Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTTCCCAAGTCCCTCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGAAGGAAACTGGGAAGCTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT
common ontology terms
term enrichment score
TermScore
homo sapiens0.650076
adult0.447406
feces0.312286
saliva0.278584
child0.265487
dentition0.207792
united states of america0.198789
subgingival plaque0.159119
mouth0.146341
china0.141343
oral cavity0.115745
supragingival plaque0.105900
kingdom of spain0.099502
germany0.097680
control0.081775
state of new york0.081081
infant0.078652
supragingival dental plaque0.078431
city0.077519
obesity0.070423
oral wash0.069606
obsolete_juvenile stage0.062827
poland0.055556
canada0.052288
mouth mucosa0.051282
russia0.050360
state of nebraska0.050360
italy0.048409
brazil0.047098
female0.046332
state of california0.045752
obese body mass index status0.044118
subgingival dental plaque0.043956
toronto0.043956
age 6 years0.043478
age 8 years0.043478
age 9 years0.043478
age 11 years0.043478
age 10 years0.042553
age 7 years0.042553
hospital0.042254
periodontitis0.041958
duodenum0.041958
LOWER IN control0.039735
australia0.039216
LOWER IN infant0.036630
crohn's disease0.035842
municipality of beijing0.035842
diarrhea0.035211
age0.034453
jiangsu province0.033445
buccal mucosa0.029740
state of oklahoma0.029630
overweight body mass index status0.029630
age 2-4 years0.029630
puerto rico0.029412
africa0.029412
tongue0.029126
macaca mulatta0.028986
formula fed0.028986
finland0.028777
kingdom of denmark0.028777
united kingdom0.028571
sweden0.028436
low bmi0.028369
commonwealth of pennsylvania0.028369
LOWER IN feces0.028070
research facility0.027411
root canal0.022346
age 7-14 years0.022222
age 130.022222
city of dresden0.022222
milk allergy0.022222
age 4-10 years0.022222
age 10-15 years0.022222
istanbul0.022222
bolivia0.022222
age 60-790.022222
burmese0.022222
LOWER IN rural community0.022222
heterosexual0.022099
msw0.022099
dermal layer of tongue0.022099
sputum0.022099
wastewater treatment plant0.022099
sichuan province0.022059
shanghai proper0.021978
ulcerative colitis0.021978
age < 3 years0.021978
egypt0.021978
food allergy0.021978
turkey0.021978
hong kong0.021978
age 30-500.021978
asian0.021978
san diego0.021739
type 2 diabetes mellitus0.021739
age 2 years0.021739
state of colorado0.021739
age 20-30 years0.021739
Fraction of dbbact annotations with this term covered by the query
TermScore
subgingival plaque0.916667
buccal mucosa0.800000
supragingival plaque0.777778
mouth mucosa0.777778
saliva0.761905
obese body mass index status0.750000
dentition0.727273
state of oklahoma0.666667
overweight body mass index status0.666667
subgingival dental plaque0.666667
toronto0.666667
metabolic syndrome0.666667
root canal0.666667
age 5-13 years0.666667
age 5-10 years0.666667
supragingival dental plaque0.666667
age 2-4 years0.666667
tonsillitis0.666667
LOWER IN age &lt;1 year0.666667
central african republic0.666667
madagascar0.666667
child0.600000
mouth0.600000
oral cavity0.571429
LOWER IN infant0.555556
homo sapiens0.505929
induced periodontitis0.500000
puerto rico0.500000
municipality of logrono0.500000
age 200.500000
obesity0.500000
LOWER IN autism0.500000
age 7-14 years0.500000
russia0.500000
chengdu city prefecture0.500000
gestational age 8-12 weeks0.500000
pulpitis0.500000
periodontal pocket0.500000
age 130.500000
infrequent brushing0.500000
LOWER IN frequenct brushing0.500000
LOWER IN toothbrushing0.500000
cheyenne0.500000
native american0.500000
arapaho0.500000
salmonella gastroenteritis0.500000
age 50-70 years0.500000
city of dresden0.500000
age<17 years0.500000
inflammatory bowel disease0.500000
glasgow0.500000
spondyloarthritis0.500000
spondylitis0.500000
denver0.500000
metabolic syndrome x0.500000
liver carcinoma0.500000
induced sputum0.500000
LOWER IN oral wash0.500000
primary endodontic infection0.500000
root canal infection0.500000
gaz:000521000.500000
moscow0.500000
milk allergy0.500000
age 4-10 years0.500000
quito0.500000
age 10-15 years0.500000
LOWER IN age 5-10 years0.500000
istanbul0.500000
LOWER IN bronchus0.500000
LOWER IN bronchial epithelium0.500000
LOWER IN bronchial brush0.500000
LOWER IN mammalian milk beverage0.500000
LOWER IN aphthous stomatitis0.500000
tooth0.500000
tonsillectomy0.500000
recurrent tonsillitis0.500000
age one year0.500000
LOWER IN hard palate0.500000
LOWER IN dermal layer of tongue0.500000
LOWER IN buccal mucosa0.500000
state of nebraska0.500000
bolivia0.500000
autoimmune hepatitis0.500000
zhengzhou city prefecture0.500000
pancreatic cancer0.500000
esophagus0.500000
squamous esophagus0.500000
depth < 3mm0.500000
shallow pocket depth0.500000
LOWER IN switzerland0.500000
endurance athlete0.500000
common bottlenose dolphin0.500000
oropharynx0.500000
taipei city0.500000
braces0.500000
teeth braces0.500000
age 13-15 years0.500000
depth > 3mm0.500000
deep pocket depth0.500000
LOWER IN tooth disease0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.909091
adult0.473485
feces0.469697
united states of america0.265152
saliva0.170455
child0.170455
china0.151515
dentition0.121212
subgingival plaque0.087121
mouth0.083333
control0.071970
oral cavity0.064394
kingdom of spain0.056818
supragingival plaque0.056818
germany0.056818
city0.045455
infant0.045455
state of new york0.045455
supragingival dental plaque0.041667
obesity0.037879
oral wash0.037879
LOWER IN control0.034091
obsolete_juvenile stage0.034091
poland0.030303
female0.030303
canada0.030303
research facility0.026515
russia0.026515
brazil0.026515
italy0.026515
state of california0.026515
mouth mucosa0.026515
state of nebraska0.026515
periodontitis0.022727
obese body mass index status0.022727
australia0.022727
hospital0.022727
subgingival dental plaque0.022727
toronto0.022727
age 10 years0.022727
age 7 years0.022727
age 6 years0.022727
age 8 years0.022727
age 9 years0.022727
age 11 years0.022727
duodenum0.022727
diarrhea0.018939
crohn's disease0.018939
LOWER IN infant0.018939
jiangsu province0.018939
age0.018939
municipality of beijing0.018939
state of oklahoma0.015152
macaca mulatta0.015152
puerto rico0.015152
low bmi0.015152
finland0.015152
united kingdom0.015152
overweight body mass index status0.015152
commonwealth of pennsylvania0.015152
formula fed0.015152
tongue0.015152
buccal mucosa0.015152
age 2-4 years0.015152
kingdom of denmark0.015152
africa0.015152
sweden0.015152
LOWER IN feces0.015152
monkey0.011364
shanghai proper0.011364
age 7-14 years0.011364
san diego0.011364
juvenile organism0.011364
age 130.011364
high bmi0.011364
type 2 diabetes mellitus0.011364
city of dresden0.011364
ulcerative colitis0.011364
age 2 years0.011364
age < 3 years0.011364
french republic0.011364
state of colorado0.011364
heterosexual0.011364
msw0.011364
dermal layer of tongue0.011364
sputum0.011364
egypt0.011364
root canal0.011364
south korea0.011364
israel0.011364
food allergy0.011364
milk allergy0.011364
age 4-10 years0.011364
age 10-15 years0.011364
turkey0.011364
istanbul0.011364
age 20-30 years0.011364
hong kong0.011364
bolivia0.011364
state of michigan0.011364
Exp. ID User ID Description Date Region Flag Sequences
455amnonColonizes gut as well as saliva (other feces, homo sapiens, saliva)2019-11-25v4No1 / 2
276amnondominant feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 15
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in research facility dentition macaca mulatta child puerto rico subgingival plaque monkey age 1-7 years )2019-08-01v4No1 / 15
794amnondominant feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 16
663amnondominant feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 17
430amnondominant feces, homo sapiens, united states of america, city, adult, state of arizona, age 202018-12-15v4No1 / 18
663amnondominant feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 18
663amnondominant feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 18
555amnon high in control compared to autistic disorder autism in homo sapiens dentition child shanghai proper supragingival plaque age 7-14 years china 2019-09-10v3No1 / 19
574amnondominant feces, homo sapiens, adult, russia2020-01-05v3No1 / 19
637amnondominant feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 19
105amnondominant homo sapiens, dentition, brazil, mouth, pulpitis2017-04-05v4No1 / 20
162amnonhigh freq. in periodontal pocket in humans (dominant homo sapiens, united states of america, dentition, san diego, subgingival plaque, periodontal pocket, mouth)2017-07-13v4No1 / 20
197amnondominant feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 132017-09-12v4No1 / 20
203amnonlower in kids with frequent toothbrushing ( high in infrequent brushing compared to frequenct brushing toothbrushing in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth )2017-10-01v4No1 / 20
242amnonhigh freq. in native-americans (dominant feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 20
390amnondominant feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 20
663amnondominant feces, homo sapiens, obesity, adult, obese body mass index status, switzerland2020-09-22v4No1 / 20
122amnondominant feces, homo sapiens, united kingdom2017-04-13v4No1 / 21
247amnondominant feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 21
278amnondominant homo sapiens, united states of america, adult, state of california, subgingival plaque2018-01-23v4No1 / 21
320amnondominant feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 21
390amnondominant feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 21
814amnondominant feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 21
703amnondominant homo sapiens, dentition, adult, germany, subgingival plaque, subgingival dental plaque, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 21
284amnondominant feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 22
297amnondominant feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 22
395amnondominant feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
797amnondominant feces, homo sapiens, child, germany, formula fed, age 2 years2021-06-13v3No1 / 22
10amnondominant feces, homo sapiens, toronto2016-10-27v4No1 / 23
73amnondominant feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 23
132amnondominant feces, homo sapiens, united states of america2017-04-16v4No1 / 23
241amnonhigh freq. in babies age < 3 years in russia (dominant feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 23
303amnondominant feces, homo sapiens, adult, germany2018-03-12v4No1 / 23
312amnondominant feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 23
344amnonhigh freq. in feces of heterosexuals (dominant feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 23
487amnondominant feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 23
572amnon high in liver carcinoma compared to control in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 23
666amnondominant feces, homo sapiens, italy2020-09-25v3No1 / 23
354amnon high in sputum induced sputum compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 24
395amnondominant feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 24
554amnondominant homo sapiens, dentition, adult, egypt, root canal, primary endodontic infection, root canal infection2019-09-10v3No1 / 24
290amnondominant feces, homo sapiens, city, adult, china2018-02-01v4No1 / 25
721amnondominant feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 25
104amnondominant homo sapiens, dentition, russia, moscow, subgingival plaque, mouth2017-04-05v4No1 / 27
131amnondominant feces, homo sapiens, south korea2017-04-16v4No1 / 27
399amnon high in crohn's disease compared to control in feces homo sapiens united states of america 2018-11-16v4No1 / 27
695amnondominant feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 27
562amnondominant feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 28
704amnonpositively correlated with age ( high in age 10-15 years compared to age 5-10 years in homo sapiens saliva child turkey istanbul )2028-04-02v3No1 / 28
320amnoncommon feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 30
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 31
292amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens adult china 2018-02-05v4No1 / 32
354amnon high in sputum induced sputum compared to bronchus bronchial epithelium bronchial brush in homo sapiens united states of america adult 2018-07-30v4No1 / 32
24amnondisappears on transition to cow milk ( high in breast milk compared to mammalian milk beverage in feces homo sapiens infant )2016-12-01v4No1 / 35
576amnon high in control compared to aphthous stomatitis in homo sapiens mouth mucosa adult czech republic buccal mucosa 2020-01-09v3No1 / 35
679amnoncommon homo sapiens, saliva, fasting, child, south korea, age 5-10 years2028-03-02v3No1 / 38
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
806amnoncommon homo sapiens, united states of america, mouth mucosa, adult, state of new york, buccal mucosa2021-06-19v3No1 / 40
806amnoncommon homo sapiens, united states of america, dentition, adult, state of new york, supragingival plaque, supragingival dental plaque2021-06-19v3No1 / 41
95amnoncommon in root canal (common homo sapiens, tooth, brazil, root canal)2017-03-12v4No1 / 42
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, age 2-4 years2019-11-18v3No1 / 42
241amnoncommon in babies age < 3 years in russia (common feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 44
773amnoncommon homo sapiens, adult, palatine tonsil, tonsillitis, japan, tonsillectomy, recurrent tonsillitis2021-04-23v4No1 / 45
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one year2018-01-14v4No1 / 46
797amnoncommon feces, homo sapiens, child, germany, formula fed, age 2 years2021-06-13v3No1 / 46
806amnon high in oral cavity oral wash compared to hard palate in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 48
564amnoncommon feces, homo sapiens, control, child, italy, age 2-4 years2019-11-18v3No1 / 50
773amnoncommon homo sapiens, adult, palatine tonsil, iga glomerulonephritis, japan, tonsillectomy2021-04-23v4No1 / 54
390amnoncommon feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 55
814amnoncommon feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 55
653amnon high in saliva compared to tongue dermal layer of tongue in homo sapiens adult toronto canada age 20-30 years 2020-09-13v3No1 / 55
774amnon high in control compared to tonsillitis in homo sapiens saliva oral cavity adult hong kong oral wash 2021-04-24v3No1 / 55
806amnon high in oral cavity oral wash compared to mouth mucosa buccal mucosa in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 57
563amnon high in control compared to hiv infection in feces homo sapiens united states of america male homosexual msm rectal swab 2019-11-18v4No1 / 58
260amnoncommon homo sapiens, united states of america, dentition, state of nebraska, subgingival plaque, mouth2017-12-05v4No1 / 59
32amnon high in adult compared to infant in homo sapiens saliva bolivia 2016-12-05v4No1 / 60
630amnon high in female compared to male in feces homo sapiens adult kingdom of spain madrid 2020-05-31v3No1 / 63
272amnoncommon in subgingival plaque in south korea (common homo sapiens, dentition, subgingival plaque, mouth, south korea)2018-01-10v4No1 / 65
720amnon high in autoimmune hepatitis compared to control in feces homo sapiens adult china zhengzhou city prefecture 2028-05-23v3No1 / 65
572amnon high in pancreatic cancer compared to control in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 66
162amnoncommon in periodontal pocket in humans (common homo sapiens, united states of america, dentition, san diego, subgingival plaque, periodontal pocket, mouth)2017-07-13v4No1 / 67
690amnoncommon in squamous esophagos samples from patients undergoing endoscopy (common homo sapiens, united states of america, hospital, esophagus, new york city, esophageal disease, squamous esophagus)2028-03-11v4No1 / 68
378amnoncommon homo sapiens, control, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth2018-09-14v4No1 / 69
663amnon high in poland compared to switzerland in feces homo sapiens adult 2020-09-22v4No1 / 72
634amnoncommon homo sapiens, saliva, adult, germany, high physical activity, endurance athlete2020-06-16v3No1 / 74
774amnoncommon homo sapiens, saliva, oral cavity, adult, hong kong, oral wash, tonsillitis2021-04-24v3No1 / 74
395amnoncommon feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 75
666amnoncommon feces, tursiops truncatus, italy, rectal swab, common bottlenose dolphin2020-09-25v3No1 / 76
54amnoncommon homo sapiens, united states of america, saliva2017-01-23v4No1 / 77
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 77
731amnoncommon in orophringeal otic secretion drainage (common homo sapiens, united states of america, oropharynx, adult, state of michigan)2021-01-09v4No1 / 77
529amnoncommon feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 79
598amnonhigher in mouthwash of kids with braces compared to no braces ( high in braces teeth braces compared to control in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years )2020-03-25v3No1 / 79
378amnoncommon homo sapiens, dentition, adult, brazil, subgingival plaque, depth > 3mm, deep pocket depth, mouth, periodontitis2018-09-14v4No1 / 80
3amnoncommon homo sapiens, tongue, china2016-10-06v4No1 / 81
678amnon high in control compared to tooth disease black dental staining in homo sapiens adult kingdom of spain supragingival plaque supragingival dental plaque 2028-03-02v3No1 / 81
658amnoncommon homo sapiens, united states of america, dentition, caucasian, child, state of nebraska, supragingival plaque, age 10 years, supragingival dental plaque, european, age 7 years, age 6 years, age 8 years, age 9 years, age 11 years2020-09-17v3No1 / 82
716amnoncommon homo sapiens, tongue, adult, dermal layer of tongue, china, halitosis, chronic bad breath2028-05-22v3No1 / 82
378amnoncommon homo sapiens, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth, periodontitis2018-09-14v4No1 / 84
663amnoncommon homo sapiens, lung, bronchoalveolar lavage, adult, poland2020-09-22v4No1 / 84
770amnon high in age 10-15 years adult organism compared to infant age <1 year in oral cavity mouth mucosa macaca mulatta cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 84
731amnoncommon homo sapiens, united states of america, mouth mucosa, adult, state of michigan, buccal mucosa2021-01-09v4No1 / 85
802amnoncommon homo sapiens, united states of america, saliva, adult, state of new york, cornell university2021-06-16v4No1 / 85
162amnoncommon in supragingival plaque in humans (common homo sapiens, united states of america, dentition, san diego, supragingival plaque, mouth)2017-07-13v4No1 / 86
806amnoncommon homo sapiens, united states of america, oral cavity, adult, state of new york, oral wash, mouth2021-06-19v3No1 / 86
319amnoncommon homo sapiens, united states of america, saliva, state of texas2018-04-18v4No1 / 87
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, age 202018-12-15v4No1 / 87
806amnon high in oral cavity oral wash compared to palatine tonsil in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 87
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
805amnoncommon homo sapiens, sputum, adult, united kingdom, city of london2021-06-18v3No1 / 88
703amnoncommon homo sapiens, dentition, adult, germany, subgingival plaque, subgingival dental plaque, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 89
715amnoncommon homo sapiens, esophagus, adult, australia, oesophageal brush2028-05-22v4No1 / 92
774amnoncommon homo sapiens, control, saliva, oral cavity, adult, hong kong, oral wash2021-04-24v3No1 / 92
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
658amnoncommon homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, age 10 years, supragingival dental plaque, hispanic or latin american, age 7 years, age 6 years, age 8 years, age 9 years, age 11 years, hispanic2020-09-17v3No1 / 93
348amnoncommon homo sapiens, saliva, adult, italy2018-07-16v4No1 / 94
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
723amnonhigher in children age 2-4 years compared to mothers ( high in child age 2-4 years compared to adult in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 95
278amnoncommon homo sapiens, united states of america, adult, state of california, subgingival plaque2018-01-23v4No1 / 96
555amnoncommon homo sapiens, saliva, child, shanghai proper, age 7-14 years, china2019-09-10v3No1 / 96
678amnoncommon homo sapiens, adult, kingdom of spain, supragingival plaque, supragingival dental plaque, tooth disease, black dental staining2028-03-02v3No1 / 96
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
658amnoncommon homo sapiens, united states of america, dentition, african american, child, state of nebraska, supragingival plaque, age 10 years, supragingival dental plaque, age 7 years, age 6 years, age 8 years, age 9 years, age 11 years2020-09-17v3No1 / 98
105amnoncommon homo sapiens, dentition, brazil, mouth, pulpitis2017-04-05v4No1 / 100
202amnoncommon homo sapiens, oral cavity, mouth mucosa, mouth, china2017-10-01v4No1 / 100
455amnoncommon homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 100
804amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens child africa central african republic madagascar age 2-5 years 2021-06-18v4No1 / 100
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 102
554amnoncommon homo sapiens, dentition, adult, egypt, root canal, primary endodontic infection, root canal infection2019-09-10v3No1 / 102
493amnoncommon homo sapiens, united states of america, saliva, adult, state of new york2019-02-27v4No1 / 104
519amnoncommon homo sapiens, city, dentition, late adult stage, adult, supragingival plaque, china2019-06-25v3No1 / 104
704amnoncommon homo sapiens, saliva, child, age 10-15 years, turkey, istanbul2028-04-02v3No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 106
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china2018-12-30v4No1 / 106
663amnoncommon homo sapiens, adult, poland, oral wash, mouth2020-09-22v4No1 / 106
712amnoncommon homo sapiens, saliva, adult, russia, kazan2028-05-21v3No1 / 106
797amnon high in age 1 year compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
806amnoncommon homo sapiens, united states of america, saliva, adult, state of new york2021-06-19v3No1 / 106
273amnon high in age age one month compared to age one week in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 107
695amnon high in milk allergy compared to sesame allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 107
704amnoncommon homo sapiens, saliva, child, turkey, istanbul, age 5-10 years2028-04-02v3No1 / 107
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china2018-12-30v4No1 / 109
524amnoncommon homo sapiens, saliva, adult, sichuan province, china2019-07-06v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 60-79, china2018-12-30v4No1 / 111
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
555amnoncommon homo sapiens, dentition, child, shanghai proper, supragingival plaque, age 7-14 years, china2019-09-10v3No1 / 112
594amnoncommon homo sapiens, saliva, adult, cameroon2020-03-12v4No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 30-50, china2018-12-30v4No1 / 115
691amnon high in spring compared to summer in water drinking water french republic commune of paris 2028-03-11v3No1 / 115
703amnoncommon homo sapiens, saliva, adult, germany, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 115
32amnoncommon homo sapiens, saliva, adult, bolivia2016-12-05v4No1 / 116
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
640amnoncommon homo sapiens, female, saliva, adult, china, shanghai district2020-08-22v4No1 / 117
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
658amnon high in asian burmese compared to hispanic or latin american hispanic in homo sapiens united states of america dentition child state of nebraska supragingival plaque age 10 years supragingival dental plaque age 7 years age 6 years age 8 years age 9 years age 11 years 2020-09-17v3No1 / 118
212amnoncommon feces, control, united states of america, research facility, mus musculus, lean body mass, mouse2017-10-22v4No1 / 120
777amnon high in age 5 years compared to age 3 years in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
636amnon high in oropharynx oropharyngeal swab compared to tracheal aspirate trachea endotracheal aspirate in homo sapiens united states of america hospital adult commonwealth of pennsylvania acute respiratory failure respiratory failure 2020-08-08v4No1 / 122
425amnoncommon homo sapiens, duodenum, child, africa, madagascar, antananarivo2018-12-08v4No1 / 123
598amnoncommon homo sapiens, saliva, oral cavity, child, kingdom of spain, age 13-15 years2020-03-25v3No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in feces homo sapiens toronto )2016-10-27v4No1 / 125
425amnoncommon homo sapiens, duodenum, child, africa, central african republic, bangui, stunted growth2018-12-08v4No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to rectum biopsy site biopsy in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 126
806amnon high in dorsum of tongue compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 126
75amnoncommon homo sapiens, saliva, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 129
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in cloaca anas platyrhynchos state of california mallard )2017-03-05v4No1 / 131
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
526amnon high in cholelithiasis compared to control in homo sapiens bile gallbladder adult kingdom of spain 2019-07-14v3No1 / 131
39amnoncommon in obese lepr-db mice (common feces, research facility, mus musculus, obesity)2016-12-09v4No1 / 132
246amnoncommon homo sapiens, saliva, italy2017-11-21v4No1 / 133
278amnoncommon homo sapiens, united states of america, saliva, adult, state of california2018-01-23v4No1 / 133
711amnon high in adult compared to child age 8-12 years in homo sapiens united states of america oral cavity state of colorado mouth 2028-05-21v4No1 / 133
775amnoncommon homo sapiens, saliva, adult, china, jinan city prefecture2021-04-24v4No1 / 133
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
519amnoncommon homo sapiens, city, saliva, late adult stage, adult, china2019-06-25v3No1 / 134
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 132017-09-12v4No1 / 136
725amnoncommon homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 136
212amnoncommon feces, united states of america, research facility, mus musculus, obese body mass index status, mouse, db/db mouse, obesity2017-10-22v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens juvenile organism obsolete_juvenile stage age 13 2017-09-12v4No1 / 138
797amnon high in child age 2 years compared to infant age 1 year in feces homo sapiens germany formula fed 2021-06-13v3No1 / 139
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in feces homo sapiens united states of america )2017-04-12v4No1 / 141
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in wastewater treatment plant sewer compared to feces in city south america low income )2017-01-21v4No1 / 148
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in feces homo sapiens united states of america )2017-02-27v4No1 / 149
278amnon high in subgingival plaque compared to saliva in homo sapiens united states of america adult state of california 2018-01-23v4No1 / 149
64amnoncommon homo sapiens, saliva, sichuan province2017-02-16v4No1 / 152
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, bile, gallbladder, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
725amnoncommon homo sapiens, control, adult, subgingival plaque, subgingival dental plaque, china, municipality of beijing2021-01-03v3No1 / 156
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
658amnoncommon homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, age 10 years, supragingival dental plaque, asian, age 7 years, age 6 years, age 8 years, age 9 years, age 11 years, burmese2020-09-17v3No1 / 157
96amnoncommon homo sapiens, brazil, subgingival plaque, mouth2017-03-29v4No1 / 158
678amnoncommon homo sapiens, control, adult, kingdom of spain, supragingival plaque, supragingival dental plaque2028-03-02v3No1 / 160
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 162
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 162
652amnoncommon homo sapiens, saliva, adult, sichuan province, china2020-09-13v3No1 / 166
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in feces homo sapiens infant )2017-11-13v4No1 / 173
806amnon high in oral cavity oral wash compared to pair of nares external naris in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 178
299amnoncommon in healthy (non-tumor) controls (common homo sapiens, control, saliva, adult, china)2018-02-27v4No1 / 179
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
299amnoncommon homo sapiens, saliva, adult, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in feces homo sapiens china )2018-12-30v4No1 / 203
653amnon high in dentition supragingival plaque supragingival dental plaque compared to tongue dermal layer of tongue in homo sapiens adult toronto canada age 20-30 years 2020-09-13v3No1 / 205
725amnoncommon homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, chronic periodontitis, china, municipality of beijing2021-01-03v3No1 / 206
542amnoncommon research facility, dentition, adult, macaca mulatta, puerto rico, subgingival plaque, monkey, age 12-23 years2019-08-01v4No1 / 208
669amnon high in age 1 year compared to age 2 months in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
658amnon high in asian burmese compared to caucasian european in homo sapiens united states of america dentition child state of nebraska supragingival plaque age 10 years supragingival dental plaque age 7 years age 6 years age 8 years age 9 years age 11 years 2020-09-17v3No1 / 212
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 220
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
104amnoncommon homo sapiens, dentition, russia, moscow, subgingival plaque, mouth2017-04-05v4No1 / 227
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens female adult china shanghai district 2020-08-22v4No1 / 232
598amnonlower in mouthwash of students compared to teachers ( high in adult compared to child age 13-15 years in homo sapiens saliva oral cavity kingdom of spain )2020-03-25v3No1 / 232
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, age 50-60 years, nephrolithiasis, china)2018-01-27v4No1 / 239
725amnoncommon homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 240
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 242
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in feces homo sapiens infant india )2016-12-19v4No1 / 253
438amnon high in child age 3-6 age 8-12 compared to adult age 30-50 age 60-79 in feces homo sapiens china 2018-12-30v4No1 / 279
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, age 50-60 years, china)2018-01-27v4No1 / 281
384amnon high in hay barn compared to pasture in farm saliva equus caballus canada horse mouth 2018-10-22v4No1 / 283
806amnon high in oral cavity oral wash compared to gingiva keratinized gingiva in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 288
653amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens adult toronto canada age 20-30 years 2020-09-13v3No1 / 291
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
723amnon high in age 2-4 years compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 306
510amnoncommon estuary, water, fresh water, kingdom of spain, estuary water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
542amnon high in adult age 12-23 years compared to child age 1-7 years in research facility dentition macaca mulatta puerto rico subgingival plaque monkey 2019-08-01v4No1 / 337
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
565amnoncommon zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 368
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 400
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
725amnon high in subgingival plaque subgingival dental plaque compared to mouth mucosa buccal mucosa in homo sapiens adult china municipality of beijing 2021-01-03v3No1 / 544
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
777amnon high in child age 18 months compared to infant age 3 months in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 583
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592
384amnon high in saliva oral cavity mouth compared to nasal cavity pair of nares in farm equus caballus canada horse 2018-10-22v4No1 / 604
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in feces homo sapiens china )2018-12-30v4No1 / 617
425amnon high in duodenum compared to feces in homo sapiens child africa 2018-12-08v4No1 / 622
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic)2017-11-22v4No1 / 1081
252amnoncommon in river sand biofilm (common river, biofilm, sand, kingdom of spain)2017-11-22v4No1 / 1181

Problems / suggestions? Please email info AT dbbact DOT org