Search result for sequence:
TACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCAGTGCAAGTCAGATGTGAAAGGCCGGGGCTCAACCCCGGAGCTGCATTTGAAACTGCTCGGCTAGAGTACAGGAGAGGCAGGCGGGAATCCTAG
common ontology terms
term enrichment score
TermScore
glasgow0.400000
children0.400000
sigmoid colon0.333333
terminal ileum0.285714
biopsy0.200000
rectum0.153846
LOWER IN crohn's disease0.142857
obesity0.133333
high bmi0.125000
italy0.095238
colon0.083333
caecum0.052632
homo sapiens0.023438
feces0.013423
adult0.012422
control0.011628
united states of america0.008264
Fraction of dbbact annotations with this term covered by the query
TermScore
glasgow0.500000
children0.500000
sigmoid colon0.333333
terminal ileum0.250000
biopsy0.142857
rectum0.100000
LOWER IN crohn's disease0.090909
obesity0.083333
high bmi0.076923
italy0.055556
colon0.047619
caecum0.028571
homo sapiens0.011858
feces0.006780
adult0.006329
control0.005917
united states of america0.004184
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
feces0.666667
italy0.333333
high bmi0.333333
obesity0.333333
adult0.333333
glasgow0.333333
control0.333333
LOWER IN crohn's disease0.333333
united states of america0.333333
rectum0.333333
caecum0.333333
colon0.333333
sigmoid colon0.333333
terminal ileum0.333333
biopsy0.333333
children0.333333

Problems / suggestions? Please email info AT dbbact DOT org