Search result for sequence:
TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.672154
feces0.647978
adult0.510092
united states of america0.253303
china0.193494
control0.180972
child0.171884
female0.131339
rural community0.093426
kingdom of spain0.081900
obesity0.079493
research facility0.075401
city0.073303
monkey0.066890
infant0.064016
rumen0.056229
italy0.054444
obsolete_juvenile stage0.054422
germany0.054296
macaca mulatta0.051903
male0.048154
pig0.045710
pregnancy0.045591
south korea0.044689
sus scrofa0.042155
state of california0.041534
high bmi0.041436
india0.038897
kingdom of the netherlands0.038596
heterosexual0.035682
msw0.035682
biopsy0.035587
homosexual0.035524
msm0.035524
amsterdam0.035211
jiangsu province0.035200
ruminal fluid0.034602
captive0.033076
sweden0.032626
taiwan0.032143
age 30-500.032057
guangzhou city prefecture0.031972
state of new york0.030822
skin0.030486
israel0.029032
gay0.028640
LOWER IN crohn's disease0.028623
cameroon0.028571
age 5-13 years0.028571
colombia0.028571
republic of china0.028571
himalayas0.028369
rhesus macaque0.028369
age 50-80 years0.028169
tibetan plateau0.027972
nepal0.027972
zoological garden0.027972
state of colorado0.027586
africa0.027586
biopsy site0.025120
obese body mass index status0.025120
overweight body mass index status0.025067
tanzania0.024911
state of michigan0.024834
crohn's disease0.024605
age0.024605
wild0.023729
hunter gatherer0.021583
age 2-4 years0.021544
estonia0.021544
chuquisaca department0.021429
cayo santiago0.021429
indian rhesus macaque0.021429
russia0.021277
duodenum0.021258
czech republic0.021090
bolivia0.020979
puerto rico0.020979
hiv infection0.020761
farm0.019983
mus musculus0.018721
small village0.018029
age > 1 year0.018029
state of oklahoma0.018002
nigeria0.018002
parkinson's disease0.017975
alpine meadow0.017921
antananarivo0.017921
dairy goat0.017921
egypt0.017921
age 60-790.017921
age 4-10 years0.017921
yak0.017762
madagascar0.017762
shanxi province0.017762
formula fed0.017762
food allergy0.017762
age 1 year0.017710
female organism0.017657
bos grunniens0.017606
Fraction of dbbact annotations with this term covered by the query
TermScore
rural community0.900000
heterosexual0.800000
msw0.800000
gay0.750000
obesity0.750000
biopsy site0.750000
small village0.750000
obese body mass index status0.750000
taiwan0.750000
hunter gatherer0.750000
age > 1 year0.750000
LOWER IN crohn's disease0.727273
biopsy0.714286
cameroon0.666667
tursiops truncatus0.666667
homosexual0.666667
msm0.666667
village0.666667
overweight body mass index status0.666667
state of oklahoma0.666667
age 5-13 years0.666667
nigeria0.666667
nanchang city prefecture0.666667
age 2-4 years0.666667
estonia0.666667
colombia0.666667
republic of china0.666667
age < 3 years0.666667
age 19-240.666667
metabolic syndrome0.666667
age 30-500.666667
age 25-45 years0.666667
sigmoid colon0.666667
venezuela0.666667
amerindian0.666667
india0.625000
pig0.625000
parkinson's disease0.600000
guangzhou city prefecture0.600000
wastewater treatment plant0.600000
pregnancy0.583333
homo sapiens0.577075
sus scrofa0.562500
adult0.544304
feces0.522034
alpine meadow0.500000
ngoantet0.500000
bottlenosed dolphin0.500000
LOWER IN anorexia nervosa0.500000
hmong0.500000
yaounde0.500000
republic of congo0.500000
nouabale-ndoki national park0.500000
myanmar0.500000
karen0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
LOWER IN weight loss0.500000
LOWER IN weight loss diet0.500000
LOWER IN high protein diet0.500000
gaz:000521000.500000
bangui0.500000
antananarivo0.500000
schizophrenia0.500000
chuquisaca department0.500000
bihar state0.500000
acidosis0.500000
dairy goat0.500000
subacute rumen acidosis0.500000
municipality of logrono0.500000
sri lanka0.500000
age 1-18 years0.500000
novosibirsk0.500000
indonesia0.500000
municipality of yogyakarta0.500000
systemic lupus erythematosus0.500000
shuar population0.500000
LOWER IN visceral leishmaniasis0.500000
breast fed0.500000
LOWER IN formula fed0.500000
age 7 months0.500000
kingdom of the netherlands0.500000
amsterdam0.500000
cron diet0.500000
irritable bowel syndrome0.500000
age 200.500000
chepang0.500000
egypt0.500000
bangladesh0.500000
age 60-790.500000
atherosclerosis0.500000
raute0.500000
daycare0.500000
age 1-5 years0.500000
type 2 diabetes mellitus0.500000
caribbean latino0.500000
chengdu city prefecture0.500000
gestational age 8-12 weeks0.500000
municipality of reus0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.854015
homo sapiens0.804745
adult0.479927
united states of america0.270073
china0.166058
control0.138686
child0.105839
female0.082117
research facility0.058394
rural community0.049270
kingdom of spain0.045620
obesity0.041971
city0.040146
monkey0.036496
infant0.034672
rumen0.031022
germany0.031022
italy0.031022
obsolete_juvenile stage0.029197
male0.027372
macaca mulatta0.027372
state of california0.023723
pregnancy0.023723
pig0.023723
south korea0.023723
sus scrofa0.021898
high bmi0.021898
india0.020073
kingdom of the netherlands0.020073
jiangsu province0.020073
ruminal fluid0.018248
sweden0.018248
homosexual0.018248
msm0.018248
biopsy0.018248
amsterdam0.018248
heterosexual0.018248
msw0.018248
captive0.018248
skin0.016423
state of new york0.016423
taiwan0.016423
guangzhou city prefecture0.016423
age 30-500.016423
israel0.016423
tibetan plateau0.014599
cameroon0.014599
gay0.014599
state of colorado0.014599
nepal0.014599
himalayas0.014599
africa0.014599
age 5-13 years0.014599
age 50-80 years0.014599
colombia0.014599
republic of china0.014599
LOWER IN crohn&#39;s disease0.014599
rhesus macaque0.014599
zoological garden0.014599
overweight body mass index status0.012774
biopsy site0.012774
wild0.012774
state of michigan0.012774
obese body mass index status0.012774
crohn's disease0.012774
tanzania0.012774
age0.012774
hiv infection0.010949
bolivia0.010949
chuquisaca department0.010949
russia0.010949
czech republic0.010949
age 2-4 years0.010949
estonia0.010949
hunter gatherer0.010949
mus musculus0.010949
farm0.010949
duodenum0.010949
cayo santiago0.010949
puerto rico0.010949
indian rhesus macaque0.010949
bos grunniens0.009124
yak0.009124
alpine meadow0.009124
thailand0.009124
state of oklahoma0.009124
madagascar0.009124
antananarivo0.009124
state of alabama0.009124
capra hircus0.009124
shanxi province0.009124
goat0.009124
dairy goat0.009124
small village0.009124
nigeria0.009124
parkinson's disease0.009124
belgium0.009124
egypt0.009124
age 60-790.009124
canada0.009124
Exp. ID User ID Description Date Region Flag Sequences
561amnondominant rumen, tibetan plateau, bos grunniens, yak, ruminal fluid, china, alpine meadow2019-11-05v3No1 / 3
594amnondominant feces, homo sapiens, adult, rural community, cameroon, ngoantet2020-03-12v4No1 / 8
79amnondominant united states of america, skin, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 10
2amnon high in control compared to anorexia nervosa in feces homo sapiens 2016-10-05v4No1 / 11
10amnon high in male compared to female in feces homo sapiens toronto 2016-10-27v4No1 / 11
578amnondominant feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 12
556amnondominant feces, homo sapiens, united states of america, adult2019-09-14v1No1 / 12
400amnonhigh freq. in hmong (chinese) females from thailand (dominant feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 13
594amnondominant feces, homo sapiens, city, adult, cameroon, yaounde2020-03-12v4No1 / 13
620amnondominant feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 13
644amnondominant feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 13
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 13
393amnondominant feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 14
400amnonhigh freq. in karen (burma) females from thailand (dominant feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 14
477amnondominant feces, homo sapiens, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 14
721amnonlower in high protein weight loss diet compared to control diet ( high in control diet compared to weight loss weight loss diet high protein diet in feces homo sapiens obesity adult scotland overweight body mass index status gaz:00052100 )2028-05-23v4No1 / 14
693amnondominant feces, homo sapiens, female, adult, austria, graz city district2028-03-16v1No1 / 14
51amnondominant feces, homo sapiens, united states of america2017-01-19v4No1 / 15
74amnondominant feces, homo sapiens, united states of america2017-02-27v4No1 / 15
276amnondominant feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 15
380amnondominant feces, homo sapiens, adult, tibetan plateau, tibet autonomous region2018-10-03v4No1 / 15
409amnondominant homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 15
425amnondominant feces, homo sapiens, child, africa, central african republic, bangui2018-12-08v4No1 / 15
425amnondominant feces, homo sapiens, child, africa, madagascar, antananarivo2018-12-08v4No1 / 15
502amnondominant feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 15
517amnondominant feces, homo sapiens, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 15
651amnondominant feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 15
79amnoncommon united states of america, skin, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 15
570amnondominant feces, homo sapiens, india, bihar state2019-12-16v3No1 / 15
729amnondominant feces, gorilla gorilla, monkey, wild, cameroon2021-01-05v3No1 / 15
787amnoncommon in high grain diet induced subacute acidosis (dominant research facility, rumen, ruminal fluid, acidosis, capra hircus, china, shanxi province, goat, dairy goat, subacute rumen acidosis)2021-05-23v3No1 / 15
51amnondominant homo sapiens, united states of america, biopsy site, biopsy2017-01-19v4No1 / 16
683amnondominant during antibiotics treatment in feces (dominant feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 16
794amnondominant feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 16
656amnondominant feces, homo sapiens, sri lanka, age 1-18 years2020-09-13v3No1 / 16
680amnondominant feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 16
723amnondominant feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 16
532amnondominant feces, homo sapiens, control, adult, czech republic2019-07-21v1No1 / 16
289amnondominant feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 17
290amnondominant feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 17
365amnondominant feces, homo sapiens, child, nigeria, obsolete_juvenile stage2018-08-30v4No1 / 17
368amnondominant feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 17
400amnonhigh freq. in feces of european american females (dominant feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 17
591amnondominant feces, homo sapiens, control, united states of america, adult, age 50-80 years2020-02-17v4No1 / 17
607amnondominant feces, homo sapiens, control, germany2020-04-19v4No1 / 17
660amnondominant feces, homo sapiens, ecuador, rural community, village, shuar population2020-09-20v4No1 / 17
570amnon high in control compared to visceral leishmaniasis in feces homo sapiens india bihar state 2019-12-16v3No1 / 17
630amnondominant feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 17
797amnon high in breast fed compared to formula fed in feces homo sapiens infant germany age 7 months 2021-06-13v3No1 / 17
730amnondominant feces, homo sapiens, control, child, kingdom of the netherlands, amsterdam2021-01-05v1No1 / 17
36amnondominant feces, homo sapiens, sichuan province2016-12-06v4No1 / 18
215amnondominant feces, homo sapiens, united states of america2017-10-23v4No1 / 18
293amnondominant feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 18
294amnondominant feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 18
294amnonhigh freq. in non-IBS healthy controls (dominant feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 18
339amnondominant feces, homo sapiens, adult, india2018-05-24v4No1 / 18
368amnondominant feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 18
428amnondominant feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 18
430amnondominant feces, homo sapiens, united states of america, city, adult, state of arizona, age 202018-12-15v4No1 / 18
477amnondominant feces, homo sapiens, adult, nepal, himalayas, forager, rural community, chepang2019-01-28v4No1 / 18
607amnondominant feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 18
650amnondominant feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 18
663amnondominant feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 18
564amnondominant feces, homo sapiens, control, child, italy, age 2-4 years2019-11-18v3No1 / 18
627amnondominant feces, female, pregnancy, adult, china2020-05-16v3No1 / 18
700amnondominant feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 18
713amnondominant feces, homo sapiens, remission, crohn's disease2028-05-21v3No1 / 18
799amnonhigher before ketogenic diet compared to after ketogenic diet in obese participants ( high in control diet compared to ketogenic diet in feces homo sapiens obesity adult estonia high bmi )2021-06-13v3No1 / 18
799amnondominant in obese participant fecal samples before ketogenic diet (dominant feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 18
799amnondominant in obese participant fecal samples after 1 month ketogenic diet (dominant feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 18
62amnondominant feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 19
121amnondominant feces, homo sapiens, adult, bangladesh2017-04-13v4No1 / 19
292amnondominant feces, homo sapiens, control, adult, china2018-02-05v4No1 / 19
401amnondominant feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 19
404amnondominant feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 19
438amnondominant feces, homo sapiens, adult, jiangsu province, age 60-79, china2018-12-30v4No1 / 19
449amnondominant feces, homo sapiens, colombia2019-01-09v4No1 / 19
455amnondominant feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 19
477amnondominant feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 19
477amnondominant feces, homo sapiens, nepal, himalayas, rural community, raute2019-01-29v4No1 / 19
482amnondominant feces, homo sapiens, child, colombia, medellin metropolitan area, daycare, age 1-5 years2019-02-12v4No1 / 19
516amnondominant feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 19
803amnondominant feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, age 50-80 years, type 2 diabetes mellitus, caribbean latino2021-06-18v4No1 / 19
574amnondominant feces, homo sapiens, adult, russia2020-01-05v3No1 / 19
637amnondominant feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 19
732amnondominant feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 19
736amnondominant feces, homo sapiens, female, adult, tanzania, pemba island2021-01-25v3No1 / 19
736amnondominant feces, homo sapiens, child, tanzania, age 1-3 years, pemba island2021-01-25v3No1 / 19
757amnondominant feces, homo sapiens, adult, brazil, santa catarina state2021-03-28v3No1 / 19
796amnondominant feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 19
190amnonlower in Hadza camp Hukamako compared to hadza camp Sengeli ( high in camp sengeli compared to camp hukamako in feces homo sapiens tanzania hunter gatherer hadza )2017-09-04v4No1 / 20
197amnondominant feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 132017-09-12v4No1 / 20
238amnondominant feces, homo sapiens, colombia2017-11-07v4No1 / 20
242amnonhigh freq. in native-americans (dominant feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 20
344amnonhigh freq. in feces of homosexual males (dominant feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 20
390amnondominant feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 20
394amnondominant feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 20
409amnondominant homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 20
477amnondominant feces, homo sapiens, raji, nepal, himalayas, rural community2019-01-29v4No1 / 20
484amnondominant feces, homo sapiens, united states of america, adult, state of michigan, age 17-292019-02-13v4No1 / 20
629amnondominant feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 20
629amnondominant feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 20
650amnondominant feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 20
803amnondominant feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, age 50-80 years, caribbean latino2021-06-18v4No1 / 20
333amnonhigh freq. in healthy controls feces (dominant feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 20
564amnondominant feces, homo sapiens, autistic disorder, child, italy, age 2-4 years2019-11-18v3No1 / 20
578amnondominant feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 20
122amnondominant feces, homo sapiens, united kingdom2017-04-13v4No1 / 21
240amnonhigh freq. in infants age <3 years (dominant feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 21
247amnondominant feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 21
249amnondominant feces, homo sapiens, united states of america2017-11-22v4No1 / 21
320amnondominant feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 21
330amnondominant feces, homo sapiens, adult, kingdom of norway, oslo, age 30-402018-05-13v4No1 / 21
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child jordan obsolete_juvenile stage 2018-08-30v4No1 / 21
393amnondominant feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 21
398amnonhigh freq. in feces of healthy adults from belgium (dominant feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 21
404amnon high in normal stool compared to hard stool in feces homo sapiens city adult columbia 2018-11-20v4No1 / 21
409amnondominant feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 21
591amnondominant feces, homo sapiens, united states of america, adult, age 50-80 years, parkinson's disease2020-02-17v4No1 / 21
607amnondominant feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 21
794amnondominant feces, homo sapiens, hiv infection, adult, kingdom of spain, human immunodeficiency virus infectious disease, municipality of logrono, antiretroviral therapy2021-06-08v4No1 / 21
814amnondominant feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 21
575amnonhigh freq. in professional martial arts athletes (dominant feces, homo sapiens, adult, high physical activity, age 19-24, china, athlete)2020-01-05v3No1 / 21
593amnondominant feces, homo sapiens, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 21
597amnondominant feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 21
720amnondominant feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 21
120amnondominant feces, homo sapiens, brazil2017-04-12v4No1 / 22
284amnondominant feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 22
293amnondominant feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 22
297amnondominant feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 22
467amnondominant feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 22
502amnondominant feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 22
629amnondominant feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 22
650amnondominant feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 22
333amnonhigh freq. in stroke patient feces (dominant feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 22
552amnondominant feces, homo sapiens, czech republic2019-09-05v3No1 / 22
593amnondominant feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 22
655amnondominant in patients before hematopoietic stem cell transplant (dominant feces, homo sapiens, italy, before hsct)2020-09-13v3No1 / 22
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, systemic lupus erythematosus, china2028-04-11v3No1 / 22
797amnondominant feces, homo sapiens, child, germany, formula fed, age 2 years2021-06-13v3No1 / 22
10amnondominant feces, homo sapiens, toronto2016-10-27v4No1 / 23
53amnondominant feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 23
73amnondominant feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 23
132amnondominant feces, homo sapiens, united states of america2017-04-16v4No1 / 23
197amnondominant feces, homo sapiens, juvenile organism, obsolete_juvenile stage, age 13, india2017-09-12v4No1 / 23
241amnonhigh freq. in babies age < 3 years in russia (dominant feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 23
241amnonhigh freq. in babies age < 3 years in estonia (dominant feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 23
312amnondominant feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 23
344amnonhigh freq. in feces of heterosexuals (dominant feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 23
394amnondominant feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 23
487amnondominant feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 23
509amnondominant feces, homo sapiens, child, nigeria, kebbi state, rural community, age 10-15 years, schistosomiasis, urinary schistosomiasis2019-03-18v4No1 / 23
601amnondominant feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 23
669amnondominant feces, homo sapiens, infant, sweden, age 1 year2020-09-26v4No1 / 23
666amnondominant feces, homo sapiens, italy2020-09-25v3No1 / 23
694amnondominant feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 23
713amnondominant feces, homo sapiens, crohn's disease, active disease2028-05-21v3No1 / 23
734amnondominant feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 23
239amnondominant feces, homo sapiens, united states of america2017-11-08v4No1 / 24
395amnondominant feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 24
566amnondominant feces, homo sapiens, adult, china2019-11-24v4No1 / 24
580amnondominant feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 24
643amnondominant feces, homo sapiens, adult, south korea2020-08-30v4No1 / 24
683amnondominant feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 24
713amnoncommon feces, homo sapiens, crohn's disease, active disease2028-05-21v3No1 / 24
745amnondominant feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 24
532amnoncommon feces, homo sapiens, adult, czech republic, short bowel syndrome2019-07-21v1No1 / 24
53amnondominant feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 25
290amnondominant feces, homo sapiens, city, adult, china2018-02-01v4No1 / 25
580amnondominant feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 25
683amnoncommon during antibiotics treatment in feces (common feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 25
721amnondominant feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 25
721amnon high in high fiber fiber diet compared to weight loss weight loss diet high protein diet in feces homo sapiens obesity adult scotland overweight body mass index status gaz:00052100 2028-05-23v4No1 / 25
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, china2028-04-11v3No1 / 25
796amnondominant feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 25
797amnondominant feces, homo sapiens, infant, germany, age 1 year, formula fed2021-06-13v3No1 / 25
62amnondominant feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 26
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens united states of america rectum biopsy site child biopsy )2018-11-22v4No1 / 26
438amnondominant feces, homo sapiens, adult, jiangsu province, age 30-50, china2018-12-30v4No1 / 26
802amnondominant feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 26
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 26
131amnondominant feces, homo sapiens, south korea2017-04-16v4No1 / 27
438amnondominant feces, homo sapiens, child, jiangsu province, age 8-12, china2018-12-30v4No1 / 27
601amnondominant feces, homo sapiens, control, adult, china2020-03-30v4No1 / 27
695amnondominant feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 27
319amnondominant feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 28
365amnondominant feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 28
562amnondominant feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 28
438amnondominant feces, homo sapiens, jiangsu province, age 13-14, china2018-12-30v4No1 / 29
724amnon high in non-pregnant compared to pregnancy pregnancy trimester 2 in homo sapiens female vagina adult egypt ismailia age 25-45 years 2021-01-03v3No1 / 29
284amnoncommon feces, homo sapiens, female, infant, state of california, age 1 year2018-01-27v4No1 / 30
320amnoncommon feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 30
438amnondominant feces, homo sapiens, child, jiangsu province, age 3-6, china2018-12-30v4No1 / 30
591amnon high in control compared to parkinson's disease in feces homo sapiens united states of america adult age 50-80 years 2020-02-17v4No1 / 30
695amnondominant feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 30
544amnoncommon united states of america, commonwealth of massachusetts, vaccinium macrocarpon, american cranberry, botanical fruit food product2019-08-04v4No1 / 31
651amnon high in male compared to female in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 31
681amnondominant feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 31
131amnon high in male compared to female in feces homo sapiens south korea 2017-04-16v4No1 / 34
12amnon high in control compared to chronic fatigue syndrome in feces homo sapiens new york county 2016-11-02v4No1 / 35
561amnon high in green stage diet spring compared to winter withered grass diet in rumen tibetan plateau bos grunniens yak ruminal fluid china alpine meadow 2019-11-05v3No1 / 35
51amnoncommon homo sapiens, united states of america, biopsy site, biopsy2017-01-19v4No1 / 36
219amnonhigher in pre-weaning compared to post-weaning in mouse feces ( high in breast milk age age 21 days compared to mouse chow age 28 days in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v4No1 / 36
191amnonlower in preterm birth vaginal samples ( high in control compared to premature birth in homo sapiens united states of america female pregnancy vagina )2017-09-05v4No1 / 37
233amnon high in age age > 1 year compared to age < 1 year in feces homo sapiens united states of america infant 2017-11-05v4No1 / 37
814amnonlower after 2 months of caloric restriction diet ( high in control diet compared to caloric restriction diet in feces homo sapiens female obesity adult obese body mass index status germany high bmi overweight body mass index status age 50-70 years )2021-06-30v4No1 / 37
681amnoncommon feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 37
390amnoncommon feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 38
74amnonHigher in plant diet compared to animal product diet ( high in diet plant diet compared to animal product diet in feces homo sapiens united states of america )2017-02-27v4No1 / 39
526amnoncommon in bile of healthy controls (common homo sapiens, control, bile, gallbladder, adult, kingdom of spain)2019-07-14v3No1 / 39
19amnoncommon in biopsies of children (IBD study) (common homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 40
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 41
352amnoncommon feces, homo sapiens, new delhi, india2018-07-30v4No1 / 41
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, age 2-4 years2019-11-18v3No1 / 42
36amnoncommon feces, homo sapiens, sichuan province2016-12-06v4No1 / 44
241amnoncommon in babies age < 3 years in russia (common feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 44
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one year2018-01-14v4No1 / 46
570amnoncommon feces, homo sapiens, india, bihar state2019-12-16v3No1 / 46
597amnoncommon feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 46
797amnoncommon feces, homo sapiens, child, germany, formula fed, age 2 years2021-06-13v3No1 / 46
482amnoncommon feces, homo sapiens, child, colombia, medellin metropolitan area, daycare, age 1-5 years2019-02-12v4No1 / 47
591amnoncommon feces, homo sapiens, united states of america, adult, age 50-80 years, parkinson's disease2020-02-17v4No1 / 47
720amnoncommon feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 48
651amnoncommon feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 49
121amnoncommon feces, homo sapiens, adult, bangladesh2017-04-13v4No1 / 50
564amnoncommon feces, homo sapiens, control, child, italy, age 2-4 years2019-11-18v3No1 / 50
796amnoncommon feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 51
730amnoncommon feces, homo sapiens, child, kingdom of the netherlands, amsterdam, crohn's disease2021-01-05v1No1 / 51
650amnoncommon feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 52
651amnon high in control compared to parkinson's disease in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 52
694amnoncommon feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 52
796amnoncommon feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 52
730amnon high in control compared to crohn's disease in feces homo sapiens child kingdom of the netherlands amsterdam 2021-01-05v1No1 / 52
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
814amnoncommon feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, systemic lupus erythematosus, china2028-04-11v3No1 / 55
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
368amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
591amnoncommon feces, homo sapiens, control, united states of america, adult, age 50-80 years2020-02-17v4No1 / 56
650amnoncommon feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 56
720amnoncommon feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 56
651amnoncommon feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 58
666amnoncommon feces, homo sapiens, italy2020-09-25v3No1 / 58
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 60
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in diet american diet compared to cron diet caloric restriction diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 61
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
637amnoncommon feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 61
593amnoncommon feces, homo sapiens, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
380amnoncommon feces, homo sapiens, adult, tibetan plateau, tibet autonomous region2018-10-03v4No1 / 63
502amnoncommon feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 63
575amnoncommon in professional martial arts athletes (common feces, homo sapiens, adult, high physical activity, age 19-24, china, athlete)2020-01-05v3No1 / 63
242amnoncommon in native-americans (common feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 65
365amnoncommon feces, homo sapiens, child, nigeria, obsolete_juvenile stage2018-08-30v4No1 / 66
650amnoncommon feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 66
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
365amnoncommon feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 67
757amnoncommon feces, homo sapiens, adult, brazil, santa catarina state2021-03-28v3No1 / 67
574amnoncommon feces, homo sapiens, adult, russia2020-01-05v3No1 / 68
593amnoncommon feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 68
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 4 weeks2018-11-04v4No1 / 71
644amnoncommon feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 71
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, switzerland2020-09-22v4No1 / 71
656amnoncommon feces, homo sapiens, sri lanka, age 1-18 years2020-09-13v3No1 / 71
425amnoncommon feces, homo sapiens, child, africa, madagascar, antananarivo2018-12-08v4No1 / 73
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 74
395amnoncommon feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 75
794amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, human immunodeficiency virus infectious disease, municipality of logrono, antiretroviral therapy2021-06-08v4No1 / 75
74amnoncommon feces, homo sapiens, united states of america2017-02-27v4No1 / 76
477amnoncommon feces, homo sapiens, nepal, himalayas, rural community, raute2019-01-29v4No1 / 76
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, age 17-292019-02-13v4No1 / 76
666amnoncommon feces, tursiops truncatus, italy, rectal swab, common bottlenose dolphin2020-09-25v3No1 / 76
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 77
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 77
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
556amnoncommon feces, homo sapiens, united states of america, adult2019-09-14v1No1 / 77
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
401amnoncommon feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 79
425amnoncommon feces, homo sapiens, child, africa, central african republic, bangui2018-12-08v4No1 / 79
732amnoncommon feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 79
736amnon high in female adult compared to child age 1-3 years in feces homo sapiens tanzania pemba island 2021-01-25v3No1 / 79
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 80
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
339amnoncommon feces, homo sapiens, adult, india2018-05-24v4No1 / 81
643amnoncommon feces, homo sapiens, adult, south korea2020-08-30v4No1 / 81
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 82
562amnoncommon feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 82
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, age 30-50, china2028-04-11v3No1 / 82
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 83
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 85
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
601amnoncommon feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 85
663amnoncommon feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 85
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
249amnoncommon feces, homo sapiens, united states of america2017-11-22v4No1 / 86
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 86
319amnoncommon homo sapiens, united states of america, saliva, state of texas2018-04-18v4No1 / 87
344amnoncommon in feces of homosexual males (common feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 87
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, age 202018-12-15v4No1 / 87
477amnoncommon feces, homo sapiens, raji, nepal, himalayas, rural community2019-01-29v4No1 / 88
487amnoncommon feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 88
293amnoncommon feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 89
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 89
803amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, age 50-80 years, caribbean latino2021-06-18v4No1 / 89
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 94
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 95
723amnonhigher in children age 2-4 years compared to mothers ( high in child age 2-4 years compared to adult in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 95
736amnoncommon feces, homo sapiens, female, adult, tanzania, pemba island2021-01-25v3No1 / 95
238amnoncommon feces, homo sapiens, colombia2017-11-07v4No1 / 96
787amnonhigher in first 2 hours compared to 5-6 hours following eating ( high in 1-2 hours compared to 5-6 hours in research facility rumen ruminal fluid capra hircus china shanxi province goat dairy goat )2021-05-23v3No1 / 96
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 97
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, forager, rural community, chepang2019-01-28v4No1 / 97
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 97
730amnoncommon feces, homo sapiens, control, child, kingdom of the netherlands, amsterdam2021-01-05v1No1 / 97
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
532amnoncommon feces, homo sapiens, control, adult, czech republic2019-07-21v1No1 / 98
455amnoncommon homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 100
438amnoncommon feces, homo sapiens, age 19-24, china2018-12-30v4No1 / 101
425amnon high in madagascar antananarivo compared to central african republic bangui in homo sapiens duodenum child africa 2018-12-08v4No1 / 103
477amnoncommon feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 103
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
693amnoncommon feces, homo sapiens, female, adult, austria, graz city district2028-03-16v1No1 / 104
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china2018-12-30v4No1 / 106
797amnon high in age 1 year compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
695amnon high in milk allergy compared to sesame allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 107
409amnoncommon feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 108
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in feces homo sapiens united states of america child )2018-11-22v4No1 / 110
770amnoncommon macaca mulatta, age > 1 year, penis, male organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 110
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 60-79, china2018-12-30v4No1 / 111
770amnon high in infant age < 1 year compared to age 10-15 years adult organism in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 111
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 112
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
517amnoncommon feces, homo sapiens, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, adult, jiangsu province, age 30-50, china2018-12-30v4No1 / 115
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, age 6 months, captive, rhesus macaque2020-09-27v4No1 / 117
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
212amnoncommon feces, control, united states of america, research facility, mus musculus, lean body mass, mouse2017-10-22v4No1 / 120
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china2018-12-30v4No1 / 121
517amnoncommon homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 121
425amnoncommon homo sapiens, duodenum, child, africa, madagascar, antananarivo2018-12-08v4No1 / 123
660amnoncommon feces, homo sapiens, ecuador, rural community, village, shuar population2020-09-20v4No1 / 123
449amnoncommon feces, homo sapiens, colombia2019-01-09v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to child obsolete_juvenile stage crohn's disease in feces homo sapiens glasgow )2017-02-26v4No1 / 125
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 125
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 126
779amnon high in control compared to crohn's disease in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 127
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, age 30-402018-05-13v4No1 / 130
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
39amnoncommon in obese lepr-db mice (common feces, research facility, mus musculus, obesity)2016-12-09v4No1 / 132
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 132
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 132017-09-12v4No1 / 136
594amnoncommon feces, homo sapiens, adult, rural community, cameroon, ngoantet2020-03-12v4No1 / 136
212amnoncommon feces, united states of america, research facility, mus musculus, obese body mass index status, mouse, db/db mouse, obesity2017-10-22v4No1 / 137
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
770amnon high in vagina female organism compared to penis male organism in macaca mulatta age > 1 year cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america )2017-04-11v4No1 / 139
797amnon high in child age 2 years compared to infant age 1 year in feces homo sapiens germany formula fed 2021-06-13v3No1 / 139
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 140
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 141
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 145
509amnoncommon feces, homo sapiens, child, nigeria, kebbi state, rural community, age 10-15 years, schistosomiasis, urinary schistosomiasis2019-03-18v4No1 / 146
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
509amnoncommon feces, homo sapiens, control, child, nigeria, kebbi state, rural community, age 10-15 years2019-03-18v4No1 / 147
780amnon high in small intestine duodenum jejunum compared to caecum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 153
594amnoncommon feces, homo sapiens, city, adult, cameroon, yaounde2020-03-12v4No1 / 154
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, bile, gallbladder, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens adult china 2018-02-05v4No1 / 161
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years2018-02-12v4No1 / 162
700amnoncommon feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 164
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
389amnon high in age 4 weeks compared to age 1-3 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 168
190amnoncommon feces, homo sapiens, tanzania, hunter gatherer, hadza2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
770amnoncommon vagina, macaca mulatta, age > 1 year, female organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 169
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, age 13, india2017-09-12v4No1 / 170
671amnoncommon feces, united states of america, research facility, macaca mulatta, age 3 months, monkey, captive, rhesus macaque2020-09-27v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in feces homo sapiens infant )2017-11-13v4No1 / 173
179amnoncommon united states of america, research facility, oral cavity, mus musculus, balb/c, mouse, mouth2017-08-13v4No1 / 183
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
402amnon high in zone 1 compared to zone 2,3 in mine tailing sediment soil guangxi zhuang autonomous region alkaline mine tailing china 2018-11-18v4No1 / 189
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
620amnoncommon feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 197
411amnoncommon feces, zambia, monkey, wild, papio kindae, kinda baboon2018-11-23v4No1 / 200
6amnoncommon homo sapiens, urine, female, pregnancy, state of tennessee2016-10-13v4No1 / 201
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in feces homo sapiens china )2018-12-30v4No1 / 203
787amnonhigher in excess grain induced rumen acidosis compared to healthy controls ( high in acidosis subacute rumen acidosis compared to control in research facility rumen ruminal fluid capra hircus china shanxi province goat dairy goat )2021-05-23v3No1 / 207
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
669amnon high in age 1 year compared to age 2 months in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v3No1 / 214
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
666amnoncommon feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 223
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
673amnon high in ascending colon caecum compared to ileum in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v4No1 / 228
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, age 50-60 years, nephrolithiasis, china)2018-01-27v4No1 / 239
666amnoncommon feces, italy, tapirus terrestris, south american tapir2020-09-25v3No1 / 242
483amnoncommon united states of america, research facility, hawaii, pearl harbor, hydroides elegans, tubeworm, shelled egg2019-02-13v4No1 / 243
161amnoncommon in barn swallows in colorado (common feces, united states of america, hirundo rustica, colorado, barn swallow)2017-07-12v4No1 / 245
398amnon high in control compared to crohn's disease in feces homo sapiens belgium 2018-11-15v4No1 / 248
425amnon high in madagascar antananarivo compared to central african republic bangui in feces homo sapiens child africa 2018-12-08v4No1 / 248
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
219amnoncommon in mother mice feces (common feces, female, research facility, mus musculus, c57bl/6, mouse, south korea)2017-10-24v4No1 / 250
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, age 8 months2020-09-27v4No1 / 252
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in feces homo sapiens infant india )2016-12-19v4No1 / 253
561amnon high in summer grass growth diet compared to green stage diet spring in rumen tibetan plateau bos grunniens yak ruminal fluid china alpine meadow 2019-11-05v3No1 / 256
63amnon high in male compared to female in feces homo sapiens united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 263
688amnoncommon feces, research facility, sus scrofa, nanchang city prefecture, pig, china, duroc pig, age 140 days2028-03-09v4No1 / 278
770amnoncommon feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 280
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, age 50-60 years, china)2018-01-27v4No1 / 281
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 288
551amnon high in diet clover hay diet compared to fresh clover diet in rumen adult egypt camel camelus dromedarius 2019-08-27v3No1 / 291
411amnoncommon feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 292
561amnon high in summer grass growth diet compared to winter withered grass diet in rumen tibetan plateau bos grunniens yak ruminal fluid china alpine meadow 2019-11-05v3No1 / 294
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
723amnon high in age 2-4 years compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
190amnon high in dry season compared to wet season in feces homo sapiens tanzania hunter gatherer hadza 2017-09-04v4No1 / 311
510amnoncommon estuary, water, fresh water, kingdom of spain, estuary water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
729amnoncommon feces, gorilla gorilla, monkey, wild, cameroon2021-01-05v3No1 / 321
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in myanmar karen compared to hmong china in feces homo sapiens thailand rural community )2018-11-18v4No1 / 329
532amnon high in control compared to short bowel syndrome in feces homo sapiens adult czech republic 2019-07-21v1No1 / 334
729amnoncommon feces, monkey, wild, pan troglodytes troglodytes, cameroon, central chimpanzee2021-01-05v3No1 / 336
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
666amnoncommon feces, equus caballus, italy, horse2020-09-25v3No1 / 341
729amnoncommon feces, zoological garden, monkey, europe, pan troglodytes verus, western chimpanzee2021-01-05v3No1 / 343
671amnon high in state of california compared to state of oregon in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 355
254amnonhigher in river when close to populated region compared to downstream ( high in populated place city upstream compared to downstream in river water fresh water fujian province depth 0.5m jiulong river china )2017-11-23v4No1 / 356
671amnoncommon feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 356
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chicago, chimpanzee, lincoln park zoo2020-05-06v4No1 / 358
565amnoncommon zoological garden, skin, captive, canada, african lion safari, macropus rufus, red kangaroo2019-11-21v3No1 / 360
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in feces papio zambia monkey baboon 2018-11-23v4No1 / 364
551amnoncommon rumen, adult, egypt, camel, camelus dromedarius2019-08-27v3No1 / 370
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
816amnonhigher in sows in first pregnancy compared to later pregnancies ( high in first pregnancy compared to multiple pregnancies in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 374
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
729amnon high in wild cameroon compared to zoological garden captive europe in feces gorilla gorilla monkey 2021-01-05v3No1 / 383
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
770amnoncommon feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 396
399amnoncommon feces, united states of america, state of tennessee, zoological garden, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon feces, united states of america, state of tennessee, zoological garden, pan troglodytes, chimpanzee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
781amnoncommon feces, kenya, wild, loxodonta africana, masai mara national park, elephant2021-04-28v4No1 / 419
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
666amnoncommon feces, italy, lama guanicoe2020-09-25v3No1 / 437
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, grivet monkey2018-01-16v4No1 / 440
75amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 442
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, vervet monkey2018-01-16v4No1 / 446
666amnoncommon feces, italy, equus asinus africanus, equus asinus, donkey2020-09-25v3No1 / 450
424amnoncommon feces, farm, sus scrofa, jinhua city prefecture, pig, jinhua pig, china2018-12-06v4No1 / 452
339amnon high in adult compared to infant age < 1 year in feces homo sapiens india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
787amnoncommon in high grain diet induced subacute acidosis (common research facility, rumen, ruminal fluid, acidosis, capra hircus, china, shanxi province, goat, dairy goat, subacute rumen acidosis)2021-05-23v3No1 / 463
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
438amnon high in adult age 30-50 age 60-79 compared to child age 3-6 age 8-12 in feces homo sapiens china 2018-12-30v4No1 / 486
274amnoncommon feces, ethiopia, monkey, chlorocebus djamdjamensis, bale monkey2018-01-16v4No1 / 489
729amnoncommon feces, zoological garden, gorilla gorilla, monkey, captive, europe2021-01-05v3No1 / 542
273amnon high in age age one year compared to age one month in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in feces homo sapiens infant finland )2017-11-12v4No1 / 567
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, china, spring)2017-07-12v4No1 / 573
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 606
603amnoncommon in baijiu fermentation pit mud in later batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 180-270)2020-04-05v3No1 / 608
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in feces homo sapiens china )2018-12-30v4No1 / 617
200amnoncommon in river downstream of wastewater treatment plant (common united states of america, river, water, fresh water, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
561amnoncommon rumen, tibetan plateau, bos grunniens, yak, ruminal fluid, china, alpine meadow2019-11-05v3No1 / 670
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned corn and soybean diet age 4-7 weeks compared to suckling preweaned age 2-4 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 681
666amnoncommon feces, italy, equus asinus africanus, african wild ass2020-09-25v3No1 / 683
787amnoncommon control, research facility, rumen, ruminal fluid, capra hircus, china, shanxi province, goat, dairy goat2021-05-23v3No1 / 700
671amnon high in age 3 months compared to age 1 month in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 714
666amnoncommon feces, italy, equus ferus, wild horse2020-09-25v3No1 / 715
752sheryoCommon in soil planted with Panax notoginseng (common soil, yunnan province, ph 6, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 730
735amnoncommon female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, restricted feed, sheep, female organism, china2021-01-22v3No1 / 744
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
83amnoncommon rumen, bos taurus, ireland, holstein-friesian bull2017-03-05v4No1 / 757
735amnoncommon control, female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, sheep, female organism, china2021-01-22v3No1 / 761
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common soil, yunnan province, ph 6, biochar, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 783
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in homo sapiens skin )2018-09-06v4No1 / 854
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in leaf maryland county )2016-12-09v4No1 / 950
701amnoncommon research facility, rumen, bos taurus, male, cow, rumen liquid, male organism, china, municipality of beijing, age 2 years2028-04-01v3No1 / 953
671amnon high in age 8 months compared to age 3 months age 6 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 955
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
83amnon high in control diet normal diet compared to restricted diet in rumen bos taurus ireland holstein-friesian bull 2017-03-05v4No1 / 1023
252amnoncommon in river sand biofilm (common river, biofilm, sand, kingdom of spain)2017-11-22v4No1 / 1181
40amnoncommon soil, field soil, rhizosphere, nicotiana tabacum, china2016-12-09v4No1 / 1420
783sheryocommon in desert soil in mongolia under water addition treatment (common soil, mongolia, sandy desert, bajada, china, dengkou county, ph 7.85, ulan buh desert, cambic arenosols, luvic gypsisols, water addition, 100% above ambient precipitation)2021-05-11v4No1 / 1442
18amnon high in equus przewalskii compared to equus caballus in feces 2016-11-14v4No1 / 1542
819amnon high in skin of cheek compared to scalp in homo sapiens female skin adult china age 25-45 years 2021-07-12v1No1 / 1684
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162

Problems / suggestions? Please email info AT dbbact DOT org