Search result for sequence:
TACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCAGTGCAAGTCAGATGTGAAAGGCCGGGGCTCAACCCCGGAGCTGCATTTGAAACTGCATAGCTAGAGTACAGGAGAGGCAGGCGGGAATCCTAG
common ontology terms
term enrichment score
TermScore
children0.500000
sigmoid colon0.400000
terminal ileum0.333333
biopsy0.222222
rectum0.166667
LOWER IN crohn's disease0.153846
obesity0.142857
high bmi0.133333
italy0.100000
colon0.086957
caecum0.054054
homo sapiens0.015686
control0.011696
united states of america0.008299
feces0.006734
Fraction of dbbact annotations with this term covered by the query
TermScore
children0.500000
sigmoid colon0.333333
terminal ileum0.250000
biopsy0.142857
rectum0.100000
LOWER IN crohn's disease0.090909
obesity0.083333
high bmi0.076923
italy0.055556
colon0.047619
caecum0.028571
homo sapiens0.007905
control0.005917
united states of america0.004184
feces0.003390
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
feces0.500000
italy0.500000
high bmi0.500000
obesity0.500000
control0.500000
LOWER IN crohn's disease0.500000
united states of america0.500000
rectum0.500000
caecum0.500000
colon0.500000
sigmoid colon0.500000
terminal ileum0.500000
biopsy0.500000
children0.500000

Problems / suggestions? Please email info AT dbbact DOT org