Search result for sequence:
TACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCAGTGCAAGTCAGATGTGAAAGGCCGGGGCTCAACCCCGGAGCTGCATTTGAAACTGCTCGGCTAGAGTACAGGAGAGGCAGGCGGGATTCCTAG
common ontology terms
term enrichment score
TermScore
glasgow0.222222
children0.222222
LOWER IN crohn's disease0.222222
sigmoid colon0.200000
LOWER IN age <1 year0.200000
terminal ileum0.181818
age > 1 year0.181818
belgium0.173913
biopsy0.142857
finland0.142857
rectum0.117647
obesity0.105263
high bmi0.100000
italy0.080000
colon0.071429
age0.071429
infant0.064516
caecum0.047619
homo sapiens0.046332
feces0.033241
adult0.024242
control0.023033
united states of america0.016260
Fraction of dbbact annotations with this term covered by the query
TermScore
glasgow0.500000
children0.500000
sigmoid colon0.333333
LOWER IN age <1 year0.333333
terminal ileum0.250000
age > 1 year0.250000
LOWER IN crohn's disease0.181818
biopsy0.142857
finland0.142857
belgium0.125000
rectum0.100000
obesity0.083333
high bmi0.076923
italy0.055556
colon0.047619
age0.047619
infant0.041667
caecum0.028571
homo sapiens0.023715
feces0.016949
adult0.012658
control0.011834
united states of america0.008368
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
feces0.857143
control0.428571
adult0.285714
belgium0.285714
united states of america0.285714
LOWER IN crohn's disease0.285714
italy0.142857
high bmi0.142857
obesity0.142857
glasgow0.142857
rectum0.142857
caecum0.142857
colon0.142857
sigmoid colon0.142857
terminal ileum0.142857
biopsy0.142857
children0.142857
age0.142857
age > 1 year0.142857
LOWER IN age <1 year0.142857
infant0.142857
finland0.142857

Problems / suggestions? Please email info AT dbbact DOT org