Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCGCGCAGGCGGCTTCTTAAGTCTGTCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGATGGAAACTGGGAAGCTCAGAGTATCGGAGAGGAAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.506450
saliva0.451773
adult0.348813
child0.196429
infant0.164179
mouth0.160000
china0.128829
state of new york0.128205
united states of america0.122511
feces0.121457
LOWER IN dentition0.118756
lung0.113924
oral cavity0.098522
bronchial epithelium0.094118
oral wash0.091954
mouth mucosa0.091743
tongue0.090909
LOWER IN supragingival plaque0.081522
sputum0.081356
LOWER IN control0.077922
germany0.077670
palatine tonsil0.067416
sweden0.067039
bolivia0.066667
bronchoalveolar lavage0.065934
crohn's disease0.065789
age 1 year0.063830
czech republic0.063492
state of california0.058824
LOWER IN supragingival dental plaque0.055046
atlanta0.054795
municipality of umea0.054054
obsolete_juvenile stage0.052174
hospital0.052174
africa0.051282
state of michigan0.050633
duodenum0.049383
australia0.047619
canada0.043956
bronchus0.041522
age 5-10 years0.041522
buccal mucosa0.041379
uganda0.041096
pneumonia0.041096
india0.040541
age 3 months0.039867
amsterdam0.039474
belgium0.039474
diarrhea0.039474
LOWER IN child0.039474
subgingival plaque0.039474
nasopharynx0.038710
rural community0.038710
poland0.037975
italy0.037975
LOWER IN feces0.037267
control0.037175
LOWER IN adult0.036810
female0.036145
hiv infection0.035294
LOWER IN mouth neoplasm0.027972
LOWER IN cancer0.027972
LOWER IN breast milk0.027972
formula fed0.027972
breast fed0.027778
age<17 years0.027778
atherosclerosis0.027778
LOWER IN aphthous stomatitis0.027778
LOWER IN subgingival plaque0.027778
city of dresden0.027778
tonsillectomy0.027778
esophagus0.027778
oropharynx0.027778
LOWER IN age 18 months0.027778
istanbul0.027778
stunted growth0.027778
late adult stage0.027778
chuquisaca department0.027778
age 60-790.027778
dermal layer of tongue0.027586
cameroon0.027397
city of london0.027397
LOWER IN mouth mucosa0.027397
turkey0.027397
shanghai district0.027397
age 5-13 years0.027397
age 30-500.027397
toronto0.027397
kingdom of denmark0.027211
trachea0.027027
vancouver0.027027
type 2 diabetes mellitus0.027027
sichuan province0.027027
age 20-30 years0.027027
ulcerative colitis0.026846
tonsil0.026667
fasting0.026667
clostridium difficile intestinal infectious disease0.026316
stomach0.025641
brazil0.025157
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN supragingival plaque0.833333
sputum0.800000
bronchial epithelium0.800000
LOWER IN dentition0.777778
LOWER IN supragingival dental plaque0.750000
saliva0.690476
LOWER IN mouth neoplasm0.666667
LOWER IN cancer0.666667
bronchus0.666667
LOWER IN breast milk0.666667
atlanta0.666667
formula fed0.666667
age 5-10 years0.666667
state of new york0.625000
buccal mucosa0.600000
palatine tonsil0.600000
oral wash0.571429
mouth mucosa0.555556
LOWER IN neoplasm0.500000
breast fed0.500000
LOWER IN formula fed0.500000
LOWER IN age 7 months0.500000
lung0.500000
severe0.500000
LOWER IN mild0.500000
chronic rhinosinusitis0.500000
LOWER IN age 30-400.500000
oslo0.500000
mammalian milk beverage0.500000
age<17 years0.500000
atherosclerosis0.500000
LOWER IN aphthous stomatitis0.500000
tongue0.500000
idiopathic pulmonary fibrosis0.500000
uganda0.500000
pneumonia0.500000
mild disease course0.500000
state of new hampshire0.500000
ceftriaxone0.500000
LOWER IN no ceftriaxone0.500000
cheek0.500000
LOWER IN anterior naris0.500000
LOWER IN subgingival plaque0.500000
city of dresden0.500000
tonsillectomy0.500000
recurrent tonsillitis0.500000
bolivia0.500000
acute pancreatitis0.500000
pancreatitis0.500000
short bowel syndrome0.500000
induced sputum0.500000
milan0.500000
LOWER IN cheek0.500000
bronchial brush0.500000
autoimmune hepatitis0.500000
zhengzhou city prefecture0.500000
esophagus0.500000
squamous esophagus0.500000
endurance athlete0.500000
oropharynx0.500000
LOWER IN age 18 months0.500000
municipality of umea0.500000
cornell university0.500000
oesophageal brush0.500000
pulpitis0.500000
istanbul0.500000
kazan0.500000
stunted growth0.500000
hypopharynx0.500000
oropharyngeal swab0.500000
LOWER IN tracheal aspirate0.500000
LOWER IN trachea0.500000
LOWER IN endotracheal aspirate0.500000
acute respiratory failure0.500000
antananarivo0.500000
age 13-15 years0.500000
bangui0.500000
dorsum of tongue0.500000
LOWER IN influenza0.500000
mallard0.500000
LOWER IN age 8-12 years0.500000
jinan city prefecture0.500000
late adult stage0.500000
hmong0.500000
LOWER IN myanmar0.500000
LOWER IN karen0.500000
LOWER IN russia0.500000
bangladesh0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
chuquisaca department0.500000
glasgow0.500000
age 130.500000
spondyloarthritis0.500000
spondylitis0.500000
age 60-790.500000
LOWER IN age &gt;940.500000
age 7-14 years0.500000
gastric carcinoma0.500000
stomach neoplasm0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.992857
adult0.507143
saliva0.335714
united states of america0.228571
feces0.214286
china0.164286
child0.142857
mouth0.100000
infant0.100000
LOWER IN control0.085714
state of new york0.071429
lung0.064286
LOWER IN dentition0.064286
oral cavity0.057143
control0.050000
mouth mucosa0.050000
germany0.050000
oral wash0.050000
bronchial epithelium0.050000
tongue0.050000
sweden0.042857
sputum0.042857
LOWER IN supragingival plaque0.042857
age 1 year0.035714
crohn's disease0.035714
czech republic0.035714
bronchoalveolar lavage0.035714
state of california0.035714
palatine tonsil0.035714
bolivia0.035714
state of michigan0.028571
atlanta0.028571
obsolete_juvenile stage0.028571
canada0.028571
hospital0.028571
australia0.028571
female0.028571
LOWER IN supragingival dental plaque0.028571
municipality of umea0.028571
africa0.028571
duodenum0.028571
amsterdam0.021429
bronchus0.021429
nasopharynx0.021429
belgium0.021429
poland0.021429
LOWER IN adult0.021429
diarrhea0.021429
hiv infection0.021429
uganda0.021429
pneumonia0.021429
buccal mucosa0.021429
age 5-10 years0.021429
india0.021429
LOWER IN child0.021429
italy0.021429
age 3 months0.021429
rural community0.021429
subgingival plaque0.021429
LOWER IN feces0.021429
LOWER IN mouth neoplasm0.014286
LOWER IN cancer0.014286
breast fed0.014286
trachea0.014286
ulcerative colitis0.014286
cameroon0.014286
united kingdom0.014286
city of london0.014286
LOWER IN breast milk0.014286
vancouver0.014286
age<17 years0.014286
atherosclerosis0.014286
LOWER IN aphthous stomatitis0.014286
clostridium difficile intestinal infectious disease0.014286
formula fed0.014286
tonsil0.014286
fasting0.014286
south korea0.014286
LOWER IN subgingival plaque0.014286
type 2 diabetes mellitus0.014286
city of dresden0.014286
japan0.014286
tonsillectomy0.014286
LOWER IN mouth mucosa0.014286
dermal layer of tongue0.014286
esophagus0.014286
oropharynx0.014286
LOWER IN age 18 months0.014286
dentition0.014286
brazil0.014286
turkey0.014286
istanbul0.014286
sichuan province0.014286
stomach0.014286
stunted growth0.014286
age0.014286
kingdom of denmark0.014286
shanghai district0.014286
city0.014286
late adult stage0.014286
Exp. ID User ID Description Date Region Flag Sequences
66amnon high in male compared to female in homo sapiens saliva adult amsterdam 2017-02-18v4No1 / 3
202amnon high in control compared to neoplasm mouth neoplasm cancer in homo sapiens oral cavity mouth mucosa mouth china 2017-10-01v4No1 / 6
797amnon high in breast fed compared to formula fed in feces homo sapiens infant germany age 1 year 2021-06-13v3No1 / 12
779amnon high in crohn's disease compared to control in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 15
797amnon high in age 1 year compared to age 7 months in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 15
596amnon high in age 6 months compared to age 3 months in homo sapiens saliva child sweden 2020-03-18v3No1 / 15
87amnondominant homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v4No1 / 17
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in feces homo sapiens united states of america child )2018-11-22v4No1 / 18
567amnon high in chronic rhinosinusitis sinusitis compared to control in homo sapiens nasopharynx adult belgium 2019-12-05v4No1 / 18
663amnondominant homo sapiens, adult, poland, oral wash, mouth2020-09-22v4No1 / 18
66amnondominant homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 19
330amnon high in infant age 1 year compared to adult age 30-40 in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 19
594amnondominant homo sapiens, saliva, adult, cameroon2020-03-12v4No1 / 20
805amnon high in nicotine dependence smoker cigarette smoking compared to non-smoker in homo sapiens sputum adult united kingdom city of london 2021-06-18v3No1 / 20
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in feces homo sapiens infant )2016-12-01v4No1 / 21
33amnondominant homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 21
87amnoncommon homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v4No1 / 22
297amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years 2018-02-12v4No1 / 22
455amnondominant homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 22
576amnon high in control compared to aphthous stomatitis in homo sapiens tongue adult czech republic 2020-01-09v3No1 / 23
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in feces homo sapiens hospital australia diarrhea )2018-11-04v4No1 / 24
469amnoncommon homo sapiens, united states of america, lung, bronchoalveolar lavage, adult, state of new york, idiopathic pulmonary fibrosis2019-01-14v4No1 / 24
258amnonhigh freq. in lungs of hiv patients with pneumonia (dominant homo sapiens, lung, bronchoalveolar lavage, hiv infection, bronchial epithelium, uganda, pneumonia)2017-11-27v4No1 / 25
399amnon high in crohn's disease compared to control in feces homo sapiens united states of america 2018-11-16v4No1 / 27
3amnondominant homo sapiens, tongue, china2016-10-06v4No1 / 30
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 31
646amnoncommon homo sapiens, sputum, united states of america, cystic fibrosis, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 33
258amnonhigher lungs of hiv pneumonia patients treated with ceftriaxone ( high in ceftriaxone compared to no ceftriaxone in homo sapiens lung bronchoalveolar lavage hiv infection bronchial epithelium uganda pneumonia )2017-11-27v4No1 / 35
284amnon high in age 1 year compared to age 2 months in feces homo sapiens female infant state of california 2018-01-27v4No1 / 35
576amnon high in control compared to aphthous stomatitis in homo sapiens mouth mucosa adult czech republic buccal mucosa 2020-01-09v3No1 / 35
102amnonlower in teeth compared to cheeks, saliva ( high in saliva cheek compared to dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 37
227amnonhigher in nasopharynx of formula fed babies compared to breast fed ( high in diet formula fed compared to breast milk breast fed in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-11-03v4No1 / 38
567amnon high in nasopharynx compared to pair of nares anterior naris in homo sapiens adult belgium 2019-12-05v4No1 / 38
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
806amnoncommon homo sapiens, united states of america, mouth mucosa, adult, state of new york, buccal mucosa2021-06-19v3No1 / 40
679amnon high in tonsil palatine tonsil compared to saliva in homo sapiens fasting child south korea age 5-10 years 2028-03-02v3No1 / 41
703amnon high in saliva compared to dentition subgingival plaque subgingival dental plaque in homo sapiens adult germany type 2 diabetes mellitus city of dresden 2028-04-02v3No1 / 44
773amnoncommon homo sapiens, adult, palatine tonsil, tonsillitis, japan, tonsillectomy, recurrent tonsillitis2021-04-23v4No1 / 45
32amnoncommon homo sapiens, saliva, infant, bolivia2016-12-05v4No1 / 46
428amnon high in acute pancreatitis pancreatitis compared to control in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 46
806amnoncommon homo sapiens, united states of america, adult, state of new york, palatine tonsil2021-06-19v3No1 / 48
258amnoncommon in lungs of hiv patients with pneumonia (common homo sapiens, lung, bronchoalveolar lavage, hiv infection, bronchial epithelium, uganda, pneumonia)2017-11-27v4No1 / 49
339amnon high in infant age < 1 year compared to adult in feces homo sapiens india 2018-05-24v4No1 / 50
576amnon high in tongue compared to mouth mucosa in homo sapiens adult czech republic 2020-01-09v3No1 / 50
335amnoncommon in mouthwash (common homo sapiens, united states of america, oral cavity, oral wash, mouth)2018-05-16v4No1 / 52
354amnoncommon homo sapiens, united states of america, saliva, adult, oral wash2018-07-30v4No1 / 52
797amnon high in infant age 1 year compared to child age 2 years in feces homo sapiens germany formula fed 2021-06-13v3No1 / 52
773amnoncommon homo sapiens, adult, palatine tonsil, iga glomerulonephritis, japan, tonsillectomy2021-04-23v4No1 / 54
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in antibiotic vancomycin metronidazole neomycin compared to control in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 55
532amnon high in short bowel syndrome compared to control in feces homo sapiens adult czech republic 2019-07-21v1No1 / 57
806amnon high in oral cavity oral wash compared to dentition supragingival plaque supragingival dental plaque in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 58
32amnon high in adult compared to infant in homo sapiens saliva bolivia 2016-12-05v4No1 / 60
335amnoncommon homo sapiens, united states of america, bronchial epithelium2018-05-16v4No1 / 61
354amnoncommon homo sapiens, sputum, united states of america, adult, induced sputum2018-07-30v4No1 / 63
726amnoncommon homo sapiens, tongue, adult, italy, dermal layer of tongue, milan2021-01-03v3No1 / 63
679amnoncommon homo sapiens, tonsil, fasting, child, palatine tonsil, south korea, age 5-10 years2028-03-02v3No1 / 64
102amnonhigher in saliva compared to teeth, cheek ( high in saliva compared to cheek dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 65
354amnoncommon homo sapiens, united states of america, bronchus, bronchial epithelium, adult, bronchial brush2018-07-30v4No1 / 65
720amnon high in autoimmune hepatitis compared to control in feces homo sapiens adult china zhengzhou city prefecture 2028-05-23v3No1 / 65
576amnoncommon homo sapiens, tongue, adult, czech republic2020-01-09v3No1 / 67
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
690amnoncommon in squamous esophagos samples from patients undergoing endoscopy (common homo sapiens, united states of america, hospital, esophagus, new york city, esophageal disease, squamous esophagus)2028-03-11v4No1 / 68
634amnoncommon homo sapiens, saliva, adult, germany, high physical activity, endurance athlete2020-06-16v3No1 / 74
299amnon high in control compared to mouth neoplasm cancer in homo sapiens saliva adult china 2018-02-27v4No1 / 75
663amnon high in switzerland compared to poland in feces homo sapiens adult 2020-09-22v4No1 / 76
54amnoncommon homo sapiens, united states of america, saliva2017-01-23v4No1 / 77
731amnoncommon in orophringeal otic secretion drainage (common homo sapiens, united states of america, oropharynx, adult, state of michigan)2021-01-09v4No1 / 77
777amnon high in infant age 3 months compared to child age 18 months in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 79
3amnoncommon homo sapiens, tongue, china2016-10-06v4No1 / 81
663amnoncommon homo sapiens, lung, bronchoalveolar lavage, adult, poland2020-09-22v4No1 / 84
731amnoncommon homo sapiens, united states of america, mouth mucosa, adult, state of michigan, buccal mucosa2021-01-09v4No1 / 85
802amnoncommon homo sapiens, united states of america, saliva, adult, state of new york, cornell university2021-06-16v4No1 / 85
806amnoncommon homo sapiens, united states of america, oral cavity, adult, state of new york, oral wash, mouth2021-06-19v3No1 / 86
319amnoncommon homo sapiens, united states of america, saliva, state of texas2018-04-18v4No1 / 87
805amnoncommon homo sapiens, sputum, adult, united kingdom, city of london2021-06-18v3No1 / 88
715amnoncommon homo sapiens, esophagus, adult, australia, oesophageal brush2028-05-22v4No1 / 92
348amnoncommon homo sapiens, saliva, adult, italy2018-07-16v4No1 / 94
105amnoncommon homo sapiens, dentition, brazil, mouth, pulpitis2017-04-05v4No1 / 100
202amnoncommon homo sapiens, oral cavity, mouth mucosa, mouth, china2017-10-01v4No1 / 100
455amnoncommon homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 100
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 102
493amnoncommon homo sapiens, united states of america, saliva, adult, state of new york2019-02-27v4No1 / 104
704amnoncommon homo sapiens, saliva, child, age 10-15 years, turkey, istanbul2028-04-02v3No1 / 105
663amnoncommon homo sapiens, adult, poland, oral wash, mouth2020-09-22v4No1 / 106
712amnoncommon homo sapiens, saliva, adult, russia, kazan2028-05-21v3No1 / 106
704amnoncommon homo sapiens, saliva, child, turkey, istanbul, age 5-10 years2028-04-02v3No1 / 107
524amnoncommon homo sapiens, saliva, adult, sichuan province, china2019-07-06v4No1 / 109
425amnoncommon homo sapiens, stomach, child, africa, stunted growth2018-12-08v4No1 / 111
594amnoncommon homo sapiens, saliva, adult, cameroon2020-03-12v4No1 / 113
703amnoncommon homo sapiens, saliva, adult, germany, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 115
32amnoncommon homo sapiens, saliva, adult, bolivia2016-12-05v4No1 / 116
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age age 3 months compared to age 1 week in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 116
640amnoncommon homo sapiens, female, saliva, adult, china, shanghai district2020-08-22v4No1 / 117
777amnon high in age 5 years compared to age 3 years in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 120
636amnon high in oropharynx oropharyngeal swab compared to tracheal aspirate trachea endotracheal aspirate in homo sapiens united states of america hospital adult commonwealth of pennsylvania acute respiratory failure respiratory failure 2020-08-08v4No1 / 122
425amnoncommon homo sapiens, duodenum, child, africa, madagascar, antananarivo2018-12-08v4No1 / 123
598amnoncommon homo sapiens, saliva, oral cavity, child, kingdom of spain, age 13-15 years2020-03-25v3No1 / 124
425amnoncommon homo sapiens, duodenum, child, africa, central african republic, bangui, stunted growth2018-12-08v4No1 / 125
806amnon high in dorsum of tongue compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 126
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in cloaca anas platyrhynchos state of california mallard )2017-03-05v4No1 / 131
246amnoncommon homo sapiens, saliva, italy2017-11-21v4No1 / 133
278amnoncommon homo sapiens, united states of america, saliva, adult, state of california2018-01-23v4No1 / 133
711amnon high in adult compared to child age 8-12 years in homo sapiens united states of america oral cavity state of colorado mouth 2028-05-21v4No1 / 133
775amnoncommon homo sapiens, saliva, adult, china, jinan city prefecture2021-04-24v4No1 / 133
519amnoncommon homo sapiens, city, saliva, late adult stage, adult, china2019-06-25v3No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america adult state of california 2018-01-23v4No1 / 146
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 148
64amnoncommon homo sapiens, saliva, sichuan province2017-02-16v4No1 / 152
96amnoncommon homo sapiens, brazil, subgingival plaque, mouth2017-03-29v4No1 / 158
519amnon high in saliva compared to dentition supragingival plaque in homo sapiens city late adult stage adult china 2019-06-25v3No1 / 159
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 162
517amnon high in mouth mucosa mouth compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 162
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
299amnoncommon in healthy (non-tumor) controls (common homo sapiens, control, saliva, adult, china)2018-02-27v4No1 / 179
777amnon high in age 3 years compared to age 18 months in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 184
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
299amnoncommon homo sapiens, saliva, adult, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens juvenile organism obsolete_juvenile stage age 13 2017-09-12v4No1 / 189
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
777amnon high in age 3 months compared to age 2 days in homo sapiens saliva infant sweden municipality of umea 2021-04-26v3No1 / 197
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in feces homo sapiens china )2018-12-30v4No1 / 203
555amnon high in saliva compared to dentition supragingival plaque in homo sapiens child shanghai proper age 7-14 years china 2019-09-10v3No1 / 205
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v3No1 / 214
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens female adult china shanghai district 2020-08-22v4No1 / 232
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 242
806amnon high in oral cavity oral wash compared to gingiva keratinized gingiva in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 288
596amnon high in age 1-7 years compared to age < 1 year in homo sapiens saliva child sweden 2020-03-18v3No1 / 288
653amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens adult toronto canada age 20-30 years 2020-09-13v3No1 / 291
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in homo sapiens adult toronto canada age 20-30 years 2020-09-13v3No1 / 306
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
725amnon high in subgingival plaque subgingival dental plaque compared to mouth mucosa buccal mucosa in homo sapiens adult china municipality of beijing 2021-01-03v3No1 / 544
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in feces homo sapiens china )2018-12-30v4No1 / 617
425amnon high in duodenum compared to feces in homo sapiens child africa 2018-12-08v4No1 / 622
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
819amnon high in skin of cheek compared to scalp in homo sapiens female skin adult china age 25-45 years 2021-07-12v1No1 / 1684

Problems / suggestions? Please email info AT dbbact DOT org