Search result for sequence:
TACGTAGGTGGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGAATGCAAGTCAGATGTGAAATCCAAGGGCTCAACCCTTGAACTGCATTTGAAACTGTATTTCTTGAGTGTCGGAGAGGTTGACGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.506223
feces0.503897
adult0.425304
pig0.176223
control0.176103
china0.172972
sus scrofa0.166052
united states of america0.142196
child0.139535
female0.097269
kingdom of spain0.080357
city0.075000
taiwan0.070946
obesity0.069307
monkey0.068127
obsolete_juvenile stage0.066246
wild0.063492
rumen0.062780
farm0.062016
LOWER IN crohn's disease0.060302
jiangsu province0.052174
pan troglodytes troglodytes0.051151
india0.050505
caecum0.049896
male0.049763
pregnancy0.049261
rural community0.046948
infant0.045872
age 30-500.041237
republic of china0.041237
LOWER IN ulcerative colitis0.040816
chuquisaca department0.040816
republic of congo0.040816
nouabale-ndoki national park0.040816
tibetan plateau0.040000
age 5-13 years0.040000
jiangxi province0.039216
belgium0.039216
bolivia0.039216
zoological garden0.038462
united kingdom0.037736
state of california0.036364
israel0.036364
research facility0.036326
germany0.034188
sweden0.033333
tibet autonomous region0.031169
cameroon0.031169
estonia0.031169
nanchang city prefecture0.031169
suckling0.030928
preweaned0.030928
age 2-4 weeks0.030928
indonesia0.030928
municipality of yogyakarta0.030928
colombia0.030928
taipei city0.030928
tanzania0.030928
LOWER IN finland0.030928
alpine meadow0.030928
guangzhou city prefecture0.030691
russia0.030612
homosexual0.030457
msm0.030457
poland0.030457
state of michigan0.030457
LOWER IN infant0.030457
yak0.030457
rectum0.030303
zhejiang province0.030227
LOWER IN zoological garden0.030227
LOWER IN child0.030000
chimpanzee0.030000
bos grunniens0.030000
ruminal fluid0.029126
south korea0.028916
high bmi0.028916
colon0.028708
age0.028708
diet0.028302
bos taurus0.028103
italy0.027907
canada0.027335
age 19-240.020942
metabolic syndrome0.020942
jordan0.020833
zhengzhou city prefecture0.020833
pemba island0.020833
age 4-10 years0.020833
ascending colon0.020833
province of alberta0.020833
age 8-120.020833
age 60-790.020833
low anterior resection0.020833
age >940.020833
oslo0.020833
age 30-400.020833
cron diet0.020833
age 13-140.020833
small village0.020833
Fraction of dbbact annotations with this term covered by the query
TermScore
taiwan0.750000
pig0.687500
age 30-500.666667
republic of china0.666667
tibet autonomous region0.666667
age 19-240.666667
cameroon0.666667
estonia0.666667
metabolic syndrome0.666667
nanchang city prefecture0.666667
pan troglodytes troglodytes0.666667
sus scrofa0.625000
LOWER IN crohn's disease0.545455
LOWER IN gout0.500000
suckling0.500000
preweaned0.500000
age 2-4 weeks0.500000
jordan0.500000
LOWER IN chronic fatigue syndrome0.500000
new york county0.500000
india0.500000
bihar state0.500000
autoimmune hepatitis0.500000
zhengzhou city prefecture0.500000
taoyuan city0.500000
LOWER IN hmong0.500000
LOWER IN hmong 2nd generation0.500000
obesity0.500000
salmonella gastroenteritis0.500000
midwest region0.500000
vegetarian diet0.500000
chengdu city prefecture0.500000
gestational age 8-12 weeks0.500000
athlete0.500000
coronary heart disease0.500000
santa catarina state0.500000
omnivore diet0.500000
indonesia0.500000
municipality of yogyakarta0.500000
yaounde0.500000
LOWER IN ngoantet0.500000
LOWER IN ulcerative colitis0.500000
LOWER IN insomnia0.500000
sri lanka0.500000
age 1-18 years0.500000
colombia0.500000
LOWER IN age 8 months0.500000
rhesus macaque0.500000
taipei city0.500000
municipality of reus0.500000
tanzania0.500000
pemba island0.500000
age 4-10 years0.500000
sesame allergy0.500000
novosibirsk0.500000
LOWER IN age 2-4 years0.500000
metabolic syndrome x0.500000
milk allergy0.500000
azerbaijan0.500000
ascending colon0.500000
salmonella enterica subsp. enterica serovar typhimurium0.500000
salmonellosis0.500000
province of alberta0.500000
third trimester0.500000
age 8-120.500000
LOWER IN inflammatory bowel disease0.500000
LOWER IN sucram0.500000
age 3-60.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
age 60-790.500000
age 6-10 weeks0.500000
chuquisaca department0.500000
low anterior resection0.500000
irritable bowel syndrome0.500000
age >940.500000
oslo0.500000
age 30-400.500000
gaz:000521000.500000
municipality of logrono0.500000
cron diet0.500000
age 13-140.500000
rem sleep behavior disorder0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
LOWER IN cuba0.500000
glasgow0.500000
el salvador0.500000
small village0.500000
LOWER IN finland0.500000
LOWER IN age 1-3 weeks0.500000
LOWER IN age 3-60.500000
age 130.500000
spondyloarthritis0.500000
spondylitis0.500000
zambia0.500000
papio kindae0.500000
kinda baboon0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.882979
homo sapiens0.776596
adult0.473404
china0.228723
control0.180851
united states of america0.180851
pig0.101064
sus scrofa0.095745
child0.095745
female0.069149
kingdom of spain0.047872
farm0.042553
city0.042553
wild0.042553
obsolete_juvenile stage0.037234
taiwan0.037234
obesity0.037234
male0.037234
research facility0.037234
monkey0.037234
rumen0.037234
caecum0.031915
jiangsu province0.031915
LOWER IN crohn's disease0.031915
india0.026596
pregnancy0.026596
rural community0.026596
infant0.026596
pan troglodytes troglodytes0.026596
age 30-500.021277
jiangxi province0.021277
republic of china0.021277
sweden0.021277
belgium0.021277
tibetan plateau0.021277
LOWER IN ulcerative colitis0.021277
state of california0.021277
israel0.021277
germany0.021277
united kingdom0.021277
bolivia0.021277
chuquisaca department0.021277
age 5-13 years0.021277
republic of congo0.021277
nouabale-ndoki national park0.021277
zoological garden0.021277
zhejiang province0.015957
guangzhou city prefecture0.015957
suckling0.015957
preweaned0.015957
age 2-4 weeks0.015957
italy0.015957
colon0.015957
south korea0.015957
tibet autonomous region0.015957
russia0.015957
indonesia0.015957
municipality of yogyakarta0.015957
cameroon0.015957
homosexual0.015957
msm0.015957
estonia0.015957
high bmi0.015957
colombia0.015957
taipei city0.015957
LOWER IN child0.015957
tanzania0.015957
nanchang city prefecture0.015957
poland0.015957
canada0.015957
diet0.015957
state of michigan0.015957
LOWER IN infant0.015957
LOWER IN finland0.015957
rectum0.015957
chimpanzee0.015957
age0.015957
bos grunniens0.015957
yak0.015957
ruminal fluid0.015957
alpine meadow0.015957
bos taurus0.015957
LOWER IN zoological garden0.015957
jordan0.010638
zhengzhou city prefecture0.010638
hiv infection0.010638
heterosexual0.010638
msw0.010638
age 19-240.010638
brazil0.010638
LOWER IN rural community0.010638
czech republic0.010638
gay0.010638
pemba island0.010638
food allergy0.010638
age 4-10 years0.010638
low bmi0.010638
metabolic syndrome0.010638
age 6 weeks0.010638
ascending colon0.010638
Exp. ID User ID Description Date Region Flag Sequences
597amnon high in control compared to gout in feces homo sapiens adult zhejiang province china 2020-03-23v3No1 / 4
707amnon high in control compared to systemic lupus erythematosus in feces homo sapiens female adult guangzhou city prefecture age 30-50 china 2028-04-11v3No1 / 19
521amnonhigh freq. in pre-weaned pigs (dominant feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 20
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child jordan obsolete_juvenile stage 2018-08-30v4No1 / 21
12amnon high in control compared to chronic fatigue syndrome in feces homo sapiens new york county 2016-11-02v4No1 / 35
570amnoncommon feces, homo sapiens, india, bihar state2019-12-16v3No1 / 46
597amnoncommon feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 46
720amnoncommon feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 48
796amnoncommon feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 51
400amnonlower in children of hmong migrands born in the usa compared to non-migrant usa people ( high in united states of america compared to hmong hmong 2nd generation in feces homo sapiens )2018-11-18v4No1 / 52
651amnon high in control compared to parkinson's disease in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 52
694amnoncommon feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 52
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
390amnoncommon feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 55
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
720amnoncommon feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 56
666amnoncommon feces, homo sapiens, italy2020-09-25v3No1 / 58
700amnon high in colon compared to caecum in control research facility sus scrofa belgium pig age 2 months 2028-04-01v3No1 / 59
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 60
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
637amnoncommon feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 61
593amnoncommon feces, homo sapiens, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
380amnoncommon feces, homo sapiens, adult, tibetan plateau, tibet autonomous region2018-10-03v4No1 / 63
575amnoncommon in professional martial arts athletes (common feces, homo sapiens, adult, high physical activity, age 19-24, china, athlete)2020-01-05v3No1 / 63
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
365amnoncommon feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 67
757amnoncommon feces, homo sapiens, adult, brazil, santa catarina state2021-03-28v3No1 / 67
574amnoncommon feces, homo sapiens, adult, russia2020-01-05v3No1 / 68
593amnoncommon feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 68
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
594amnon high in city yaounde compared to rural community ngoantet in feces homo sapiens adult cameroon 2020-03-12v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
394amnon high in control compared to ulcerative colitis in feces homo sapiens united states of america adult state of california 2018-11-06v4No1 / 71
566amnon high in control compared to insomnia in feces homo sapiens adult china 2019-11-24v4No1 / 71
656amnoncommon feces, homo sapiens, sri lanka, age 1-18 years2020-09-13v3No1 / 71
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 74
74amnoncommon feces, homo sapiens, united states of america2017-02-27v4No1 / 76
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
404amnoncommon feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 79
671amnon high in age 3 months age 6 months compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 79
529amnoncommon feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 79
732amnoncommon feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 79
736amnon high in female adult compared to child age 1-3 years in feces homo sapiens tanzania pemba island 2021-01-25v3No1 / 79
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 80
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, china2028-04-11v3No1 / 82
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 83
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
601amnoncommon feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 85
663amnoncommon feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 85
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 86
723amnonlower in children age 2-4 years compared to mothers ( high in adult compared to child age 2-4 years in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 87
487amnoncommon feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 88
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
736amnoncommon feces, homo sapiens, female, adult, tanzania, pemba island2021-01-25v3No1 / 95
238amnoncommon feces, homo sapiens, colombia2017-11-07v4No1 / 96
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
673amnoncommon research facility, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta, caecum2020-09-28v4No1 / 99
438amnoncommon feces, homo sapiens, age 19-24, china2018-12-30v4No1 / 101
477amnoncommon feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 103
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china2018-12-30v4No1 / 106
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
256amnonhigher in control diet compared to diet enriched with sucram in pig gut ( high in diet standard feed compared to sucram in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 109
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in feces homo sapiens united states of america child )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 60-79, china2018-12-30v4No1 / 111
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 112
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
517amnoncommon feces, homo sapiens, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 113
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 30-50, china2018-12-30v4No1 / 115
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in feces homo sapiens adult taipei city taiwan )2019-07-18v3No1 / 115
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china2018-12-30v4No1 / 121
449amnoncommon feces, homo sapiens, colombia2019-01-09v4No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in feces homo sapiens toronto )2016-10-27v4No1 / 125
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 125
779amnon high in control compared to crohn's disease in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 127
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, age 30-402018-05-13v4No1 / 130
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 132
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in farm caecum tibet autonomous region cecal content china 2018-04-10v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 136
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 141
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens adult china 2018-02-05v4No1 / 161
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
700amnoncommon feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 164
389amnon high in age 4 weeks compared to age 1-3 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 168
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in feces homo sapiens china )2018-12-30v4No1 / 168
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, age 13, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
197amnon high in india compared to finland in feces homo sapiens juvenile organism obsolete_juvenile stage age 13 2017-09-12v4No1 / 189
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
411amnoncommon feces, zambia, monkey, wild, papio kindae, kinda baboon2018-11-23v4No1 / 200
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v3No1 / 214
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
666amnoncommon feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 223
411amnoncommon feces, zambia, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
673amnon high in ascending colon caecum compared to ileum in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v4No1 / 228
620amnoncommon feces, wild, chimpanzee, pan troglodytes troglodytes, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 238
398amnon high in control compared to crohn's disease in feces homo sapiens belgium 2018-11-15v4No1 / 248
425amnon high in madagascar antananarivo compared to central african republic bangui in feces homo sapiens child africa 2018-12-08v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in feces homo sapiens infant india )2016-12-19v4No1 / 253
111amnoncommon ruminant reticulum, omasum, rumen, ovis aries, mongolian sheep, china2017-04-09v4No1 / 253
625amnoncommon feces, united states of america, zoological garden, state of minnesota, ateles geoffroyi, como zoo, black-handed spider monkey2020-05-16v4No1 / 256
561amnon high in summer grass growth diet compared to green stage diet spring in rumen tibetan plateau bos grunniens yak ruminal fluid china alpine meadow 2019-11-05v3No1 / 256
63amnon high in male compared to female in feces homo sapiens united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
261amnoncommon united states of america, rumen, bos taurus, state of nebraska, cow2017-12-10v4No1 / 266
688amnoncommon feces, research facility, sus scrofa, nanchang city prefecture, pig, china, duroc pig, age 140 days2028-03-09v4No1 / 278
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, age 50-60 years, china)2018-01-27v4No1 / 281
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 288
729amnon high in wild pan troglodytes troglodytes cameroon central chimpanzee compared to zoological garden captive europe pan troglodytes verus eastern chimpanzee in feces monkey 2021-01-05v3No1 / 288
411amnoncommon feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 292
561amnon high in summer grass growth diet compared to winter withered grass diet in rumen tibetan plateau bos grunniens yak ruminal fluid china alpine meadow 2019-11-05v3No1 / 294
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
723amnon high in age 2-4 years compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 306
190amnon high in dry season compared to wet season in feces homo sapiens tanzania hunter gatherer hadza 2017-09-04v4No1 / 311
399amnoncommon feces, united states of america, state of tennessee, zoological garden, sus scrofa, pig2018-11-16v4No1 / 319
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
111amnoncommon rectum, colon, ileum, ovis aries, mongolian sheep, cecum, china2017-04-09v4No1 / 330
532amnon high in control compared to short bowel syndrome in feces homo sapiens adult czech republic 2019-07-21v1No1 / 334
729amnoncommon feces, monkey, wild, pan troglodytes troglodytes, cameroon, central chimpanzee2021-01-05v3No1 / 336
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 347
620amnon high in wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park compared to united states of america zoological garden pan troglodytes in feces chimpanzee 2020-05-06v4No1 / 351
620amnon high in wild republic of congo nouabale-ndoki national park compared to united states of america zoological garden in feces gorilla gorilla gorilla 2020-05-06v4No1 / 368
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
816amnonhigher in sows in first pregnancy compared to later pregnancies ( high in first pregnancy compared to multiple pregnancies in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 374
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in diet cron diet caloric restriction diet compared to american diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
314amnoncommon farm, caecum, sus scrofa, tibet autonomous region, pig, cecal content, china2018-04-10v4No1 / 402
625amnoncommon feces, united states of america, zoological garden, state of minnesota, pongo abelii, sumatran orangutan, como zoo2020-05-16v4No1 / 414
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, grivet monkey2018-01-16v4No1 / 440
339amnon high in adult compared to infant age < 1 year in feces homo sapiens india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
620amnon high in chimpanzee pan troglodytes troglodytes compared to gorilla gorilla in feces wild republic of congo nouabale-ndoki national park 2020-05-06v4No1 / 478
256amnoncommon caecum, left colon, right colon, sus scrofa, pig, united kingdom2017-11-26v4No1 / 490
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
517amnon high in feces compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in feces homo sapiens china )2018-12-30v4No1 / 617
561amnoncommon rumen, tibetan plateau, bos grunniens, yak, ruminal fluid, china, alpine meadow2019-11-05v3No1 / 670
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
83amnoncommon rumen, bos taurus, ireland, holstein-friesian bull2017-03-05v4No1 / 757
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
83amnon high in control diet normal diet compared to restricted diet in rumen bos taurus ireland holstein-friesian bull 2017-03-05v4No1 / 1023

Problems / suggestions? Please email info AT dbbact DOT org