Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGTCTGCAAGTCAGATGTGAAATCCATGGGCTCAACCCATGAACTGCATTTGAAACTGTAGATCTTGAGTGTCGGAGGGGCAATCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
feces0.580465
homo sapiens0.576597
adult0.454667
china0.175434
united states of america0.169231
control0.164678
child0.148390
monkey0.135162
rural community0.117607
female0.116299
zoological garden0.105705
kingdom of spain0.096985
macaca mulatta0.095808
city0.094118
pig0.073620
research facility0.070222
obesity0.068566
sus scrofa0.067249
male0.060298
homosexual0.057052
msm0.057052
rhesus macaque0.056250
obsolete_juvenile stage0.055470
captive0.051680
gorilla gorilla0.051348
taiwan0.051173
india0.050826
rumen0.048682
infant0.047004
gay0.044968
LOWER IN crohn's disease0.044728
wild0.043716
germany0.040906
state of california0.040698
jiangsu province0.039886
age 30-500.038585
cameroon0.038585
age 5-13 years0.038585
guangzhou city prefecture0.038462
cayo santiago0.038217
indian rhesus macaque0.038217
puerto rico0.036810
republic of china0.032310
colombia0.032310
obese body mass index status0.032051
chuquisaca department0.032051
chimpanzee0.032051
ruminal fluid0.032051
ethiopia0.032051
LOWER IN child0.031847
poland0.031546
pregnancy0.031546
africa0.031056
state of colorado0.031056
bolivia0.031056
south korea0.030896
high bmi0.030896
united kingdom0.030120
israel0.029240
caecum0.028923
sweden0.027248
LOWER IN heterosexual0.026059
LOWER IN msw0.026059
hunter gatherer0.026030
small village0.026030
heterosexual0.025918
msw0.025918
municipality of logrono0.025806
himalayas0.025806
tanzania0.025806
LOWER IN ulcerative colitis0.025806
age > 1 year0.025806
como zoo0.025806
republic of congo0.025806
nouabale-ndoki national park0.025806
LOWER IN infant0.025723
nepal0.025478
capra hircus0.025478
goat0.025478
state of new york0.025157
amsterdam0.025157
hiv infection0.024845
state of tennessee0.024845
age0.024768
thailand0.024540
kingdom of the netherlands0.024540
state of minnesota0.024242
skin0.023121
metabolic syndrome0.019576
overweight body mass index status0.019576
nigeria0.019576
estonia0.019576
nanchang city prefecture0.019576
village0.019576
pan troglodytes troglodytes0.019576
papio anubis0.019576
hmong0.019481
taoyuan city0.019481
lima0.019481
shantytown0.019481
Fraction of dbbact annotations with this term covered by the query
TermScore
rural community0.900000
gorilla gorilla0.833333
LOWER IN heterosexual0.800000
LOWER IN msw0.800000
taiwan0.750000
gay0.750000
hunter gatherer0.750000
small village0.750000
age 30-500.666667
republic of china0.666667
metabolic syndrome0.666667
overweight body mass index status0.666667
colombia0.666667
tibet autonomous region0.666667
age 19-240.666667
nigeria0.666667
cameroon0.666667
homosexual0.666667
msm0.666667
estonia0.666667
age 5-13 years0.666667
nanchang city prefecture0.666667
venezuela0.666667
amerindian0.666667
village0.666667
pan troglodytes troglodytes0.666667
papio anubis0.666667
olive baboon0.666667
LOWER IN crohn's disease0.636364
india0.625000
guangzhou city prefecture0.600000
heterosexual0.600000
msw0.600000
monkey0.600000
obesity0.583333
hmong0.500000
municipality of logrono0.500000
LOWER IN stunted growth0.500000
obese body mass index status0.500000
taoyuan city0.500000
LOWER IN clostridium difficile intestinal infectious disease0.500000
metabolic syndrome x0.500000
lima0.500000
shantytown0.500000
age 13-140.500000
non-pregnant0.500000
LOWER IN pregnancy0.500000
LOWER IN pregnancy trimester 20.500000
egypt0.500000
ismailia0.500000
LOWER IN plant based diet0.500000
LOWER IN chronic fatigue syndrome0.500000
new york county0.500000
age 50-70 years0.500000
new delhi0.500000
hmong 2nd generation0.500000
bihar state0.500000
daycare0.500000
age 1-5 years0.500000
autoimmune hepatitis0.500000
zhengzhou city prefecture0.500000
macaca mulatta0.500000
cayo santiago0.500000
indian rhesus macaque0.500000
graves' disease0.500000
stroke0.500000
midwest region0.500000
chengdu city prefecture0.500000
gestational age 8-12 weeks0.500000
athlete0.500000
LOWER IN state of oregon0.500000
rhesus macaque0.500000
age 8 months0.500000
coronary heart disease0.500000
jordan0.500000
santa catarina state0.500000
omnivore diet0.500000
indonesia0.500000
municipality of yogyakarta0.500000
yaounde0.500000
LOWER IN ngoantet0.500000
type 2 diabetes mellitus0.500000
caribbean latino0.500000
municipality of santiago de cali0.500000
bucaramanga0.500000
barranquilla0.500000
LOWER IN bogota0.500000
LOWER IN medellin metropolitan area0.500000
sri lanka0.500000
age 1-18 years0.500000
antananarivo0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
human immunodeficiency virus infectious disease0.500000
antiretroviral therapy0.500000
raute0.500000
bangui0.500000
taipei city0.500000
municipality of reus0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.890728
homo sapiens0.754967
adult0.453642
united states of america0.218543
china0.172185
control0.145695
child0.092715
female0.076159
monkey0.076159
research facility0.069536
rural community0.062914
zoological garden0.059603
kingdom of spain0.056291
city0.052980
macaca mulatta0.052980
pig0.039735
obesity0.036424
male0.036424
sus scrofa0.036424
captive0.033113
obsolete_juvenile stage0.029801
rhesus macaque0.029801
homosexual0.029801
msm0.029801
taiwan0.026490
india0.026490
infant0.026490
gorilla gorilla0.026490
wild0.026490
rumen0.026490
jiangsu province0.023179
germany0.023179
state of california0.023179
gay0.023179
LOWER IN crohn's disease0.023179
guangzhou city prefecture0.019868
age 30-500.019868
cayo santiago0.019868
puerto rico0.019868
indian rhesus macaque0.019868
cameroon0.019868
age 5-13 years0.019868
africa0.016556
obese body mass index status0.016556
poland0.016556
republic of china0.016556
south korea0.016556
high bmi0.016556
colombia0.016556
sweden0.016556
pregnancy0.016556
LOWER IN child0.016556
israel0.016556
state of colorado0.016556
united kingdom0.016556
bolivia0.016556
chuquisaca department0.016556
caecum0.016556
chimpanzee0.016556
ruminal fluid0.016556
ethiopia0.016556
thailand0.013245
municipality of logrono0.013245
hiv infection0.013245
heterosexual0.013245
msw0.013245
state of new york0.013245
nepal0.013245
himalayas0.013245
tanzania0.013245
kingdom of the netherlands0.013245
amsterdam0.013245
LOWER IN ulcerative colitis0.013245
age > 1 year0.013245
hunter gatherer0.013245
LOWER IN heterosexual0.013245
LOWER IN msw0.013245
skin0.013245
LOWER IN infant0.013245
small village0.013245
age0.013245
state of minnesota0.013245
como zoo0.013245
republic of congo0.013245
nouabale-ndoki national park0.013245
capra hircus0.013245
goat0.013245
state of tennessee0.013245
hmong0.009934
low bmi0.009934
taoyuan city0.009934
brazil0.009934
metabolic syndrome0.009934
lima0.009934
shantytown0.009934
age 13-140.009934
vagina0.009934
egypt0.009934
diet0.009934
overweight body mass index status0.009934
Exp. ID User ID Description Date Region Flag Sequences
400amnonhigh freq. in hmong (chinese) females from thailand (dominant feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 13
794amnondominant feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 16
425amnonlower in kids with stunted growth compared to non-stunted ( high in control compared to stunted growth in feces homo sapiens child africa )2018-12-08v4No1 / 18
663amnondominant feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 18
663amnondominant feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 18
707amnon high in control compared to systemic lupus erythematosus in feces homo sapiens female adult guangzhou city prefecture age 30-50 china 2028-04-11v3No1 / 19
796amnondominant feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 19
597amnondominant feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 21
120amnondominant feces, homo sapiens, brazil2017-04-12v4No1 / 22
390amnonlower in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in non c. diff diarrhea compared to clostridium difficile intestinal infectious disease in feces homo sapiens hospital australia diarrhea )2018-11-04v4No1 / 23
487amnondominant feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 23
53amnondominant feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 25
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, china2028-04-11v3No1 / 25
131amnondominant feces, homo sapiens, south korea2017-04-16v4No1 / 27
601amnondominant feces, homo sapiens, control, adult, china2020-03-30v4No1 / 27
438amnondominant feces, homo sapiens, jiangsu province, age 13-14, china2018-12-30v4No1 / 29
724amnon high in non-pregnant compared to pregnancy pregnancy trimester 2 in homo sapiens female vagina adult egypt ismailia age 25-45 years 2021-01-03v3No1 / 29
63amnon high in diet animal product diet compared to plant based diet in feces homo sapiens united states of america 2017-04-12v4No1 / 32
12amnon high in control compared to chronic fatigue syndrome in feces homo sapiens new york county 2016-11-02v4No1 / 35
814amnonlower after 2 months of caloric restriction diet ( high in control diet compared to caloric restriction diet in feces homo sapiens female obesity adult obese body mass index status germany high bmi overweight body mass index status age 50-70 years )2021-06-30v4No1 / 37
352amnoncommon feces, homo sapiens, new delhi, india2018-07-30v4No1 / 41
400amnonhigher in children of hmong migrands born in the usa compared to non-migrant usa people ( high in hmong hmong 2nd generation compared to united states of america in feces homo sapiens )2018-11-18v4No1 / 41
36amnoncommon feces, homo sapiens, sichuan province2016-12-06v4No1 / 44
570amnoncommon feces, homo sapiens, india, bihar state2019-12-16v3No1 / 46
597amnoncommon feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 46
482amnoncommon feces, homo sapiens, child, colombia, medellin metropolitan area, daycare, age 1-5 years2019-02-12v4No1 / 47
720amnoncommon feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 48
770amnon high in infant age < 1 year compared to age 10-15 years adult organism in oral cavity mouth mucosa macaca mulatta cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 49
796amnoncommon feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 51
694amnoncommon feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 52
796amnoncommon feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 52
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
814amnoncommon feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 55
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
720amnoncommon feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 56
666amnoncommon feces, homo sapiens, italy2020-09-25v3No1 / 58
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
637amnoncommon feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 61
593amnoncommon feces, homo sapiens, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
380amnoncommon feces, homo sapiens, adult, tibetan plateau, tibet autonomous region2018-10-03v4No1 / 63
575amnoncommon in professional martial arts athletes (common feces, homo sapiens, adult, high physical activity, age 19-24, china, athlete)2020-01-05v3No1 / 63
630amnon high in male compared to female in feces homo sapiens adult kingdom of spain madrid 2020-05-31v3No1 / 63
365amnoncommon feces, homo sapiens, child, nigeria, obsolete_juvenile stage2018-08-30v4No1 / 66
650amnoncommon feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 66
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta monkey captive rhesus macaque age 8 months 2020-09-27v4No1 / 66
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
365amnoncommon feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 67
757amnoncommon feces, homo sapiens, adult, brazil, santa catarina state2021-03-28v3No1 / 67
574amnoncommon feces, homo sapiens, adult, russia2020-01-05v3No1 / 68
593amnoncommon feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 68
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
594amnon high in city yaounde compared to rural community ngoantet in feces homo sapiens adult cameroon 2020-03-12v4No1 / 70
803amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, age 50-80 years, type 2 diabetes mellitus, caribbean latino2021-06-18v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
404amnon high in municipality of santiago de cali bucaramanga barranquilla compared to bogota medellin metropolitan area in feces homo sapiens city adult colombia 2018-11-20v4No1 / 71
644amnoncommon feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 71
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, switzerland2020-09-22v4No1 / 71
656amnoncommon feces, homo sapiens, sri lanka, age 1-18 years2020-09-13v3No1 / 71
425amnoncommon feces, homo sapiens, child, africa, madagascar, antananarivo2018-12-08v4No1 / 73
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 74
794amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, human immunodeficiency virus infectious disease, municipality of logrono, antiretroviral therapy2021-06-08v4No1 / 75
74amnoncommon feces, homo sapiens, united states of america2017-02-27v4No1 / 76
477amnoncommon feces, homo sapiens, nepal, himalayas, rural community, raute2019-01-29v4No1 / 76
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
404amnoncommon feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 79
425amnoncommon feces, homo sapiens, child, africa, central african republic, bangui2018-12-08v4No1 / 79
529amnoncommon feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 79
732amnoncommon feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 79
736amnon high in female adult compared to child age 1-3 years in feces homo sapiens tanzania pemba island 2021-01-25v3No1 / 79
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 80
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
339amnoncommon feces, homo sapiens, adult, india2018-05-24v4No1 / 81
643amnoncommon feces, homo sapiens, adult, south korea2020-08-30v4No1 / 81
671amnoncommon feces, united states of america, research facility, macaca mulatta, age 1 month, monkey, captive, rhesus macaque2020-09-27v4No1 / 81
562amnoncommon feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 82
650amnon high in male compared to female in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 82
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, china2028-04-11v3No1 / 82
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 83
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
601amnoncommon feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 85
663amnoncommon feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 85
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
249amnoncommon feces, homo sapiens, united states of america2017-11-22v4No1 / 86
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 86
344amnoncommon in feces of homosexual males (common feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 87
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, age 202018-12-15v4No1 / 87
723amnonlower in children age 2-4 years compared to mothers ( high in adult compared to child age 2-4 years in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 87
477amnoncommon feces, homo sapiens, raji, nepal, himalayas, rural community2019-01-29v4No1 / 88
487amnoncommon feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 88
293amnoncommon feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 89
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 89
803amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, age 50-80 years, caribbean latino2021-06-18v4No1 / 89
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 94
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
400amnoncommon in hmong (chinese) females from thailand (common feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 95
736amnoncommon feces, homo sapiens, female, adult, tanzania, pemba island2021-01-25v3No1 / 95
238amnoncommon feces, homo sapiens, colombia2017-11-07v4No1 / 96
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, forager, rural community, chepang2019-01-28v4No1 / 97
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 97
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
438amnoncommon feces, homo sapiens, age 19-24, china2018-12-30v4No1 / 101
477amnoncommon feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 103
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china2018-12-30v4No1 / 106
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
644amnonhigher in individuals born in latin america compared to indivuals born in usa ( high in non usa born compared to usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 107
695amnon high in milk allergy compared to sesame allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 107
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
256amnonhigher in control diet compared to diet enriched with sucram in pig gut ( high in diet standard feed compared to sucram in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 109
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in feces homo sapiens united states of america child )2018-11-22v4No1 / 110
770amnoncommon macaca mulatta, age > 1 year, penis, male organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 110
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 60-79, china2018-12-30v4No1 / 111
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
794amnon high in control compared to hiv infection human immunodeficiency virus infectious disease antiretroviral therapy in feces homo sapiens adult kingdom of spain municipality of logrono 2021-06-08v4No1 / 112
517amnoncommon feces, homo sapiens, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 113
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 30-50, china2018-12-30v4No1 / 115
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in feces homo sapiens adult taipei city taiwan )2019-07-18v3No1 / 115
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, age 6 months, captive, rhesus macaque2020-09-27v4No1 / 117
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
294amnon high in control compared to irritable bowel syndrome in feces homo sapiens adult kingdom of spain 2018-02-09v4No1 / 121
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 121
393amnon high in gay homosexual msm compared to heterosexual msw in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 121
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china2018-12-30v4No1 / 121
517amnoncommon homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 121
660amnoncommon feces, homo sapiens, ecuador, rural community, village, shuar population2020-09-20v4No1 / 123
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay homosexual msm compared to heterosexual msw in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 124
449amnoncommon feces, homo sapiens, colombia2019-01-09v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to child obsolete_juvenile stage crohn's disease in feces homo sapiens glasgow )2017-02-26v4No1 / 125
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 125
779amnon high in control compared to crohn's disease in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 127
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, age 30-402018-05-13v4No1 / 130
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
526amnon high in cholelithiasis compared to control in homo sapiens bile gallbladder adult kingdom of spain 2019-07-14v3No1 / 131
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
660amnonlower in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in upano valley compared to cross-cutucu in feces homo sapiens ecuador rural community village shuar population )2020-09-20v4No1 / 132
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 132
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 132017-09-12v4No1 / 136
594amnoncommon feces, homo sapiens, adult, rural community, cameroon, ngoantet2020-03-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
770amnon high in vagina female organism compared to penis male organism in macaca mulatta age > 1 year cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 138
797amnon high in child age 2 years compared to infant age 1 year in feces homo sapiens germany formula fed 2021-06-13v3No1 / 139
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 140
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 141
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 145
509amnoncommon feces, homo sapiens, child, nigeria, kebbi state, rural community, age 10-15 years, schistosomiasis, urinary schistosomiasis2019-03-18v4No1 / 146
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
509amnoncommon feces, homo sapiens, control, child, nigeria, kebbi state, rural community, age 10-15 years2019-03-18v4No1 / 147
594amnoncommon feces, homo sapiens, city, adult, cameroon, yaounde2020-03-12v4No1 / 154
629amnon high in homosexual msm compared to heterosexual msw in feces homo sapiens adult male kingdom of the netherlands amsterdam 2020-05-31v4No1 / 154
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens adult china 2018-02-05v4No1 / 161
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 162
700amnoncommon feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 164
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in feces homo sapiens china )2018-12-30v4No1 / 168
190amnoncommon feces, homo sapiens, tanzania, hunter gatherer, hadza2017-09-04v4No1 / 169
770amnoncommon vagina, macaca mulatta, age > 1 year, female organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 169
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, age 13, india2017-09-12v4No1 / 170
671amnoncommon feces, united states of america, research facility, macaca mulatta, age 3 months, monkey, captive, rhesus macaque2020-09-27v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in feces homo sapiens infant )2017-11-13v4No1 / 173
625amnoncommon feces, united states of america, zoological garden, state of minnesota, pithecia pithecia, white-faced saki, como zoo2020-05-16v4No1 / 179
399amnon high in control compared to ulcerative colitis in feces homo sapiens united states of america 2018-11-16v4No1 / 180
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
197amnon high in india compared to finland in feces homo sapiens juvenile organism obsolete_juvenile stage age 13 2017-09-12v4No1 / 189
620amnoncommon feces, gorilla gorilla, wild, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 196
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
620amnoncommon feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 197
411amnoncommon feces, zambia, monkey, wild, papio kindae, kinda baboon2018-11-23v4No1 / 200
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 217
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
666amnoncommon feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 223
411amnoncommon feces, zambia, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
673amnon high in ascending colon caecum compared to ileum in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v4No1 / 228
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
620amnoncommon feces, wild, chimpanzee, pan troglodytes troglodytes, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, age 50-60 years, nephrolithiasis, china)2018-01-27v4No1 / 239
406amnoncommon feces, zoological garden, gorilla gorilla, french republic, monkey, gorilla2018-11-21v4No1 / 239
398amnon high in control compared to crohn's disease in feces homo sapiens belgium 2018-11-15v4No1 / 248
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, age 8 months2020-09-27v4No1 / 252
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in feces homo sapiens infant india )2016-12-19v4No1 / 253
625amnoncommon feces, united states of america, zoological garden, state of minnesota, ateles geoffroyi, como zoo, black-handed spider monkey2020-05-16v4No1 / 256
63amnon high in male compared to female in feces homo sapiens united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 263
688amnoncommon feces, research facility, sus scrofa, nanchang city prefecture, pig, china, duroc pig, age 140 days2028-03-09v4No1 / 278
770amnoncommon feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 280
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, age 50-60 years, china)2018-01-27v4No1 / 281
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 288
411amnoncommon feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 292
625amnoncommon feces, united states of america, zoological garden, gorilla gorilla, state of minnesota, como zoo2020-05-16v4No1 / 293
649amnon high in duodenum jejunum compared to colon in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 295
737amnoncommon research facility, rumen, age 2 months, ruminal fluid, capra hircus, china, hainan autonomous prefecture, goat, hainan black goat2021-01-27v3No1 / 295
331amnoncommon feces, ethiopia, monkey, theropithecus gelada2018-05-13v4No1 / 298
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
723amnon high in age 2-4 years compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 306
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
399amnoncommon feces, united states of america, state of tennessee, zoological garden, sus scrofa, pig2018-11-16v4No1 / 319
729amnoncommon feces, gorilla gorilla, monkey, wild, cameroon2021-01-05v3No1 / 321
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in feces homo sapiens adult czech republic 2019-07-21v1No1 / 334
729amnoncommon feces, monkey, wild, pan troglodytes troglodytes, cameroon, central chimpanzee2021-01-05v3No1 / 336
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
649amnon high in ileum compared to colon in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 338
190amnon high in wet season compared to dry season in feces homo sapiens tanzania hunter gatherer hadza 2017-09-04v4No1 / 341
729amnoncommon feces, zoological garden, monkey, europe, pan troglodytes verus, western chimpanzee2021-01-05v3No1 / 343
671amnon high in state of california compared to state of oregon in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 355
254amnonhigher in river when close to populated region compared to downstream ( high in populated place city upstream compared to downstream in river water fresh water fujian province depth 0.5m jiulong river china )2017-11-23v4No1 / 356
671amnoncommon feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 356
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chicago, chimpanzee, lincoln park zoo2020-05-06v4No1 / 358
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in feces papio zambia monkey baboon 2018-11-23v4No1 / 364
565amnoncommon zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 368
551amnoncommon rumen, adult, egypt, camel, camelus dromedarius2019-08-27v3No1 / 370
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in feces homo sapiens )2018-11-18v4No1 / 378
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in diet cron diet caloric restriction diet compared to american diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 381
729amnon high in wild cameroon compared to zoological garden captive europe in feces gorilla gorilla monkey 2021-01-05v3No1 / 383
620amnoncommon feces, united states of america, zoological garden, gorilla gorilla, chicago, lincoln park zoo2020-05-06v4No1 / 384
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, state of tennessee, zoological garden, gorilla gorilla2018-11-16v4No1 / 395
770amnoncommon feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 396
314amnoncommon farm, caecum, sus scrofa, tibet autonomous region, pig, cecal content, china2018-04-10v4No1 / 402
399amnoncommon feces, united states of america, state of tennessee, zoological garden, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon feces, united states of america, state of tennessee, zoological garden, pan troglodytes, chimpanzee2018-11-16v4No1 / 407
625amnoncommon feces, united states of america, zoological garden, state of minnesota, pongo abelii, sumatran orangutan, como zoo2020-05-16v4No1 / 414
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chimpanzee, saint louis, saint louis zoo2020-05-06v4No1 / 433
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, grivet monkey2018-01-16v4No1 / 440
75amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to infant age < 1 year in feces homo sapiens india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
787amnoncommon in high grain diet induced subacute acidosis (common research facility, rumen, ruminal fluid, acidosis, capra hircus, china, shanxi province, goat, dairy goat, subacute rumen acidosis)2021-05-23v3No1 / 463
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
620amnon high in chimpanzee pan troglodytes troglodytes compared to gorilla gorilla in feces wild republic of congo nouabale-ndoki national park 2020-05-06v4No1 / 478
438amnon high in adult age 30-50 age 60-79 compared to child age 3-6 age 8-12 in feces homo sapiens china 2018-12-30v4No1 / 486
274amnoncommon feces, ethiopia, monkey, chlorocebus djamdjamensis, bale monkey2018-01-16v4No1 / 489
256amnoncommon caecum, left colon, right colon, sus scrofa, pig, united kingdom2017-11-26v4No1 / 490
787amnonlower in excess grain induced rumen acidosis compared to healthy controls ( high in control compared to acidosis subacute rumen acidosis in research facility rumen ruminal fluid capra hircus china shanxi province goat dairy goat )2021-05-23v3No1 / 504
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay homosexual msm compared to heterosexual msw in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 519
620amnoncommon feces, united states of america, zoological garden, gorilla gorilla, saint louis, saint louis zoo2020-05-06v4No1 / 530
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in feces homo sapiens child africa 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in feces homo sapiens china )2018-12-30v4No1 / 617
561amnoncommon rumen, tibetan plateau, bos grunniens, yak, ruminal fluid, china, alpine meadow2019-11-05v3No1 / 670
787amnoncommon control, research facility, rumen, ruminal fluid, capra hircus, china, shanxi province, goat, dairy goat2021-05-23v3No1 / 700
671amnon high in age 3 months compared to age 1 month in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 714
256amnonlower in small intestine compared to colon in pigs ( high in caecum left colon right colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
735amnoncommon female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, restricted feed, sheep, female organism, china2021-01-22v3No1 / 744
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
331amnon high in wet season compared to dry season in feces ethiopia monkey theropithecus gelada 2018-05-13v4No1 / 818
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
88amnoncommon feces, south africa, syncerus caffer caffer, cape buffalo2017-03-08v4No1 / 891
701amnoncommon research facility, rumen, bos taurus, male, cow, rumen liquid, male organism, china, municipality of beijing, age 2 years2028-04-01v3No1 / 953
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
620amnon high in united states of america zoological garden compared to wild republic of congo nouabale-ndoki national park in feces gorilla gorilla gorilla 2020-05-06v4No1 / 1019

Problems / suggestions? Please email info AT dbbact DOT org