Search result for sequence:
TACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCAGTGCAAGTCAGATGTGAAAGGCCGGGGCTCAACCCCGGAGCTGCATTTGAAACTGCTCGGCTAGAGTACAGGAGAGGCAGGCGGAAATCCTAG
common ontology terms
term enrichment score
TermScore
cobb broiler chicken0.179487
gallus gallus0.179348
chicken0.179348
age 35 days0.164706
adult0.151883
feces0.142035
homo sapiens0.135407
republic of china0.126582
taiwan0.119048
kingdom of spain0.116883
heterosexual0.112360
msw0.112360
formula fed0.105263
sweden0.095238
south korea0.088889
hiv infection0.087719
indonesia0.085714
municipality of yogyakarta0.085714
midwest region0.085714
male0.082418
germany0.082305
child0.081744
russia0.078947
age 2 years0.078947
obesity0.078947
gay0.078947
female0.077170
italy0.073171
homosexual0.073171
msm0.073171
caecum0.066007
china0.063358
sigmoid colon0.059701
age 2-4 years0.059701
vegetarian diet0.058824
coronary heart disease0.058824
terminal ileum0.058824
jinzhou city prefecture0.058824
weaned0.058824
corn and soybean diet0.058824
age 4-7 weeks0.058824
madrid0.057143
age 30-500.057143
cameroon0.057143
biopsy0.056338
seoul0.055556
jiangxi province0.055556
LOWER IN infant0.054795
guangzhou city prefecture0.054054
jejunum0.054054
small intestine0.052632
broiler chicken0.052632
gorilla gorilla0.052632
czech republic0.051282
zhejiang province0.051282
cloaca0.048780
monkey0.047619
duodenum0.046512
LOWER IN ileum0.044444
zoological garden0.042553
sus scrofa0.041667
pig0.041667
captive0.040816
control0.037795
canada0.037736
research facility0.037453
wild0.035714
skin0.030769
age 25-50 years0.030303
omnivore diet0.030303
hexaprotodon liberiensis0.030303
pygmy hippopotamus0.030303
novosibirsk0.030303
LOWER IN age 7 months0.030303
glasgow0.030303
LOWER IN age 0-6 months0.030303
african lion safari0.030303
macropus rufus0.030303
red kangaroo0.030303
toronto zoo0.030303
LOWER IN europe0.030303
children0.030303
LOWER IN suckling0.030303
LOWER IN preweaned0.030303
LOWER IN age 2-4 weeks0.030303
farm0.029851
LOWER IN age 50-80 years0.029851
gout0.029851
shanghai district0.029851
LOWER IN kingdom of spain0.029851
rheumatoid arthritis0.029851
osteoarthritis0.029851
LOWER IN cloaca0.029851
viet nam0.029851
papio anubis0.029851
olive baboon0.029851
systemic lupus erythematosus0.029412
new zealand0.029412
LOWER IN gay0.029412
LOWER IN homosexual0.028986
Fraction of dbbact annotations with this term covered by the query
TermScore
sigmoid colon0.666667
age 2-4 years0.666667
indonesia0.500000
municipality of yogyakarta0.500000
vegetarian diet0.500000
cobb broiler chicken0.500000
coronary heart disease0.500000
midwest region0.500000
age 25-50 years0.500000
terminal ileum0.500000
omnivore diet0.500000
hexaprotodon liberiensis0.500000
pygmy hippopotamus0.500000
novosibirsk0.500000
LOWER IN age 7 months0.500000
glasgow0.500000
jinzhou city prefecture0.500000
weaned0.500000
corn and soybean diet0.500000
age 4-7 weeks0.500000
LOWER IN age 0-6 months0.500000
african lion safari0.500000
macropus rufus0.500000
red kangaroo0.500000
toronto zoo0.500000
LOWER IN europe0.500000
children0.500000
LOWER IN suckling0.500000
LOWER IN preweaned0.500000
LOWER IN age 2-4 weeks0.500000
madrid0.333333
republic of china0.333333
age 35 days0.333333
formula fed0.333333
LOWER IN age 50-80 years0.333333
gout0.333333
shanghai district0.333333
LOWER IN kingdom of spain0.333333
age 30-500.333333
rheumatoid arthritis0.333333
osteoarthritis0.333333
LOWER IN cloaca0.333333
viet nam0.333333
cameroon0.333333
papio anubis0.333333
olive baboon0.333333
biopsy0.285714
russia0.250000
taiwan0.250000
age 2 years0.250000
seoul0.250000
obesity0.250000
gay0.250000
systemic lupus erythematosus0.250000
new zealand0.250000
LOWER IN gay0.250000
jiangxi province0.250000
LOWER IN infant0.222222
heterosexual0.200000
msw0.200000
guangzhou city prefecture0.200000
jejunum0.200000
LOWER IN homosexual0.200000
LOWER IN msm0.200000
gallus gallus0.187500
chicken0.187500
italy0.166667
homosexual0.166667
msm0.166667
small intestine0.166667
broiler chicken0.166667
thailand0.166667
gorilla gorilla0.166667
south korea0.153846
czech republic0.142857
zhejiang province0.142857
cat0.142857
LOWER IN zoological garden0.142857
LOWER IN captive0.142857
LOWER IN age 1 year0.125000
felis catus0.111111
cloaca0.111111
kingdom of spain0.100000
hiv infection0.100000
age 1 year0.100000
monkey0.100000
rectum0.100000
duodenum0.090909
LOWER IN crohn's disease0.090909
adult0.088608
germany0.086957
child0.085714
pregnancy0.083333
feces0.077966
sweden0.076923
high bmi0.076923
LOWER IN ileum0.076923
homo sapiens0.075099
ileum0.066667
zoological garden0.066667
Fraction of annotations for the query sequences containing the term
TermScore
feces0.796875
homo sapiens0.687500
adult0.531250
male0.234375
gallus gallus0.171875
chicken0.171875
research facility0.156250
china0.156250
kingdom of spain0.140625
sweden0.125000
cobb broiler chicken0.109375
age 35 days0.109375
female0.093750
control0.093750
hiv infection0.078125
heterosexual0.078125
msw0.078125
taiwan0.078125
republic of china0.078125
caecum0.078125
child0.078125
germany0.078125
formula fed0.062500
united states of america0.062500
south korea0.062500
indonesia0.046875
municipality of yogyakarta0.046875
russia0.046875
age 2 years0.046875
midwest region0.046875
italy0.046875
obesity0.046875
gay0.046875
homosexual0.046875
msm0.046875
madrid0.031250
vegetarian diet0.031250
czech republic0.031250
coronary heart disease0.031250
seoul0.031250
sigmoid colon0.031250
terminal ileum0.031250
biopsy0.031250
zhejiang province0.031250
age 2-4 years0.031250
guangzhou city prefecture0.031250
age 30-500.031250
cloaca0.031250
LOWER IN infant0.031250
small intestine0.031250
duodenum0.031250
jejunum0.031250
jinzhou city prefecture0.031250
LOWER IN ileum0.031250
broiler chicken0.031250
farm0.031250
sus scrofa0.031250
jiangxi province0.031250
pig0.031250
weaned0.031250
corn and soybean diet0.031250
age 4-7 weeks0.031250
gorilla gorilla0.031250
monkey0.031250
wild0.031250
cameroon0.031250
zoological garden0.031250
skin0.031250
captive0.031250
canada0.031250
age 25-50 years0.015625
LOWER IN age 50-80 years0.015625
ileum0.015625
gout0.015625
shanghai district0.015625
LOWER IN kingdom of spain0.015625
systemic lupus erythematosus0.015625
pregnancy0.015625
rheumatoid arthritis0.015625
osteoarthritis0.015625
omnivore diet0.015625
hexaprotodon liberiensis0.015625
pygmy hippopotamus0.015625
high bmi0.015625
felis catus0.015625
new zealand0.015625
cat0.015625
novosibirsk0.015625
age 1 year0.015625
LOWER IN age 7 months0.015625
infant0.015625
LOWER IN age 1 year0.015625
glasgow0.015625
LOWER IN caecum0.015625
LOWER IN cloaca0.015625
LOWER IN gay0.015625
LOWER IN homosexual0.015625
LOWER IN msm0.015625
viet nam0.015625
LOWER IN age 0-6 months0.015625
Exp. ID User ID Description Date Region Flag Sequences
723amnondominant feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 16
630amnondominant feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 17
574amnondominant feces, homo sapiens, adult, russia2020-01-05v3No1 / 19
578amnondominant feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 20
734amnondominant feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 20
744amnondominant research facility, gallus gallus, male, chicken, caecum, cobb broiler chicken, age 35 days2021-02-21v3No1 / 21
552amnondominant feces, homo sapiens, czech republic2019-09-05v3No1 / 22
797amnondominant feces, homo sapiens, child, germany, formula fed, age 2 years2021-06-13v3No1 / 22
734amnondominant feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 23
745amnondominant feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 24
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 26
681amnondominant feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 31
745amnon high in age 25-50 years compared to age 50-80 years in feces homo sapiens united states of america adult midwest region 2021-02-25v3No1 / 32
681amnoncommon feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 37
744amnoncommon research facility, ileum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 38
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
597amnoncommon feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 46
797amnoncommon feces, homo sapiens, child, germany, formula fed, age 2 years2021-06-13v3No1 / 46
597amnoncommon feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 47
564amnoncommon feces, homo sapiens, control, child, italy, age 2-4 years2019-11-18v3No1 / 50
694amnoncommon feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 52
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
578amnon high in sweden compared to kingdom of spain in feces homo sapiens hiv infection adult gay homosexual msm male 2020-01-14v3No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, systemic lupus erythematosus, china2028-04-11v3No1 / 55
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 60
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
593amnoncommon feces, homo sapiens, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
574amnoncommon feces, homo sapiens, adult, russia2020-01-05v3No1 / 68
593amnoncommon feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 68
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 74
666amnoncommon feces, italy, hexaprotodon liberiensis, pygmy hippopotamus2020-09-25v3No1 / 76
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, china2028-04-11v3No1 / 82
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
668amnoncommon feces, research facility, felis catus, new zealand, cat2020-09-26v3No1 / 85
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
797amnon high in age 1 year compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
744amnoncommon research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 114
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 132
797amnon high in child age 2 years compared to infant age 1 year in feces homo sapiens germany formula fed 2021-06-13v3No1 / 139
744amnoncommon research facility, gallus gallus, male, chicken, caecum, cobb broiler chicken, age 35 days2021-02-21v3No1 / 141
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
780amnon high in small intestine duodenum jejunum compared to caecum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 153
744amnon high in caecum compared to cloaca in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 187
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 220
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
744amnon high in cloaca compared to ileum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 265
568amnoncommon feces, gallus gallus, chicken, broiler chicken, viet nam2019-12-08v3No1 / 272
744amnon high in caecum compared to ileum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 286
521amnonhigh freq. in weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 288
723amnon high in age 2-4 years compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
568amnoncommon feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 320
729amnoncommon feces, gorilla gorilla, monkey, wild, cameroon2021-01-05v3No1 / 321
565amnoncommon zoological garden, skin, captive, canada, african lion safari, macropus rufus, red kangaroo2019-11-21v3No1 / 360
565amnoncommon zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 368
729amnon high in wild cameroon compared to zoological garden captive europe in feces gorilla gorilla monkey 2021-01-05v3No1 / 383
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned corn and soybean diet age 4-7 weeks compared to suckling preweaned age 2-4 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 681

Problems / suggestions? Please email info AT dbbact DOT org