Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGCCGGCAAGTCAGATGTGAAATCTGGAGGCTTAACCTCCAAACTGCATTTGAAACTGTAGGTCTTGAGTACCGGAGAGGTTATCGGAATTCCTTG
common ontology terms
term enrichment score
TermScore
homo sapiens0.575904
feces0.548508
adult0.457429
united states of america0.251810
control0.163801
child0.120094
china0.115607
female0.113448
italy0.110701
infant0.094862
city0.081919
germany0.078501
kingdom of spain0.071146
taiwan0.070278
obesity0.068670
LOWER IN crohn's disease0.061404
LOWER IN male0.058824
age0.057971
obsolete_juvenile stage0.051724
high bmi0.051591
state of colorado0.051502
state of new york0.049793
jiangsu province0.046332
heterosexual0.044793
msw0.044793
age 2-4 years0.044543
republic of china0.044543
felis catus0.043812
formula fed0.043103
low bmi0.043103
state of california0.040486
homosexual0.035874
msm0.035874
LOWER IN ulcerative colitis0.035556
new zealand0.035556
biopsy0.035346
cat0.035346
age 50-80 years0.035242
poland0.034934
hispanic or latin american0.034934
south korea0.029740
male0.029593
research facility0.028005
gay0.027149
estonia0.027088
parkinson's disease0.027027
obese body mass index status0.026906
taipei city0.026906
denver0.026906
LOWER IN rural community0.026906
LOWER IN infant0.026549
LOWER IN high bmi0.026432
rectum0.026432
kingdom of denmark0.026374
state of alabama0.026201
age 2 years0.026201
kingdom of norway0.026201
age 1 year0.025862
hiv infection0.025862
sheep0.025862
pregnancy0.025532
ovis aries0.025532
switzerland0.024896
israel0.024896
canada0.024145
colon0.024145
LOWER IN control0.020779
remission0.018182
sigmoid colon0.018182
overweight body mass index status0.018182
age 19-240.018182
metabolic syndrome0.018182
age > 1 year0.018100
age<17 years0.018100
terminal ileum0.018100
taoyuan city0.018100
type 2 diabetes mellitus0.018100
caribbean latino0.018100
municipality of logrono0.018100
indonesia0.018100
municipality of yogyakarta0.018100
LOWER IN gay0.018100
low anterior resection0.018100
age >940.018100
oslo0.018100
age 30-400.018100
LOWER IN small village0.018100
nanning city prefecture0.018100
age 50-60 years0.018100
LOWER IN homosexual0.018018
LOWER IN msm0.018018
autistic disorder0.017937
madrid0.017937
juvenile organism0.017937
LOWER IN age &lt; 1 year0.017937
atlanta0.017937
european0.017937
nanchang city prefecture0.017937
state of oklahoma0.017937
toronto0.017937
Fraction of dbbact annotations with this term covered by the query
TermScore
heterosexual0.800000
msw0.800000
taiwan0.750000
gay0.750000
age 2-4 years0.666667
remission0.666667
sigmoid colon0.666667
republic of china0.666667
overweight body mass index status0.666667
age 19-240.666667
estonia0.666667
homosexual0.666667
msm0.666667
metabolic syndrome0.666667
LOWER IN crohn&#39;s disease0.636364
parkinson's disease0.600000
LOWER IN gastric bypass0.500000
tucson0.500000
small waist circumference0.500000
LOWER IN waist circumference0.500000
LOWER IN large waist circumference0.500000
chronic fatigue syndrome0.500000
new york county0.500000
juvenile0.500000
centererians0.500000
LOWER IN mammalian milk beverage0.500000
age > 1 year0.500000
LOWER IN ulcerative colitis0.500000
age<17 years0.500000
age 30-50 years0.500000
terminal ileum0.500000
LOWER IN endospore enriched fraction0.500000
LOWER IN lysis0.500000
age 7 months0.500000
breast fed0.500000
taoyuan city0.500000
LOWER IN hmong0.500000
LOWER IN hmong 2nd generation0.500000
obesity0.500000
graves' disease0.500000
stroke0.500000
obese body mass index status0.500000
age 50-70 years0.500000
midwest region0.500000
zhengzhou city prefecture0.500000
little physical activity0.500000
LOWER IN physical activity0.500000
vegetarian diet0.500000
schizophrenia0.500000
athlete0.500000
sesame allergy0.500000
LOWER IN milk allergy0.500000
age 4-10 years0.500000
coronary heart disease0.500000
omnivore diet0.500000
type 2 diabetes mellitus0.500000
caribbean latino0.500000
adriatic sea coastal waters of italy0.500000
caretta caretta0.500000
loggerhead sea turtle0.500000
human immunodeficiency virus infectious disease0.500000
municipality of logrono0.500000
antiretroviral therapy0.500000
age 17-290.500000
usa born0.500000
LOWER IN non usa born0.500000
taipei city0.500000
municipality of reus0.500000
denver0.500000
new zealand0.500000
age 200.500000
LOWER IN egypt0.500000
metabolic syndrome x0.500000
LOWER IN age 4 months0.500000
indonesia0.500000
municipality of yogyakarta0.500000
azerbaijan0.500000
third trimester0.500000
LOWER IN gay0.500000
age 8-120.500000
LOWER IN age 7 months0.500000
age one month0.500000
LOWER IN age one week0.500000
LOWER IN inflammatory bowel disease0.500000
cornell university0.500000
age 3-60.500000
mild0.500000
LOWER IN severe0.500000
age 60-790.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
low anterior resection0.500000
irritable bowel syndrome0.500000
age >940.500000
oslo0.500000
age 30-400.500000
gaz:000521000.500000
cron diet0.500000
age 13-140.500000
rem sleep behavior disorder0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.944700
homo sapiens0.884793
adult0.525346
united states of america0.364055
control0.156682
china0.138249
child0.078341
female0.073733
italy0.069124
infant0.055300
germany0.050691
city0.046083
kingdom of spain0.041475
taiwan0.036866
obesity0.036866
LOWER IN male0.032258
age0.032258
LOWER IN crohn&#39;s disease0.032258
research facility0.027650
high bmi0.027650
state of new york0.027650
obsolete_juvenile stage0.027650
state of colorado0.027650
jiangsu province0.027650
age 2-4 years0.023041
formula fed0.023041
low bmi0.023041
felis catus0.023041
state of california0.023041
republic of china0.023041
heterosexual0.023041
msw0.023041
LOWER IN control0.018433
south korea0.018433
poland0.018433
LOWER IN ulcerative colitis0.018433
biopsy0.018433
age 50-80 years0.018433
hispanic or latin american0.018433
new zealand0.018433
cat0.018433
homosexual0.018433
msm0.018433
male0.018433
age 1 year0.013825
LOWER IN high bmi0.013825
switzerland0.013825
state of alabama0.013825
age 2 years0.013825
parkinson's disease0.013825
obese body mass index status0.013825
pregnancy0.013825
israel0.013825
hiv infection0.013825
estonia0.013825
taipei city0.013825
denver0.013825
gay0.013825
kingdom of denmark0.013825
kingdom of norway0.013825
LOWER IN infant0.013825
LOWER IN rural community0.013825
canada0.013825
rectum0.013825
colon0.013825
ovis aries0.013825
sheep0.013825
autistic disorder0.009217
hospital0.009217
madrid0.009217
remission0.009217
juvenile organism0.009217
body mass index0.009217
LOWER IN low bmi0.009217
LOWER IN adult0.009217
age > 1 year0.009217
LOWER IN age &lt; 1 year0.009217
atlanta0.009217
age<17 years0.009217
sigmoid colon0.009217
terminal ileum0.009217
zhejiang province0.009217
taoyuan city0.009217
guangzhou city prefecture0.009217
overweight body mass index status0.009217
commonwealth of virginia0.009217
caucasian0.009217
european0.009217
age 19-240.009217
commonwealth of massachusetts0.009217
type 2 diabetes mellitus0.009217
caribbean latino0.009217
commonwealth of pennsylvania0.009217
municipality of logrono0.009217
state of michigan0.009217
colombia0.009217
metabolic syndrome0.009217
kingdom of the netherlands0.009217
amsterdam0.009217
nanchang city prefecture0.009217
Exp. ID User ID Description Date Region Flag Sequences
215amnonlower in people with Roux-en-Y gastric bypass compared to controls ( high in control compared to gastric bypass in feces homo sapiens united states of america )2017-10-23v4No1 / 5
564amnon high in autistic disorder compared to control in feces homo sapiens child italy age 2-4 years 2019-11-18v3No1 / 5
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 1 year 2021-06-13v3No1 / 10
689amnoncommon feces, homo sapiens, united states of america, hospital, adult, non c. diff diarrhea, tucson2028-03-11v4No1 / 12
131amnonnegatively correlated with waist circumference ( high in small waist circumference compared to waist circumference large waist circumference in feces homo sapiens south korea )2017-04-16v4No1 / 15
12amnon high in chronic fatigue syndrome compared to control in feces homo sapiens new york county 2016-11-02v4No1 / 18
630amnon high in sedentary low physical activity compared to high physical activity in feces homo sapiens adult kingdom of spain madrid 2020-05-31v3No1 / 18
601amnon high in control compared to type 2 diabetes mellitus in feces homo sapiens adult china 2020-03-30v4No1 / 20
663amnon high in low bmi compared to obesity obese body mass index status high bmi in feces homo sapiens adult poland switzerland 2020-09-22v4No1 / 21
713amnoncommon feces, homo sapiens, remission, crohn's disease2028-05-21v3No1 / 22
641amnoncommon feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
650amnonpositively correlated with BMI ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america adult state of new york )2020-09-09v4No1 / 26
651amnon high in female compared to male in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 28
36amnonhigher in centernarians ( high in centererians compared to adult in feces homo sapiens sichuan province )2016-12-06v4No1 / 30
24amnondisappears on transition to cow milk ( high in breast milk compared to mammalian milk beverage in feces homo sapiens infant )2016-12-01v4No1 / 35
233amnon high in age age > 1 year compared to age < 1 year in feces homo sapiens united states of america infant 2017-11-05v4No1 / 37
297amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years 2018-02-12v4No1 / 38
320amnonhigher in CD patients with remission ( high in remission compared to crohn's disease in feces homo sapiens adult )2018-04-19v4No1 / 38
390amnoncommon feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 38
131amnonnegatively correlated with age (30-80 years) ( high in age age 30-50 years compared to age 50-80 years in feces homo sapiens south korea )2017-04-16v4No1 / 39
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in feces homo sapiens united states of america adult )2018-11-18v4No1 / 41
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, age 2-4 years2019-11-18v3No1 / 42
797amnon high in age 7 months compared to age 3 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 44
597amnoncommon feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 46
797amnoncommon feces, homo sapiens, child, germany, formula fed, age 2 years2021-06-13v3No1 / 46
591amnoncommon feces, homo sapiens, united states of america, adult, age 50-80 years, parkinson's disease2020-02-17v4No1 / 47
597amnoncommon feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 47
651amnoncommon feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 49
564amnoncommon feces, homo sapiens, control, child, italy, age 2-4 years2019-11-18v3No1 / 50
797amnoncommon feces, homo sapiens, child, germany, breast fed, age 2 years2021-06-13v3No1 / 50
16amnon high in control compared to diarrhea in feces felis catus state of california 2016-11-08v4No1 / 51
796amnoncommon feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 51
400amnonlower in children of hmong migrands born in the usa compared to non-migrant usa people ( high in united states of america compared to hmong hmong 2nd generation in feces homo sapiens )2018-11-18v4No1 / 52
650amnoncommon feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 52
694amnoncommon feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 52
796amnoncommon feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 52
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
131amnon high in female compared to male in feces homo sapiens south korea 2017-04-16v4No1 / 55
814amnoncommon feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 55
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
368amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
591amnoncommon feces, homo sapiens, control, united states of america, adult, age 50-80 years2020-02-17v4No1 / 56
650amnoncommon feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 56
720amnoncommon feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 56
650amnon high in female compared to male in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 57
651amnoncommon feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 58
666amnoncommon feces, homo sapiens, italy2020-09-25v3No1 / 58
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 59
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 60
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
502amnoncommon feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 63
575amnoncommon in professional martial arts athletes (common feces, homo sapiens, adult, high physical activity, age 19-24, china, athlete)2020-01-05v3No1 / 63
630amnon high in female compared to male in feces homo sapiens adult kingdom of spain madrid 2020-05-31v3No1 / 63
695amnon high in sesame allergy compared to milk allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 64
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 68
644amnon high in female compared to male in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v4No1 / 69
22amnon high in control compared to hiv infection in feces homo sapiens united states of america 2016-11-28v4No1 / 70
803amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, age 50-80 years, type 2 diabetes mellitus, caribbean latino2021-06-18v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
644amnoncommon feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 71
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, switzerland2020-09-22v4No1 / 71
810amnoncommon in sea turtle feces from sea turtle rescue center (common feces, research facility, mediterranean sea, italy, adriatic sea coastal waters of italy, caretta caretta, loggerhead sea turtle)2021-06-22v3No1 / 72
395amnoncommon feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 75
794amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, human immunodeficiency virus infectious disease, municipality of logrono, antiretroviral therapy2021-06-08v4No1 / 75
74amnoncommon feces, homo sapiens, united states of america2017-02-27v4No1 / 76
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, age 17-292019-02-13v4No1 / 76
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 77
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 77
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
401amnoncommon feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 79
529amnoncommon feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 79
732amnoncommon feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 79
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 82
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 83
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
404amnon high in lean body mass low bmi compared to high bmi in feces homo sapiens city adult colombia 2018-11-20v4No1 / 84
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
601amnoncommon feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 85
663amnoncommon feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 85
668amnoncommon feces, research facility, felis catus, new zealand, cat2020-09-26v3No1 / 85
249amnoncommon feces, homo sapiens, united states of america2017-11-22v4No1 / 86
344amnoncommon in feces of homosexual males (common feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 87
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, age 202018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
404amnon high in female compared to male in feces homo sapiens city adult colombia 2018-11-20v4No1 / 88
487amnoncommon feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 88
293amnoncommon feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 89
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 89
803amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, age 50-80 years, caribbean latino2021-06-18v4No1 / 89
668amnon high in age 5 years compared to age 4 months in feces research facility felis catus new zealand cat 2020-09-26v3No1 / 92
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
723amnonhigher in children age 2-4 years compared to mothers ( high in child age 2-4 years compared to adult in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 95
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in feces homo sapiens united states of america adult )2018-02-07v4No1 / 96
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 97
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 97
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
702amnon high in felis catus cat compared to canis lupus familiaris dog in feces united states of america state of north carolina 2028-04-02v4No1 / 100
438amnoncommon feces, homo sapiens, age 19-24, china2018-12-30v4No1 / 101
477amnoncommon feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 103
563amnoncommon feces, homo sapiens, control, united states of america, homosexual, msm, male, rectal swab2019-11-18v4No1 / 103
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 106
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china2018-12-30v4No1 / 106
797amnon high in age 1 year compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
273amnon high in age age one month compared to age one week in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
409amnoncommon feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 108
436amnoncommon feces, united states of america, felis catus, state of colorado, cat2018-12-25v4No1 / 108
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china2018-12-30v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in feces homo sapiens united states of america child )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 60-79, china2018-12-30v4No1 / 111
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 30-50, china2018-12-30v4No1 / 115
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in feces homo sapiens adult taipei city taiwan )2019-07-18v3No1 / 115
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
743amnoncommon feces, farm, adult, italy, captive, lepus europaeus, european hare2021-02-21v3No1 / 119
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china2018-12-30v4No1 / 121
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 125
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, age 30-402018-05-13v4No1 / 130
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
578amnon high in kingdom of spain compared to sweden in feces homo sapiens hiv infection adult gay homosexual msm male 2020-01-14v3No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
644amnonlower in individuals born in mexico compared to cuba ( high in cuba compared to mexico in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens juvenile organism obsolete_juvenile stage age 13 2017-09-12v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america )2017-04-11v4No1 / 139
797amnon high in child age 2 years compared to infant age 1 year in feces homo sapiens germany formula fed 2021-06-13v3No1 / 139
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in feces homo sapiens united states of america )2017-02-27v4No1 / 149
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
815amnoncommon feces, mongolia, winter, wild, vulpes vulpes, lake hulun, red fox2021-07-04v3No1 / 160
292amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens adult china 2018-02-05v4No1 / 161
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in feces homo sapiens infant )2017-11-13v4No1 / 173
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
669amnon high in age 1 year compared to age 2 months in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 220
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
10amnonpositively correlated with age (6-35) ( high in adult compared to child in feces homo sapiens toronto )2016-10-27v4No1 / 228
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, age 50-60 years, nephrolithiasis, china)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in feces homo sapiens belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in feces homo sapiens infant india )2016-12-19v4No1 / 253
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, age 50-60 years, china)2018-01-27v4No1 / 281
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
78amnon high in male compared to female in feces tropical grassland biome kenya nanger granti gazelle 2017-03-01v4No1 / 301
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
723amnon high in age 2-4 years compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
565amnoncommon farm, skin, bos taurus, cow, canada2019-11-21v3No1 / 318
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
666amnoncommon feces, equus caballus, italy, horse2020-09-25v3No1 / 341
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v4No1 / 384
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 400
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
666amnoncommon feces, italy, lama guanicoe2020-09-25v3No1 / 437
666amnoncommon feces, italy, equus asinus africanus, equus asinus, donkey2020-09-25v3No1 / 450
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in feces homo sapiens china )2018-12-30v4No1 / 474
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
666amnoncommon feces, bos taurus, italy, cow2020-09-25v3No1 / 482
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
666amnoncommon feces, italy, vicugna pacos, alpaca2020-09-25v3No1 / 546
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
666amnoncommon feces, italy, ovis aries musimon, mouflon2020-09-25v3No1 / 649
565amnoncommon zoological garden, skin, captive, canada, tragelaphus oryx, toronto zoo, eland2019-11-21v3No1 / 674
666amnoncommon feces, italy, capra hircus, goat2020-09-25v3No1 / 674
666amnoncommon feces, ovis aries, italy, sheep2020-09-25v3No1 / 688
649amnon high in colon compared to ileum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 897
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261

Problems / suggestions? Please email info AT dbbact DOT org