Search result for sequence:
TACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCAGTGCAAGTCAGATGTGAAAGGCCGGGGCTCAACCCCGGAGCTGCATTTGAAACTGCTCGGCTAGAGTACAGGAGAGGCAGGCGGGATTTCTAG
common ontology terms
term enrichment score
TermScore
glasgow0.333333
children0.333333
sigmoid colon0.285714
LOWER IN age <1 year0.285714
terminal ileum0.250000
age > 1 year0.250000
biopsy0.181818
finland0.181818
rectum0.142857
LOWER IN crohn's disease0.133333
obesity0.125000
high bmi0.117647
italy0.090909
colon0.080000
age0.080000
infant0.071429
caecum0.051282
homo sapiens0.031128
feces0.020067
adult0.012346
control0.011561
united states of america0.008230
Fraction of dbbact annotations with this term covered by the query
TermScore
glasgow0.500000
children0.500000
sigmoid colon0.333333
LOWER IN age <1 year0.333333
terminal ileum0.250000
age > 1 year0.250000
biopsy0.142857
finland0.142857
rectum0.100000
LOWER IN crohn's disease0.090909
obesity0.083333
high bmi0.076923
italy0.055556
colon0.047619
age0.047619
infant0.041667
caecum0.028571
homo sapiens0.015810
feces0.010169
adult0.006329
control0.005917
united states of america0.004184
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
feces0.750000
italy0.250000
high bmi0.250000
obesity0.250000
adult0.250000
glasgow0.250000
control0.250000
LOWER IN crohn's disease0.250000
united states of america0.250000
rectum0.250000
caecum0.250000
colon0.250000
sigmoid colon0.250000
terminal ileum0.250000
biopsy0.250000
children0.250000
age0.250000
age > 1 year0.250000
LOWER IN age <1 year0.250000
infant0.250000
finland0.250000

Problems / suggestions? Please email info AT dbbact DOT org