Search result for sequence:
TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGAAGGCTAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGGTCATCTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.619798
feces0.618654
adult0.485194
united states of america0.228640
china0.187581
child0.180344
control0.161015
rural community0.108155
female0.093971
monkey0.087805
infant0.087167
sus scrofa0.076596
macaca mulatta0.075949
kingdom of spain0.073555
obesity0.072980
obsolete_juvenile stage0.071247
pig0.071247
zoological garden0.070000
research facility0.069716
germany0.069124
italy0.063137
captive0.061868
city0.060991
caecum0.060465
male0.053933
taiwan0.052863
biopsy0.052770
guangzhou city prefecture0.052402
rectum0.046997
rhesus macaque0.046997
colon0.044687
high bmi0.041472
wild0.039663
biopsy site0.037400
republic of china0.037284
homosexual0.037284
msm0.037284
india0.037214
pregnancy0.036269
formula fed0.036269
state of california0.034398
farm0.033816
gay0.032172
estonia0.032086
age 30-500.032086
age 5-13 years0.032086
ulcerative colitis0.031932
LOWER IN crohn's disease0.031915
himalayas0.031830
age 1 year0.031579
nepal0.031332
africa0.030848
state of new york0.030848
united kingdom0.030848
ovis aries0.030848
sweden0.029703
jiangsu province0.029484
heterosexual0.026936
msw0.026936
cayo santiago0.026667
indian rhesus macaque0.026667
chuquisaca department0.026667
chimpanzee0.026667
gorilla gorilla0.026667
age 50-80 years0.026490
age 6 weeks0.026490
zhejiang province0.026144
state of colorado0.025974
puerto rico0.025974
bolivia0.025974
south korea0.025862
LOWER IN female0.025773
canada0.025000
australia0.023952
small village0.021602
obese body mass index status0.021602
hunter gatherer0.021602
age 2-4 years0.021563
colombia0.021563
tibet autonomous region0.021563
republic of congo0.021448
nouabale-ndoki national park0.021448
taoyuan city0.021448
lepus europaeus0.021448
zhengzhou city prefecture0.021448
type 2 diabetes mellitus0.021448
age 60-790.021448
rectal swab0.021333
LOWER IN duodenum0.021333
russia0.021295
kingdom of denmark0.021108
age 2 years0.020997
hiv infection0.020779
age0.020725
israel0.020151
skin0.019560
metabolic syndrome0.016238
village0.016238
age 19-240.016238
sigmoid colon0.016238
Fraction of dbbact annotations with this term covered by the query
TermScore
rural community0.900000
heterosexual0.800000
msw0.800000
biopsy site0.750000
small village0.750000
obesity0.750000
taiwan0.750000
obese body mass index status0.750000
gay0.750000
hunter gatherer0.750000
biopsy0.714286
metabolic syndrome0.666667
village0.666667
age 2-4 years0.666667
estonia0.666667
republic of china0.666667
age 19-240.666667
LOWER IN age 2 months0.666667
sigmoid colon0.666667
colombia0.666667
overweight body mass index status0.666667
age 30-500.666667
tibet autonomous region0.666667
state of oklahoma0.666667
nigeria0.666667
homosexual0.666667
msm0.666667
age 5-13 years0.666667
nanchang city prefecture0.666667
age 30 days0.666667
venezuela0.666667
amerindian0.666667
cameroon0.666667
pan troglodytes troglodytes0.666667
papio anubis0.666667
olive baboon0.666667
india0.625000
guangzhou city prefecture0.600000
sus scrofa0.562500
ulcerative colitis0.555556
LOWER IN crohn's disease0.545455
homo sapiens0.513834
adult0.506329
LOWER IN high arabinoxylan and resistant starch diet0.500000
LOWER IN arabinoxylan diet0.500000
republic of congo0.500000
nouabale-ndoki national park0.500000
sudan0.500000
obsolete_juvenile stage0.500000
bangui0.500000
chengdu city prefecture0.500000
gestational age 8-12 weeks0.500000
municipality of reus0.500000
taoyuan city0.500000
breast fed0.500000
raji0.500000
himalayas0.500000
nature reserve0.500000
lepus europaeus0.500000
european brown hare0.500000
autoimmune hepatitis0.500000
zhengzhou city prefecture0.500000
jordan0.500000
athlete0.500000
stroke0.500000
type 2 diabetes mellitus0.500000
felis silvestris0.500000
wild cat0.500000
inflammatory bowel disease0.500000
graves' disease0.500000
mild0.500000
LOWER IN severe0.500000
rectum0.500000
taipei city0.500000
state of alabama0.500000
age 7 months0.500000
LOWER IN plant based diet0.500000
oslo0.500000
terminal ileum0.500000
children0.500000
LOWER IN endospore enriched fraction0.500000
LOWER IN lysis0.500000
age one year0.500000
bihar state0.500000
daycare0.500000
age 1-5 years0.500000
tanzania0.500000
age 1-3 years0.500000
pemba island0.500000
salmonella gastroenteritis0.500000
age 50-70 years0.500000
midwest region0.500000
vegetarian diet0.500000
schizophrenia0.500000
cheyenne0.500000
native american0.500000
arapaho0.500000
coronary heart disease0.500000
santa catarina state0.500000
omnivore diet0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.876712
homo sapiens0.780822
adult0.465753
united states of america0.252055
china0.197260
control0.136986
child0.112329
research facility0.063014
female0.060274
rural community0.057534
infant0.049315
monkey0.049315
kingdom of spain0.041096
germany0.041096
macaca mulatta0.041096
sus scrofa0.041096
obsolete_juvenile stage0.038356
obesity0.038356
pig0.038356
zoological garden0.038356
italy0.035616
caecum0.035616
captive0.035616
city0.032877
male0.032877
biopsy0.027397
taiwan0.027397
guangzhou city prefecture0.027397
rectum0.024658
colon0.024658
rhesus macaque0.024658
high bmi0.021918
wild0.021918
biopsy site0.019178
pregnancy0.019178
republic of china0.019178
formula fed0.019178
state of california0.019178
india0.019178
homosexual0.019178
msm0.019178
farm0.019178
africa0.016438
estonia0.016438
nepal0.016438
himalayas0.016438
ulcerative colitis0.016438
age 1 year0.016438
state of new york0.016438
sweden0.016438
age 30-500.016438
gay0.016438
united kingdom0.016438
age 5-13 years0.016438
ovis aries0.016438
jiangsu province0.016438
LOWER IN crohn's disease0.016438
australia0.013699
zhejiang province0.013699
age 50-80 years0.013699
LOWER IN female0.013699
south korea0.013699
heterosexual0.013699
msw0.013699
state of colorado0.013699
canada0.013699
age 6 weeks0.013699
cayo santiago0.013699
puerto rico0.013699
indian rhesus macaque0.013699
bolivia0.013699
chuquisaca department0.013699
chimpanzee0.013699
gorilla gorilla0.013699
kingdom of denmark0.010959
republic of congo0.010959
nouabale-ndoki national park0.010959
small village0.010959
age 2-4 years0.010959
russia0.010959
taoyuan city0.010959
age 2 years0.010959
lepus europaeus0.010959
zhengzhou city prefecture0.010959
type 2 diabetes mellitus0.010959
colombia0.010959
hiv infection0.010959
obese body mass index status0.010959
tibet autonomous region0.010959
rectal swab0.010959
israel0.010959
age 60-790.010959
hunter gatherer0.010959
skin0.010959
age0.010959
LOWER IN duodenum0.010959
metabolic syndrome0.008219
village0.008219
central african republic0.008219
bangui0.008219
Exp. ID User ID Description Date Region Flag Sequences
467amnonlower in arabinoxylan and resistant starch diet compared to normal diet ( high in control diet compared to high fiber plant fiber cell high arabinoxylan and resistant starch diet arabinoxylan diet in feces homo sapiens metabolic syndrome adult kingdom of denmark )2019-01-14v4No1 / 9
620amnondominant feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 13
51amnonlower in stool compared to biopsies ( high in biopsy site biopsy compared to feces in homo sapiens united states of america )2017-01-19v4No1 / 14
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child sudan obsolete_juvenile stage 2018-08-30v4No1 / 14
425amnondominant feces, homo sapiens, child, africa, central african republic, bangui2018-12-08v4No1 / 15
51amnondominant homo sapiens, united states of america, biopsy site, biopsy2017-01-19v4No1 / 16
290amnondominant feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 17
564amnondominant feces, homo sapiens, control, child, italy, age 2-4 years2019-11-18v3No1 / 18
627amnondominant feces, female, pregnancy, adult, china2020-05-16v3No1 / 18
799amnondominant in obese participant fecal samples before ketogenic diet (dominant feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 18
799amnondominant in obese participant fecal samples after 1 month ketogenic diet (dominant feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 18
62amnondominant feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 19
292amnondominant feces, homo sapiens, control, adult, china2018-02-05v4No1 / 19
574amnondominant feces, homo sapiens, adult, russia2020-01-05v3No1 / 19
637amnondominant feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 19
732amnondominant feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 19
796amnondominant feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 19
797amnondominant feces, homo sapiens, child, germany, breast fed, age 2 years2021-06-13v3No1 / 19
477amnondominant feces, homo sapiens, raji, nepal, himalayas, rural community2019-01-29v4No1 / 20
639amnondominant feces, nature reserve, adult, australia, wild, lepus europaeus, european brown hare2020-08-21v3No1 / 20
720amnondominant feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 20
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child jordan obsolete_juvenile stage 2018-08-30v4No1 / 21
575amnonhigh freq. in professional martial arts athletes (dominant feces, homo sapiens, adult, high physical activity, age 19-24, china, athlete)2020-01-05v3No1 / 21
597amnondominant feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 21
720amnondominant feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 21
779amnondominant feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 22
333amnonhigh freq. in stroke patient feces (dominant feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 22
552amnondominant feces, homo sapiens, czech republic2019-09-05v3No1 / 22
713amnoncommon feces, homo sapiens, remission, crohn's disease2028-05-21v3No1 / 22
797amnondominant feces, homo sapiens, child, germany, formula fed, age 2 years2021-06-13v3No1 / 22
601amnondominant feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 23
779amnondominant feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 23
666amnondominant feces, homo sapiens, italy2020-09-25v3No1 / 23
694amnondominant feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, age 1 year, formula fed2021-06-13v3No1 / 23
241amnoncommon in babies age < 3 years in estonia (common feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 24
566amnondominant feces, homo sapiens, adult, china2019-11-24v4No1 / 24
601amnon high in type 2 diabetes mellitus compared to control in feces homo sapiens adult china 2020-03-30v4No1 / 24
597amnondominant feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 24
666amnondominant feces, italy, felis silvestris, wild cat2020-09-25v3No1 / 24
290amnondominant feces, homo sapiens, city, adult, china2018-02-01v4No1 / 25
395amnoncommon feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 25
779amnoncommon feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 25
796amnondominant feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 25
797amnondominant feces, homo sapiens, infant, germany, age 1 year, formula fed2021-06-13v3No1 / 25
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens united states of america rectum biopsy site child biopsy )2018-11-22v4No1 / 26
601amnondominant feces, homo sapiens, control, adult, china2020-03-30v4No1 / 27
529amnondominant feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 27
591amnon high in control compared to parkinson's disease in feces homo sapiens united states of america adult age 50-80 years 2020-02-17v4No1 / 30
651amnon high in male compared to female in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 31
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 31
63amnon high in diet animal product diet compared to plant based diet in feces homo sapiens united states of america 2017-04-12v4No1 / 32
131amnon high in male compared to female in feces homo sapiens south korea 2017-04-16v4No1 / 34
284amnon high in age 1 year compared to age 2 months in feces homo sapiens female infant state of california 2018-01-27v4No1 / 35
51amnoncommon homo sapiens, united states of america, biopsy site, biopsy2017-01-19v4No1 / 36
390amnoncommon feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 38
330amnoncommon feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year2018-05-13v4No1 / 39
19amnoncommon in biopsies of children (IBD study) (common homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 40
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in feces homo sapiens united states of america adult )2018-11-18v4No1 / 41
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, age 2-4 years2019-11-18v3No1 / 42
36amnoncommon feces, homo sapiens, sichuan province2016-12-06v4No1 / 44
241amnoncommon in babies age < 3 years in russia (common feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 44
797amnon high in age 7 months compared to age 3 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 44
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one year2018-01-14v4No1 / 46
570amnoncommon feces, homo sapiens, india, bihar state2019-12-16v3No1 / 46
597amnoncommon feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 46
797amnoncommon feces, homo sapiens, child, germany, formula fed, age 2 years2021-06-13v3No1 / 46
482amnoncommon feces, homo sapiens, child, colombia, medellin metropolitan area, daycare, age 1-5 years2019-02-12v4No1 / 47
591amnoncommon feces, homo sapiens, united states of america, adult, age 50-80 years, parkinson's disease2020-02-17v4No1 / 47
779amnoncommon feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 47
597amnoncommon feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 47
720amnoncommon feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 48
736amnoncommon feces, homo sapiens, child, tanzania, age 1-3 years, pemba island2021-01-25v3No1 / 49
564amnoncommon feces, homo sapiens, control, child, italy, age 2-4 years2019-11-18v3No1 / 50
797amnoncommon feces, homo sapiens, child, germany, breast fed, age 2 years2021-06-13v3No1 / 50
796amnoncommon feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 51
650amnoncommon feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 52
694amnoncommon feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 52
796amnoncommon feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 52
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
390amnoncommon feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 55
814amnoncommon feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, systemic lupus erythematosus, china2028-04-11v3No1 / 55
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
591amnoncommon feces, homo sapiens, control, united states of america, adult, age 50-80 years2020-02-17v4No1 / 56
650amnoncommon feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 56
720amnoncommon feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 56
651amnoncommon feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 58
666amnoncommon feces, homo sapiens, italy2020-09-25v3No1 / 58
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 60
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
637amnoncommon feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 61
593amnoncommon feces, homo sapiens, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
380amnoncommon feces, homo sapiens, adult, tibetan plateau, tibet autonomous region2018-10-03v4No1 / 63
502amnoncommon feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 63
575amnoncommon in professional martial arts athletes (common feces, homo sapiens, adult, high physical activity, age 19-24, china, athlete)2020-01-05v3No1 / 63
242amnoncommon in native-americans (common feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 65
365amnoncommon feces, homo sapiens, child, nigeria, obsolete_juvenile stage2018-08-30v4No1 / 66
650amnoncommon feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 66
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
365amnoncommon feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 67
757amnoncommon feces, homo sapiens, adult, brazil, santa catarina state2021-03-28v3No1 / 67
574amnoncommon feces, homo sapiens, adult, russia2020-01-05v3No1 / 68
593amnoncommon feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 68
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
803amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, age 50-80 years, type 2 diabetes mellitus, caribbean latino2021-06-18v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
644amnoncommon feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 71
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, switzerland2020-09-22v4No1 / 71
656amnoncommon feces, homo sapiens, sri lanka, age 1-18 years2020-09-13v3No1 / 71
425amnoncommon feces, homo sapiens, child, africa, madagascar, antananarivo2018-12-08v4No1 / 73
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 74
395amnoncommon feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 75
794amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, human immunodeficiency virus infectious disease, municipality of logrono, antiretroviral therapy2021-06-08v4No1 / 75
74amnoncommon feces, homo sapiens, united states of america2017-02-27v4No1 / 76
477amnoncommon feces, homo sapiens, nepal, himalayas, rural community, raute2019-01-29v4No1 / 76
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, age 17-292019-02-13v4No1 / 76
666amnoncommon feces, tursiops truncatus, italy, rectal swab, common bottlenose dolphin2020-09-25v3No1 / 76
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 77
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 77
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
401amnoncommon feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 79
425amnoncommon feces, homo sapiens, child, africa, central african republic, bangui2018-12-08v4No1 / 79
529amnoncommon feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 79
732amnoncommon feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 79
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 80
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
339amnoncommon feces, homo sapiens, adult, india2018-05-24v4No1 / 81
643amnoncommon feces, homo sapiens, adult, south korea2020-08-30v4No1 / 81
671amnoncommon feces, united states of america, research facility, macaca mulatta, age 1 month, monkey, captive, rhesus macaque2020-09-27v4No1 / 81
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 82
562amnoncommon feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 82
650amnon high in male compared to female in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 82
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, china2028-04-11v3No1 / 82
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in feces homo sapiens adult nanning city prefecture age 50-60 years china )2018-01-27v4No1 / 83
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 83
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
601amnoncommon feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 85
663amnoncommon feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 85
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
249amnoncommon feces, homo sapiens, united states of america2017-11-22v4No1 / 86
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 86
344amnoncommon in feces of homosexual males (common feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 87
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, age 202018-12-15v4No1 / 87
477amnoncommon feces, homo sapiens, raji, nepal, himalayas, rural community2019-01-29v4No1 / 88
487amnoncommon feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 88
293amnoncommon feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 89
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 89
803amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, age 50-80 years, caribbean latino2021-06-18v4No1 / 89
666amnoncommon feces, italy, felis silvestris, wild cat2020-09-25v3No1 / 91
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
668amnon high in age 5 years compared to age 4 months in feces research facility felis catus new zealand cat 2020-09-26v3No1 / 92
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
363amnoncommon dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 94
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 94
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 95
736amnoncommon feces, homo sapiens, female, adult, tanzania, pemba island2021-01-25v3No1 / 95
238amnoncommon feces, homo sapiens, colombia2017-11-07v4No1 / 96
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 97
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, forager, rural community, chepang2019-01-28v4No1 / 97
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 97
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
673amnoncommon research facility, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta, caecum2020-09-28v4No1 / 99
363amnon high in rectum caecum colon compared to ruminant reticulum omasum rumen in dairy ovis aries italy obsolete_juvenile stage age 30 days 2018-08-29v4No1 / 101
438amnoncommon feces, homo sapiens, age 19-24, china2018-12-30v4No1 / 101
477amnoncommon feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 103
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china2018-12-30v4No1 / 106
797amnon high in age 1 year compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
409amnoncommon feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 108
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in feces homo sapiens united states of america child )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 60-79, china2018-12-30v4No1 / 111
477amnon high in nepal himalayas rural community compared to united states of america in feces homo sapiens adult 2019-01-28v4No1 / 111
770amnon high in infant age < 1 year compared to age 10-15 years adult organism in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 111
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
517amnoncommon feces, homo sapiens, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 30-50, china2018-12-30v4No1 / 115
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, age 6 months, captive, rhesus macaque2020-09-27v4No1 / 117
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy site biopsy compared to feces in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 118
743amnoncommon feces, farm, adult, italy, captive, lepus europaeus, european hare2021-02-21v3No1 / 119
212amnoncommon feces, control, united states of america, research facility, mus musculus, lean body mass, mouse2017-10-22v4No1 / 120
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
371amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china2018-12-30v4No1 / 121
517amnoncommon homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 121
425amnoncommon homo sapiens, duodenum, child, africa, madagascar, antananarivo2018-12-08v4No1 / 123
660amnoncommon feces, homo sapiens, ecuador, rural community, village, shuar population2020-09-20v4No1 / 123
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay homosexual msm compared to heterosexual msw in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 124
449amnoncommon feces, homo sapiens, colombia2019-01-09v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to child obsolete_juvenile stage crohn's disease in feces homo sapiens glasgow )2017-02-26v4No1 / 125
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 125
779amnon high in control compared to crohn's disease in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 127
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, age 30-402018-05-13v4No1 / 130
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
39amnoncommon in obese lepr-db mice (common feces, research facility, mus musculus, obesity)2016-12-09v4No1 / 132
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 132
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 132017-09-12v4No1 / 136
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in farm caecum tibet autonomous region cecal content china 2018-04-10v4No1 / 136
594amnoncommon feces, homo sapiens, adult, rural community, cameroon, ngoantet2020-03-12v4No1 / 136
212amnoncommon feces, united states of america, research facility, mus musculus, obese body mass index status, mouse, db/db mouse, obesity2017-10-22v4No1 / 137
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
770amnon high in vagina female organism compared to penis male organism in macaca mulatta age > 1 year cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america )2017-04-11v4No1 / 139
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 141
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
509amnoncommon feces, homo sapiens, child, nigeria, kebbi state, rural community, age 10-15 years, schistosomiasis, urinary schistosomiasis2019-03-18v4No1 / 146
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
509amnoncommon feces, homo sapiens, control, child, nigeria, kebbi state, rural community, age 10-15 years2019-03-18v4No1 / 147
594amnoncommon feces, homo sapiens, city, adult, cameroon, yaounde2020-03-12v4No1 / 154
673amnoncommon control, research facility, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, province of alberta, caecum2020-09-28v4No1 / 154
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, bile, gallbladder, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens adult china 2018-02-05v4No1 / 161
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 162
389amnon high in age 4 weeks compared to age 1-3 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 168
190amnoncommon feces, homo sapiens, tanzania, hunter gatherer, hadza2017-09-04v4No1 / 169
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
770amnoncommon vagina, macaca mulatta, age > 1 year, female organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 169
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, age 13, india2017-09-12v4No1 / 170
671amnoncommon feces, united states of america, research facility, macaca mulatta, age 3 months, monkey, captive, rhesus macaque2020-09-27v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in feces homo sapiens infant )2017-11-13v4No1 / 173
671amnon high in age 8 months compared to female adult in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 182
639amnoncommon feces, nature reserve, adult, australia, wild, lepus europaeus, european brown hare2020-08-21v3No1 / 182
107amnoncommon united states of america, research facility, colon, texas, eublepharis macularius, leopard gecko2017-04-07v4No1 / 183
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
197amnon high in india compared to finland in feces homo sapiens juvenile organism obsolete_juvenile stage age 13 2017-09-12v4No1 / 189
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
620amnoncommon feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 197
411amnoncommon feces, zambia, monkey, wild, papio kindae, kinda baboon2018-11-23v4No1 / 200
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in feces homo sapiens china )2018-12-30v4No1 / 203
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
669amnon high in age 1 year compared to age 2 months in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v3No1 / 214
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
673amnon high in ascending colon caecum compared to ileum in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v4No1 / 228
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
639amnon high in lepus europaeus european brown hare compared to oryctolagus cuniculus european rabbit in feces nature reserve adult australia wild 2020-08-21v3No1 / 235
620amnoncommon feces, wild, chimpanzee, pan troglodytes troglodytes, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, age 50-60 years, nephrolithiasis, china)2018-01-27v4No1 / 239
398amnon high in control compared to crohn's disease in feces homo sapiens belgium 2018-11-15v4No1 / 248
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, age 8 months2020-09-27v4No1 / 252
666amnoncommon feces, oryctolagus cuniculus, italy, european rabbit2020-09-25v3No1 / 252
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in feces homo sapiens infant india )2016-12-19v4No1 / 253
63amnon high in male compared to female in feces homo sapiens united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 263
688amnoncommon feces, research facility, sus scrofa, nanchang city prefecture, pig, china, duroc pig, age 140 days2028-03-09v4No1 / 278
770amnoncommon feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 280
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, age 50-60 years, china)2018-01-27v4No1 / 281
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 288
411amnoncommon feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 292
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
723amnon high in age 2-4 years compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
510amnoncommon estuary, water, fresh water, kingdom of spain, estuary water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
111amnoncommon rectum, colon, ileum, ovis aries, mongolian sheep, cecum, china2017-04-09v4No1 / 330
729amnoncommon feces, monkey, wild, pan troglodytes troglodytes, cameroon, central chimpanzee2021-01-05v3No1 / 336
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
729amnoncommon feces, zoological garden, monkey, europe, pan troglodytes verus, western chimpanzee2021-01-05v3No1 / 343
671amnon high in state of california compared to state of oregon in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 355
671amnoncommon feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 356
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chicago, chimpanzee, lincoln park zoo2020-05-06v4No1 / 358
759amnoncommon feces, united states of america, sus scrofa, state of alabama, wild, wild boar2021-04-04v4No1 / 362
565amnoncommon zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 368
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
816amnonhigher in sows in first pregnancy compared to later pregnancies ( high in first pregnancy compared to multiple pregnancies in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 374
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in feces homo sapiens )2018-11-18v4No1 / 378
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
620amnoncommon feces, united states of america, zoological garden, gorilla gorilla, chicago, lincoln park zoo2020-05-06v4No1 / 384
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, state of tennessee, zoological garden, gorilla gorilla2018-11-16v4No1 / 395
770amnoncommon feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 396
314amnoncommon farm, caecum, sus scrofa, tibet autonomous region, pig, cecal content, china2018-04-10v4No1 / 402
399amnoncommon feces, united states of america, state of tennessee, zoological garden, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon feces, united states of america, state of tennessee, zoological garden, pan troglodytes, chimpanzee2018-11-16v4No1 / 407
625amnoncommon feces, united states of america, zoological garden, state of minnesota, pongo abelii, sumatran orangutan, como zoo2020-05-16v4No1 / 414
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chimpanzee, saint louis, saint louis zoo2020-05-06v4No1 / 433
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, grivet monkey2018-01-16v4No1 / 440
75amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, vervet monkey2018-01-16v4No1 / 446
424amnoncommon feces, farm, sus scrofa, jinhua city prefecture, pig, jinhua pig, china2018-12-06v4No1 / 452
339amnon high in adult compared to infant age < 1 year in feces homo sapiens india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
111amnon high in rectum caecum colon ileum compared to ruminant reticulum omasum rumen in ovis aries mongolian sheep china 2017-04-09v4No1 / 464
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
738amnon high in age 30 days compared to age 1 week in gallus gallus chicken united kingdom caecum 2021-01-30v3No1 / 474
620amnon high in chimpanzee pan troglodytes troglodytes compared to gorilla gorilla in feces wild republic of congo nouabale-ndoki national park 2020-05-06v4No1 / 478
438amnon high in adult age 30-50 age 60-79 compared to child age 3-6 age 8-12 in feces homo sapiens china 2018-12-30v4No1 / 486
274amnoncommon feces, ethiopia, monkey, chlorocebus djamdjamensis, bale monkey2018-01-16v4No1 / 489
256amnoncommon caecum, left colon, right colon, sus scrofa, pig, united kingdom2017-11-26v4No1 / 490
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay homosexual msm compared to heterosexual msw in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 519
620amnoncommon feces, united states of america, zoological garden, gorilla gorilla, saint louis, saint louis zoo2020-05-06v4No1 / 530
729amnoncommon feces, zoological garden, gorilla gorilla, monkey, captive, europe2021-01-05v3No1 / 542
725amnon high in subgingival plaque subgingival dental plaque compared to mouth mucosa buccal mucosa in homo sapiens adult china municipality of beijing 2021-01-03v3No1 / 544
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in feces homo sapiens child africa 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in feces homo sapiens china )2018-12-30v4No1 / 617
729amnon high in zoological garden captive europe compared to wild cameroon in feces gorilla gorilla monkey 2021-01-05v3No1 / 656
671amnon high in age 3 months compared to age 1 month in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 714
256amnonlower in small intestine compared to colon in pigs ( high in caecum left colon right colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in homo sapiens skin )2018-09-06v4No1 / 854
649amnon high in colon compared to ileum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 897
671amnon high in age 8 months compared to age 3 months age 6 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 955
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
620amnon high in united states of america zoological garden compared to wild republic of congo nouabale-ndoki national park in feces gorilla gorilla gorilla 2020-05-06v4No1 / 1019
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261

Problems / suggestions? Please email info AT dbbact DOT org