4No1 / 158
678amnoncommon homo sapiens, control, adult, kingdom of spain, supragingival plaque, supragingival dental plaque2028-03-02v3No1 / 160
209amnoncommon in whale blow condensate (common respiratory airway, north america, megaptera novaeangliae, humpback whale, exhaled air condensate, whale blow)2017-10-15v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 162
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 162
517amnon high in mouth mucosa mouth compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 162
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, age 13, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
806amnon high in oral cavity oral wash compared to pair of nares external naris in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 178
299amnoncommon in healthy (non-tumor) controls (common homo sapiens, control, saliva, adult, china)2018-02-27v4No1 / 179
671amnon high in age 8 months compared to female adult in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 182
555amnon high in dentition supragingival plaque compared to saliva in homo sapiens child shanghai proper age 7-14 years china 2019-09-10v3No1 / 184
567amnon high in pair of nares anterior naris compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
299amnoncommon homo sapiens, saliva, adult, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens juvenile organism obsolete_juvenile stage age 13 2017-09-12v4No1 / 189
371amnoncommon homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 195
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
777amnon high in age 3 months compared to age 2 days in homo sapiens saliva infant sweden municipality of umea 2021-04-26v3No1 / 197
384amnoncommon farm, pasture, saliva, oral cavity, equus caballus, canada, horse, mouth2018-10-22v4No1 / 201
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in feces homo sapiens china )2018-12-30v4No1 / 203
653amnon high in dentition supragingival plaque supragingival dental plaque compared to tongue dermal layer of tongue in homo sapiens adult toronto canada age 20-30 years 2020-09-13v3No1 / 205
725amnoncommon homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, chronic periodontitis, china, municipality of beijing2021-01-03v3No1 / 206
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
669amnon high in age 1 year compared to age 2 months in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
511amnoncommon kingdom of norway, sweden, finland, lapland, depth 0-5cm, snow2019-03-20v4No1 / 213
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v3No1 / 214
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
104amnoncommon homo sapiens, dentition, russia, moscow, subgingival plaque, mouth2017-04-05v4No1 / 227
331amnon high in dry season compared to wet season in feces ethiopia monkey theropithecus gelada 2018-05-13v4No1 / 232
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens female adult china shanghai district 2020-08-22v4No1 / 232
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta monkey captive rhesus macaque age 8 months 2020-09-27v4No1 / 232
725amnoncommon homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 240
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 242
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in feces homo sapiens infant india )2016-12-19v4No1 / 253
63amnon high in male compared to female in feces homo sapiens united states of america 2017-12-04v4No1 / 262
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 263
384amnoncommon farm, hay, saliva, oral cavity, equus caballus, canada, horse, barn, mouth2018-10-22v4No1 / 274
770amnoncommon feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 280
596amnon high in age 1-7 years compared to age < 1 year in homo sapiens saliva child sweden 2020-03-18v3No1 / 288
53amnon high in el salvador small village compared to lima shantytown in feces homo sapiens city 2017-01-21v4No1 / 296
78amnon high in male compared to female in feces tropical grassland biome kenya nanger granti gazelle 2017-03-01v4No1 / 301
723amnon high in age 2-4 years compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
209amnonhigher in whale blow condensate compared to ocean water ( high in respiratory airway megaptera novaeangliae humpback whale exhaled air condensate whale blow compared to ocean sea water depth 25cm in north america )2017-10-15v4No1 / 359
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in united states of america water drinking water tap water state of illinois )2018-05-28v4No1 / 365
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in feces homo sapiens )2018-11-18v4No1 / 378
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
438amnon high in adult age 30-50 age 60-79 compared to child age 3-6 age 8-12 in feces homo sapiens china 2018-12-30v4No1 / 486
671amnon high in state of oregon compared to state of california in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 534
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in feces homo sapiens child africa 2018-12-08v4No1 / 564
777amnon high in child age 18 months compared to infant age 3 months in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 583
384amnon high in saliva oral cavity mouth compared to nasal cavity pair of nares in farm equus caballus canada horse 2018-10-22v4No1 / 604
425amnon high in duodenum compared to feces in homo sapiens child africa 2018-12-08v4No1 / 622
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
671amnon high in age 8 months compared to age 3 months age 6 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 955

Problems / suggestions? Please email info AT dbbact DOT org